Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 1998 Aug;36(8):2397.

Detection of Cilia-Associated Respiratory Bacillus by PCR

Diane D Cundiff 1, Cynthia Besch-Williford 1, Reuel R Hook Jr 1, Craig L Franklin 1, Lela K Riley 1
PMCID: PMC105065

Volume 32, no. 8, p. 1930–1934, 1994. Page 1931, Table 1: The sequence and position of primer gap403 should read “CATGTAGCGGTGAAATGCTCAGA” and “620-642,” respectively, and the sequence of primer RF141 should read “TTAAAGCTCCGGCGCTCGAA.”


Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES