Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function

Abstract

Dysfunction of visceral smooth muscle (“visceral myopathy”) impairs bowel, bladder, and uterine function. Symptoms of this life-threatening condition include massive intestinal distension with slow transit, vomiting, feeding intolerance, growth failure, poor bladder emptying, and difficult vaginal delivery. The most common genetic cause of visceral myopathy is a heterozygous point mutation (R257C) in gamma smooth muscle actin (ACTG2). We genetically modified the WAe0009-A human embryonic stem cell line to carry the c.769C>T p.R257C/+ mutation. This cell line will facilitate studies of how the ACTG2 R257C heterozygous variant affects smooth muscle development and function.

1. Resource utility

This is the first gene-edited ACTG2 mutant hESC line published. This heterozygous ACTG2 R257C mutation causes life-threatening visceral myopathy. These cells will be a valuable resource to define how this mutation affects smooth muscle cell biology and development (see Table 1).

Table 1.

Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography	Normal	Fig. 1A
Pluripotency status evidence for the described cell line	Qualitative analysis (i.e.Immunocytochemistry, western blotting)	Nuclear localization of OCT 3/4	Fig. 1B
	Quantitative analysis (i.e. Flow cytometry, RT-qPCR)	NANOG: 97.9%; OCT3/4: 94.4%; SOX2: 99.3%; Tra 1–60/1–81: 97.5%; SSEA-3/4: 98.5	Fig. 1B and 1C
Karyotype	Karyotype (G-banding) and resolution	46XX, Resolution 500	Fig. 1D
Genotyping for the desired genomic alteration/allelic status of the gene of interest	PCR across the edited site or targeted allele-specific PCR	Presence of ACTG2 c.769C>T confirmed	Fig. 1E
	Evaluation of the - (homo-/hetero-/hemi-) zygous status of introduced genomic alteration(s)	Confirmation of heterozygous ACTG2 c.769C>T insertion	Fig. 1F
	Transgene-specific PCR (when applicable)	N/A	N/A
Verification of the absence of random plasmid integration events	PCR	PCR amplification verifies no integration of plasmid backbone sequence	Supp Fig. 1
Parental and modified cell line genetic identity evidence	Microsatellite PCR (mPCR) OR	N/A	N/A
	STR analysis	24 sites tested	Submitted in archive with journal
Mutagenesis / genetic modification outcome analysis	Sequencing (genomic DNA PCR or RT-PCR product)	DNA PCR across edited site followed by Sanger Sequencing	Fig. 1E
	PCR-based analyses	N/A	N/A
	Southern Blot or WGS; western blotting (for knock-outs, KOs)	N/A	N/A
Off-target nuclease activity analysis	PCR across top 5/10 predicted top likely off-target sites, whole genome/exome sequencing	N/A	N/A
Specific pathogen-free status	Mycoplasma	Mycoplasma testing by RT-PCR. Negative	Supp Fig. 2
Multilineage differentiation potential	Directed differentiation	Proof of three germ layer formation:Ectoderm: FOXG1, PAX6Endoderm: SOX17, FOXA2Mesoderm: HAND1, CD144	Fig. 1G
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	N/A	N/A
Genotype - additional histocompatibility info (OPTIONAL)	Blood group genotyping	N/A	N/A
	HLA tissue typing	N/A	N/A

2. Resource details

Gamma smooth muscle actin (ACTG2) is encoded by one of 6 actin isoforms. Heterozygous point mutations in ACTG2 cause visceral myopathy, a potentially deadly human disease characterized by profound weakness of smooth muscle in the bowel, bladder, and uterus. The most common disease-causing mutation is ACTG2 R257C, the variant engineered in this cell line. People with ACTG2 R257C mutations have myopathic chronic intestinal pseudo-obstruction (CIPO) with very dilated bowel, slow transit of bowel intraluminal contents, vomiting, and growth failure. They typically need intravenous nutrition, at least intermittently, to survive. In addition, affected individuals usually have a dilated bladder that empties inefficiently and uterine muscle dysfunction. In its most severe form, intrauterine disease impairs colon growth, a condition called Megacystis Microcolon Intestinal Hypoperistalsis Syndrome (MMIHS) that may lead to death during childhood. Current therapies are only supportive. This gene edited hESC line was generated to facilitate studies of disease mechanisms that could lead to new treatments or cures.

CRISPR-Cas9 gene editing was used to introduce a heterozygous ACTG2 R257C mutation in human embryonic stem cells (H9-hESCs; WAe0009-A). Data represent one of two independent clones that were expanded and characterized. Colonies were screened for characteristic morphology (Fig. 1A) and expression of intracellular (Fig. 1B) and extracellular (Fig. 1C) stemness markers. A normal karyotype was demonstrated by G-band analysis (Fig. 1D) and DNA fingerprinting by STR analysis confirmed the genetic authenticity of the line. The expected c.769C>T substitution for the ACTG2 R257C heterozygous mutation was confirmed by Sanger sequencing (Fig. 1E). BclI restriction digest of the PCR-amplified region around the C>T substitution confirmed insertion of a single targeted mutant allele with preservation of a WT allele (Fig. 1F). The cell line lacked genomic integration of CRISPR-Cas9 and guide RNA plasmid vectors as confirmed by PCR (Supp Fig. 1) and tested negative for mycoplasma (Supp Fig. 2). Pluripotency was confirmed by directed differentiation to the three germ layers and analysis of surface markers by flow cytometry (Fig. 1G).

Fig. 1.

Characterization of CHOPe003-A ESC line.

3. Materials and methods

3.1. CRISPR-Cas9-mediated gene editing

Guide RNA (gRNA) sequences were chosen with CRISPR Guide RNA Design tool (https://benchling.com, 2018) and cloned into Addgene_41824 using previously established methods (Maguire et al., 2022). Single-stranded oligonucleotides (200 bp ultramers; 4 nmol; Integrated DNA Technologies) served as repair templates. The R257C mutant oligonucleotide sequence contained the c.769C>T point mutation, a silent mutation creating a unique BclI restriction site in addition to a mutated PAM site and three silent gRNA binding site mutations (see Table 2).

Table 2.

Reagents details.

Antibodies and stains used for immunocytochemistry/flow-cytometry				RRID
	Antibody	Dilution	Company Cat #
Pluripotency Markers	Mouse anti-Oct3/4 (C-10)	1:200	Santa Cruz #sc-5297	RRID:AB_628051
	Rabbit anti-Nanog (D73G4)	1:400	Cell Signaling #4903S	RRID:AB_10559205
	Rabbit anti-Nanog (D73G4)	1:300	Cell Signaling #3579S	RRID:AB_2195767
	Rabbit anti-Sox2 (D6D9)	1:50	Biolegend #330306	RRID:AB_1279440
	AF488 anti-human SSEA-3	1:400	Biolegend #330408	RRID:AB_1089200
	AF647 anti-human SSEA-4	1:100	Biolegend #330614	RRID:AB_2119064
	AF488 anti-human Tra-1–60	1:50	Biolegend #330706	RRID:AB_1089242
	AF647 anti-human Tra-1–81	1:50	Biolegend #301910	RRID:AB_493257
	AF488 anti-human CD15 (SSEA-1)	1:200	Biolegend #355210	RRID:AB_2562013
Differentiation Markers	PE Mouse anti-human Sox17	1:25	BD #561591	RRID:AB_10717121
	Mouse anti-human FoxA2	1:100	Santa Cruz #sc-101060	RRID:AB_1124660
	Rabbit anti-FOXG1	1:300	Abcam #196868	RRID:AB_2892604
	AF647 anti-human PAX6	1:20	BD #562249	RRID:AB_2644844
	Mouse anti-Hand1	1:200	Novus #NBP2–00576	RRID:AB_2877685
	CD144 APC	1:20	eBioscience #17–1449–42	RRID:AB_10804754
Secondary antibodies	Goat anti-mouse IgG2a-AF647	1:400	Jackson Immunoresearch #115–605–206	RRID:AB_2338917
	Goat anti-rabbit IgG-AF488	1:400	Jackson Immunoresearch #111–545–144	RRID: AB_2338052
	Goat anti-mouse IgG2b-AF488	1:400	Jackson Immunoresearch #115–545–207	RRID:AB_2338856
Nuclear stain	Hoechst33342, DAPI	1 μg/mL	Cell Signalling Technology #4082	N/A
	DAPI	N/A	Vector Laboratories	N/A
Site-specific nuclease
Nuclease information	human codon-optimized Cas9 nuclease from S. pyogenes	RRID:Addgene_44719		Delivery method: Lipofection (Lipofectamine Stem), Enrichment strategy: FACS for GFP expression
	BclI-HF restriction endonucleases	New England Biolabs #R3160S		N/A
Primers and Oligonucleotides used in this study
Episomal plasmids	RRID:Addgene_41824	gRNA expression vector
	RRID:Addgene_44719	Cas9-GFP plasmid
Targeted mutation analysis/Sanger sequencing	ACTG2 exon 8 R257C screen (501 bp region)	GAAGGAGGTTTTCATGGAGATCAA / CTGTTCTGCTTTTCCTGTATCTTG
Genomic editing	200 bp ssDNA oligonucleotide repair template with ACTG2 c.769C>T mutation	CCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAAGTGATCACCATT GGCAATGAGCGCTTCTGCTGCCCTGAGACCCTCTTCCAGCCTTCATTCATA GGTGAGATGCTGCCCACAGTCCCTGCCAATCTCAGGAGGGGAGGGTGGAG GAGTGGGTGAGGTATGGAGAGAGAAACACCAGGAGTCATGGCCACTTTG
	200 bp ssDNA oligonucleotide repair template with ACTG2 wild-type sequence	CCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAAGTTATCACCATTG GCAATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCATTCATA GGTGAGATGCTGCCCACAGTCCCTGCCAATCTCAGGAGGGGAGGGTGG AGGAGTGGGTGAGGTATGGAGAGAGAAACACCAGGAGTCATGGCCACTTTG
	gRNA sequence with homology arms targeting ACTG2 locus, used with RRID:Addgene_41824	TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCAGCCTTCCTTTATTGGTG/ GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCACCAATAAAGGAAGGCTGC
Genomic target sequence	Genomic location of ACTG2/c.769C>T	chr2:73914835–73914835
	Genomic location of gRNA binding site	chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG)
Bioinformatic gRNA design tool used	Benchling (2018)	https://www.benchling.com/crispr
Mycoplasma Detection	16S Ribosomal RNA (518 bp)	CGCCTGAGTAGTACGTTCGC / GCGGTGTGTACAAGACCCGA
	GAPDH (internal control) (150 bp)	GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT
Verification of the absence of random plasmid integration events	Kanamycin (RRID:Addgene_41824) (340 bp)	CAGACAATCGGCTGCTCTGA / ATGCGATGTTTCGCTTGGTG
	Ampicillin (RRID:Addgene_44719) (230 bp)	TTGTTGCCGGGAAGCTAGAG / TGATAACACTGCGGCCAACT
	GAPDH (internal control) (150 bp)	GTGGACCTGACCTGCCGTCT / GGAGGAGTGGGTGTCGCTGT

The h9-hESCs (WAe0009-A; WiCell, Madison, WI) were transfected (Lipofectamine Stem; Thermo Fisher Scientific, #STEM00001) as previously described (Maguire et al., 2022). Briefly, Addgene_44719 and modified Addgene_41824, R257C and WT repair template were added in a 1:1 ratio (0.0521 μg of each ssODN/cm² of plate surface area). Transfected cells were maintained in DMEM/F12 (80%) supplemented with knockout serum replacement (20%), glutamine (1%), non-essential amino acids (1%), penicillin/streptomycin (1%), beta-mercaptoethanol (0.1 mM), bFGF (10 ng/ml) at 37 °C, 5% CO2, 5% O2, 90 % N2. Medium was replenished every 2–3 days for 3–4 weeks until uniform colonies were mechanically isolated for expansion on MEFs.

3.2. Mutation verification

PCR amplification with GoTaq Green Master Mix (Promega, #PRM7122) was performed on genomic DNA extracted by proteinase K digest (100 μg/ml; QIAGEN, #19133) of individual colonies using the following parameters: 95 °C × 2 min, 35 cycles (95 °C × 1 min, 56 °C × 45 s, 72 °C × 30 s), 72 °C × 5 min, and 4 °C hold. The PCR product was purified, analyzed by Sanger sequencing, and digested with BclI restriction enzyme. Digested products were visualized by agarose gel electrophoresis. Heterozygous mutation corresponded to the presence of three bands: uncut band (501 bp) and two cut bands (215 bp and 286 bp).

3.3. Flow cytometry and immunocytochemistry

TrypLE-dissociated cells were analyzed using a CytoFLEX flow cytometer (Beckman Coulter) and FlowJo software program (BD Biosciences). For cell surface stemness markers, cells were incubated with the appropriate antibody combinations for 15–30 min at room temperature. For intracellular markers, cells were permeabilized with saponin buffer and incubated with primary and secondary antibodies for 30 min at room temperature. Unstained samples were used as negative controls. Immunocytochemistry was performed as previously described (Maguire et al., 2019). Cells were imaged with a Leica DMI4000 B inverted fluorescent microscope.

3.4. STR and karyotype analyses

DNA fingerprinting and G-band analyses were performed by Cell Line Genetics. Twenty cells in metaphase were counted and 7 were analyzed with a 500 G resolution reported as good.

3.5. Trilineage differentiation

For mesoderm and endoderm differentiation, cells were grown on MEFs and transitioned to feeder free conditions in mTeSR1 while cells grown in feeder free conditions were used for ectoderm differentiation. Mesoderm (Mills et al., 2014), endoderm (Mukherjee et al., 2021), and ectoderm (Dawicki-McKenna et al., 2023) differentiations were performed as previously described. Cells were harvested on day 4 for mesoderm, day 3 for endoderm, and day 8 for ectoderm.

3.6. Mycoplasma

PCR analysis for mycoplasma was performed as previously described (Maguire et al., 2019).

3.7. Verification of absence of random genomic plasmid integration

PCR amplification with KAPA2G Hotstart Genotyping Mix (Roche, #KK7352) was performed on plasmid DNA and genomic DNA extracted by DNeasy Blood & Tissue Kit (Qiagen, #69504) with the following parameters: 95 °C × 3 min, 30 cycles (98 °C × 20 s, 60 °C × 15 s, 72 °C × 20 s), 72 °C ×5 min, and 4 °C hold. The PCR products were visualized by agarose gel electrophoresis.

Resource Table:

Unique stem cell line identifier	CHOPe003-A
Alternative name(s) of stem cell line	H9-ACTG2-R257C
Institution	The Children’s Hospital of Philadelphia, Philadelphia, PA USA
Contact information of the reported cell line distributor	Deborah L. French, frenchd@email.chop.edu
Type of cell line	ESC
Origin	Human
Additional origin info (applicable for human ESC or iPSC)	Age: N/A Sex: N/A
Cell Source	N/A
Method of reprogramming	N/A
Clonality	Clonal
Evidence of the reprogramming transgene loss (including genomic copy if applicable)	N/A
The cell culture system used	MEFs followed by feeder-free conditions during expansion after CRISPR/Cas9 gene editing
Type of the Genetic Modification	CRISPR/Cas9 gene edited C>T nucleotide substitution to create R257C amino acid substitution
Associated disease	Visceral myopathy (OMIM#155310, 619350), MMIHS (OMIM#619431, 619351, 619365, 249210)
Gene/locus	ACTG2/ c.769C>T
Method of modification/user-customisable nuclease (UCN) used, the resource used for design optimisation	CRISPR/Cas9
User-customisable nuclease (UCN) delivery method	Plasmid transfection
All double-stranded DNA genetic material molecules introduced into the cells	Cas9-GFP plasmid, guide RNA expression vector, 200 bp single-stranded oligonucleotides
Analysis of the nuclease-targeted allele status	Sanger sequencing of the targeted allele, PCR for both alleles followed by restriction digest with BclI for the untargeted allele
Method of the off-target nuclease activity prediction and surveillance	None
Descriptive name of the transgene	ACTG2 R257C
Eukaryotic selective agent resistance cassettes (including inducible, gene/ cell type-specific)	N/A
Inducible/constitutive expression system details	N/A
Date archived/stock creation date	May 2022
Cell line repository/bank	https://hpscreg.eu/cell-line/CHOPe003-A
Ethical/GMO work approvals	H9 hESCs were obtained from WiCell
	Research Institute on 06/20/2018, with a WiCell “Simple Letter Agreement” being signed (No. 19-W0008)
Addgene/public access repository recombinant DNA sources’ disclaimers (if applicable)	RRID:Addgene_41824RRID: Addgene_44719

Data availability

Data will be made available on request.