Protocols for transgenesis at a safe harbor site in the Xenopus laevis genome using CRISPR-Cas9

Summary

We have established a new transgenesis protocol based on CRISPR-Cas9, “New and Easy XenopusTransgenesis (NEXTrans),” and identified a novel safe harbor site in African clawed frogs, Xenopus laevis. We describe steps in detail for the construction of NEXTrans plasmid and guide RNA, CRISPR-Cas9-mediated NEXTrans plasmid integration into the locus, and its validation by genomic PCR. This improved strategy allows us to simply generate transgenic animals that stably express the transgene.

For complete details on the use and execution of this protocol, please refer to Shibata et al. (2022).¹

Graphical abstract

Highlights

• •CRISPR-Cas9-based transgenesis into a novel safe harbor site in X. laevis
• •Faithful reporter transgene expression in a promoter-/enhancer-specific manner
• •Germline transmission of F1 siblings stably expressing reporter transgene

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

We have established a new transgenesis protocol based on CRISPR-Cas9, “New and Easy XenopusTransgenesis (NEXTrans),” and identified a novel safe harbor site in African clawed frogs, Xenopus laevis. We describe steps in detail for the construction of NEXTrans plasmid and guide RNA, CRISPR-Cas9-mediated NEXTrans plasmid integration into the locus, and its validation by genomic PCR. This improved strategy allows us to simply generate transgenic animals that stably express the transgene.

Before you begin

We have established a targeted transgenesis method for Xenopus laevis, named NEXTrans (New and Easy Xenopus Transgenesis), using CRISPR-Cas9 (Figure 1).¹ NEXTrans is a non-homologous end joining (NHEJ)-based targeted transgenesis method that generates transgenic X. laevis by co-injecting a preset NEXTrans plasmid that includes a 665-bp tgfbr2l.L fragment, recombinant Cas9 protein, and single guide RNA (sgRNA), which targets tgfbr2l, into fertilized eggs (Figure 2).

Figure 1.

Schematic comparison of the principle of transgenesis using REMI, I-SceI, and NEXTrans methods

Transgenic plasmids are randomly incorporated at multiple loci in the Xenopus laevis genome by the restriction enzyme-mediated integration (REMI)² and meganuclease (I-SceI)-mediated³ transgenesis methods, whereas the NEXTrans plasmid with CRISPR-Cas9 is integrated into a novel safe harbor site, the tgfbr2l locus.

Figure 2.

Schematic representation of NEXTrans (New and Easy Xenopus Transgenesis) at a novel harbor site

The NEXTrans plasmid carrying the transgene cassette is co-injected into fertilized Xenopus laevis eggs with Cas9 RNP targeting the tgfbr2l.L and tgfbr2l.S loci (exon 4). The plasmid integrates into the target sites in the zygotic genome in a forward and/or reverse direction by NHEJ repair during the early embryonic stage and can be detected by PCR. Primer pairs were used for PCR genotyping to detect the Tg(NEXT-fgk:egfp) integration as follows: primers 1 and 5 for tgfbr2l.L forward insertion, primers 2 and 5 for tgfbr2l.L reverse insertion, primers 3 and 5 for tgfbr2l.S forward insertion, and primers 4 and 5 for tgfbr2l.S reverse direction (see key resources table).

Transgenesis by target integration has been applied in state-of-the-art strategies that have been used in animals after the post-genome era. They include cell tracking analyses, such as Cre/loxP and DNA barcoding system; large-scale and robust reporter assays; and functional analysis by strictly regulating the expression of transgenes, such as the Tet/On or optogenetic strategies.^4,5,6,7,8 Controlling the copy number of the transgenes is required for these methods. Therefore, safe harbor transgenesis, such as that at the Rosa26 locus in mouse,^9,10 is essential to establish transgenic animals in which the copy number can be controlled in Xenopus research. The biggest advantage of NEXTrans based on a safe harbor site is that it allows the implementation of these state-of-the-art technologies in Xenopus research. Additionally, because the NEXTrans plasmid, Tg(NEXT-fgk:egfp), is now available, researchers can easily construct transgenic plasmids by replacing the cDNA cassette that contains the desired promoter/enhancer and gene of interest sequence with the fgk-egfp counterpart or by subcloning the 665-bp tgfbr2l.L fragment directly into another plasmid.

Institutional permissions

All animal care was approved by the Institutional Animal Care and Use Committee of the National Institutes of Natural Sciences and University of Hyogo.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins
Human chorionic gonadotropin (HCG) (3,000 U/glass ampoule)	ASKA Animal Health	N/A
Serotropin (1,000 U/glass ampoule)	ASKA Animal Health	N/A
Penicillin-Streptomycin (10,000 U/mL)	Gibco	Cat#15140-122
Ficoll 400	Sigma-Aldrich	Cat#F4375
L-cysteine	Sigma-Aldrich	Cat#C7352
Agarose	Sigma-Aldrich	Cat#A4718
Ethyl 3-aminobenzoate methanesulfonate (MS222)	Sigma-Aldrich	Cat#E10521
10N NaOH	Nacalai Tesque	Cat#94611-45
Alt-R S.p. Cas9 nuclease 3NLS	IDT	Cat#1081058
Mineral oil	Sigma-Aldrich	Cat#M8410
2M KCl	Thermo Scientific	Cat#AM9640G
NaCl	Wako	Cat#191-01665
MgCl2・6H2O	Nacalai Tesque	Cat#20909-55
CaCl2・2H2O	Nacalai Tesque	Cat#06730-15
HEPES	Sigma-Aldrich	Cat#H4034
NaHCO3	Sigma-Aldrich	Cat#S7277-250G
Nuclease-free water	Thermo Scientific	Cat#AM9938
Critical commercial assays
High-fidelity PCR enzyme, KOD FX Neo	Toyobo	Cat#KFX-201
High-fidelity PCR enzyme, KOD One	Toyobo	Cat#KMM-101
QIAquick PCR Purification Kit	Qiagen	Cat#28104
In-Fusion HD cloning Kit	Takara Bio	Cat#639649
CUGA®7 gRNA Synthesis Kit	Nippon Gene	Cat#314-08691
DNeasy Blood & Tissue Kit	Qiagen	Cat#69504
GeneJET Plasmid Miniprep Kit	Thermo Scientific	Cat#FERK0502
D5000 Reagents	Agilent	Cat#5067-5589
D5000 Screen Tape	Agilent	Cat#5067-5588
Experimental models: Organisms/strains
Xenopus laevis (wild type, adult, male and female)	National Institute of Basic Biology, Japan	N/A
Oligonucleotides
In-Fusion tgfbr2l.L forward 5′-ACCTAAATTGTAAGCTGATTCTG TGGATAACCGTATTACC-3′	This paper	N/A
In-Fusion tgfbr2l.L reverse 5′-ATCTCGGTCTATTCTGGAATTCC ACAAGGGGTACA-3′	This paper	N/A
cmv:tdtomato forward 5′-AGAATAGACCGAGATAGGGTTGAGT-3′	This paper	N/A
cmv:tdtomato reverse 5′-GCTTACAATTTAGGTGGCACTTTTC-3′	This paper	N/A
sgRNA PCR primer 1 5′-AAAAGCACCGACTCGGTGCCA CTTTTTCAAGTT GATAACGGACTA GCCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC-3′	Shibata et al.1	N/A
sgRNA PCR primer 2 5′-TAATACGACTCACTATAGGAGCC TTTGGGTCCGATACGTTTTAGAGCT AGAAATAGCAAG-3′	Shibata et al.1	N/A
Primer 1(tgfbr2l.L forward direction) 5′-AAATATGGCACCTCCCTTCCAT-3′	This paper	N/A
Primer 2 (tgfbr2l.L reverse direction) 5′-TTGGTGCTCTTGATGTCCCG-3′	This paper	N/A
Primer 3 (tgfbr2l.S forward direction) 5′-AAACATTGACAAGAGTTGAACAGTG-3′	This paper	N/A
Primer 4 (tgfbr2l.S reverse direction) 5′-CACCACATGGGGTACAGTCA-3′	This paper	N/A
Primer 5 (eGFP) 5′-CAGGATGTTGCCGTCCTCCTT GAAGTCGAT-3′	This paper	N/A
Recombinant DNA
Tg(NEXT-fgk:egfp)	Shibata et al.1	N/A
Tg(NEXT-cmv:tdtomato)	Shibata et al.1	N/A
Tg(NEXT-cryga:tdtomato)	Shibata et al.1	N/A
pCS2-cmv:tdtomato	Shibata et al.1	N/A
Software and Algorithms
Primer3	Untergasser et al.11	https://bioinfo.ut.ee/primer3-0.4.0/
ImageJ Fiji	Schindelin et al.12	https://imagej.nih.gov/ij/
Other
Microinjector	Drummond Scientific	Cat#3-000-204
Micromanipulator	Drummond Scientific	Cat#3-000-024-R
Microneedle (3.5-inch glass capillaries)	Drummond Scientific	Cat#3-000-203-G/X
Stereomicroscope	Zeiss	STEMI 305
Fluorescent stereomicroscope	Leica	MZ10F
Puller for microneedles	Narishige	PN-31
100 mm Petri dish	SANPLATEC	Cat#TCD-100N
Gel electrophoresis equipment	Advance	M-2P
4150 TapeStation	Agilent	Cat#G2992AA
NanoDrop Lite	Thermo Scientific	Cat#ND-LITE-PR
PCR thermal cycler	Applied Biosystems	Cat#A37834

Materials and equipment

10× Marc’s Modified Ringer’s (MMR) stock solution

Reagent		Final concentration	Amount
NaCl		1 M	58.44 g
2M KCl		20 mM	10 mL
MgCl2・6H2O		10 mM	2.03 g
CaCl2・2H2O		20 mM	2.94 g
HEPES		50 mM	11.92 g
Deionized water		N/A	Up to 1 L
Total		N/A	1 L

Note: Adjust the solution to pH 7.4. Then sterilize with an autoclave or 0.2 μm filter. Store at 25°C for up to 1 year.

0.1× MMR solution

Reagent	Final concentration	Amount
10× MMR	0.1× MMR	10 mL
Penicillin-Streptomycin	10 U/mL	1 mL
Deionized water	N/A	Up to 1 L
Total	N/A	1 L

Note: Prepare this solution just before use. Store at 4°C for up to 1 month.

Injection medium

Reagent	Final concentration	Amount
10× MMR	0.3× MMR	15 mL
Ficoll 400	5% (w/v)	25 g
Penicillin-Streptomycin	10 U/mL	500 μL
Deionized water	N/A	Up to 500 mL
Total	N/A	500 mL

Note: Sterilize the medium with 0.2 μm filter. Store at 4°C for up to 1 month.

De-jellying solution

Reagent	Final concentration	Amount
10× MMR	0.1× MMR	500 μL
L-cysteine	2% (w/v)	1 g
Deionized water	N/A	Up to 50 mL
Total	N/A	50 mL

Note: Adjust the solution to pH 7.8 with 10 N NaOH.

CRITICAL: Prepare the solution just before use.

10× Cas9 buffer stock solution

Reagent	Final concentration	Amount
2 M KCl	1.5 M	150 μL
1 M HEPES	0.2 M	40 μL
Nuclease free water	N/A	10 μL
Total	N/A	200 μL

Note: Prepare this stock solution under Rnase-free conditions. Store at −20°C for up to 1 year.

0.2% Ethyl 3-aminobenzoate methanesulfonate (MS222) solution

Reagent	Final concentration	Amount
MS222	0.2% (w/v)	2 g
NaHCO3	16.7 mM	1.4 g
Dechlorinated water	N/A	Up to 1 L
Total	N/A	1 L

Note: Store at 25°C for up to 1 month.

• •1 M HEPES solution: add 23.8 g HEPES to 100 mL of deionized water and adjust to pH 7.5 with 10 N NaOH. Then sterilize with a 0.2 μm filter.

Store at 25°C for up to 1 year.

• •100 U/μL Human Chorionic Gonadotropin (HCG) solution: dissolve HCG in 3 mL of 0.6% NaCl solution (supplied).

Store at −20°C for up to 1 year.

• •0.2 U/μL Serotropin solution: dissolve Serotropin in 5 mL of 0.6% NaCl solution (supplied).

Store at −20°C for up to 1 year.

• •Injection plate: 100-mm petri dish coated with 1% agarose dissolved in 0.3× MMR.

Store at 4°C for up to 1 month.

Step-by-step method details

Preparation of NEXTrans transgenic plasmid

Timing: 1 week

This section describes in detail for the construction of the NEXTrans plasmid.

• 1.
  Clone the DNA fragment including the 665-bp tgfbr2l.L genome fragment amplified from the NEXTrans plasmid (e.g., Tg(NEXT-fgk:egfp)) into the plasmid needed to generate transgenic Xenopus using standard plasmid construction methods. The following step-by-step method summarizes the method for Tg(NEXT-cmv:tdtomato) construction as example.

  Note: For example, the In-Fusion HD Cloning Kit; https://www.takarabio.com/assets/a/112472.

  Alternatives: Construct a transgenic plasmid by replacing the DNA cassette with the desired promoter/enhancer or cDNA of the gene of interest sequence with the fgk-egfp cassette in Tg(NEXT-fgk:egfp).

  • a.
    Design two primer sets in the prepared host plasmid for inverse PCR (cmv:tdtomato forward and reverse primer) and the inserted DNA fragment including the 665-bp tgfbr2l.L fragment (In-fusion tgfbr2l forward and reverse primer) (see key resources table).
  • b.
    Amplify host plasmid DNA by inverse PCR and the tgfbr2l fragment with KOD One DNA polymerase (Toyobo; Cat#KMM-101).

    PCR reaction master mix

    Reagent	Amount
    2× KOD One master mix	25.0 μL
    Plasmid DNA (up to 50 ng)	X μL
    Forward primer (10 μM)	1.5 μL
    Reverse primer (10 μM)	1.5 μL
    Nuclease free water	22-X μL
    Total	50 μL

    PCR cycling conditions

    Steps	Temperature	Time	Cycles
    Denaturation	98°C	10 s	10–20 cycles
    Annealing	60°C	5 s
    Extension	68°C	1 or 25 s
    Hold	4°C	Forever

    Note: The extension time depends on the PCR product size; i.e., approximately . <1 kb, 1 sec; 1–10 kb, 5 sec/kb.

  • c.
    Confirm the PCR product size by electrophoresis. In this case, 768 bp of the inserted genome DNA fragment containing the 665-bp tgfbr2l.L fragment from Tg(NEXT-fgk:egfp) and 5194 bp of the pCS2 host plasmid containing the cmv promoter and tdtomato cDNA fragments were amplified.
  • d.
    Purify the PCR products using a PCR purification kit (Qiagen; Cat#28104) following the manufacturer’s instructions (https://www.qiagen.com/jp/landing-pages/microbiome-rna-research-workflow/sample-disruption/qiaquick-pcr-purification-kit/).
  • e.
    Elute the PCR product with 30–50 μL of nuclease-free water.

    Pause point: The purified PCR product can be stored at −20°C for subsequent experiments.

  • f.
    Mix the following reagents to obtain a 10 μL reaction mixture.

    Reagents	Amount
    Purified pCS2 host plasmid (154 ng/μL)	1 μL
    Purified tgfbr2l DNA fragment (46 ng/μL)	1 μL
    5× In-Fusion HD Enzyme Premix	2 μL
    Nuclease free water	6 μL
    Total	10 μL

  • g.
    Incubate the reaction mixture for 15 min at 50°C.

    Note: Details may change depending upon the desired gene of interest and plasmid size and concentration.

• 2.
  After transformation, confirm the plasmid insert sequence by PCR and Sanger sequencing.

  • a.
    Design some primer sets in the host plasmid and the inserted DNA fragment.
  • b.
    Confirm the PCR product size by electrophoresis.
  • c.
    DNA sequencing (in-house or outsourced).
• 3.Use a plasmid DNA extraction kit to isolate plasmid DNA (Thermo Scientific; Cat#FERK0502) following the manufacturer’s instructions (https://www.fishersci.com/shop/products/fermentas-genejet-plasmid-miniprep-kit/FERK0502).
• 4.Purify the plasmid DNA using a PCR purification kit (Qiagen; Cat#28104) following the manufacturer’s instructions.

Note: This step is performed to avoid residues of ethyl alcohol, RNAases, and surfactants that can affect the viability of the injected embryos.

• 5.Elute the DNA in 30–50 μL of nuclease-free water.

Pause point: The purified plasmid DNA can be stored at −20°C for subsequent experiments.

In vitro synthesis of sgRNA targeting the tgfbr2l locus

Timing: 5 h

This section describes the amplification of template DNA and sgRNA synthesis.

• 6.Prepare the following oligonucleotide set^13,14 : sgRNA PCR primer 1 (5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′); sgRNA PCR primer 2 (5′-TAATACGACTCACTATAGGAGCCTTTGGGTCCGATACGTTTTAGAGCTAGAAATAGCAAG-3′). Underlined sequence is the T7 promoter and bold sequence is the tgfbr2l target sequence. Only this sgRNA set is used for targeted integration of the construct into the Xenopus genome during the NEXTrans procedure.
• 7.Amplify the template by PCR according to the PCR-based sgRNA preparation strategy. We recommend using KOD FX Neo DNA polymerase (Toyobo; Cat#KFX-201).

PCR reaction master mix

Reagent	Amount
2× KOD FX Neo buffer	40.0 μL
KOD FX neo	1.2 μL
100 μM sgRNA PCR primer 1	1.5 μL
100 μM sgRNA PCR primer 2	1.5 μL
2 mM dNTP	16.0 μL
Nuclease free water	19.8 μL
Total	80.0 μL

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	94°C	5 min	1
Denaturation	94°C	20 s	10–15 cycles
Annealing	60°C	30 s
Extension	68°C	15 s
Final extension	68°C	1 min	1
Hold	4°C	forever

• 8.
  Purify the PCR products using a PCR purification kit (Qiagen; Cat#28104). Elute the PCR product with 30–50 μL of nuclease-free water.

  • a.
    Check the specificity of the amplification by agarose electrophoresis; PCR product size should be 117 bp.
  • b.
    Quantitate the concentration using a spectrophotometer (NanoDrop).

Pause point: The purified PCR product can be stored at −20°C for subsequent experiments.

• 9.
  Synthesize and purify the sgRNA using an in vitro transcription kit based on T7 RNA polymerase (e.g., Nippon Gene; Cat#314-08691) following the manufacturer’s instructions.

  • a.
    Mix the following reagents to obtain a 20 μL reaction mixture.

    Reagents	Amount
    Template DNA (150–200 ng)	X μL
    5× Transcription buffer	4 μL
    0.1 M DTT	2 μL
    NTP mix	6 μL
    CUGA7 Enzyme (T7 RNA polymerase) solution	1 μL
    Nuclease free water	7-X μL
    Total	20 μL

  • b.
    Incubate the reaction mixture at 37°C for 2.5 h.
  • c.
    Add 2 μL of DNase I.

    Note: Make sure to add the DNase after transcription to remove the template DNA.

  • d.
    Incubate at 37°C for 15 min.
  • e.
    Add 578 μL of sgRNA binding buffer.
  • f.
    Transfer 600 μL of the solution to a spin column (supplied) for purification.
  • g.
    Centrifuge at 13,000 × g for 1 min at 4°C.
  • h.
    Remove the supernatant and add 750 μL of gRNA wash buffer.
  • i.
    Centrifuge at 13,000 × g for 1 min at 4°C.
  • j.
    Remove the supernatant and centrifuge at 13,000 × g for 1 min at 4°C.
  • k.
    Elute sgRNA with 30–50 μL of nuclease-free water.
• 10.Quantify the concentration. Normally, 50–100 μg of sgRNA is synthesized. Divide the sgRNA into aliquots in the nuclease-free tubes. troubleshooting 1.

Pause point: The sgRNA can be stored in aliquots at −80°C until it is ready to be used for injection mixture preparation (step 22).

Preparation of in vitro fertilization eggs

Timing: 3 days

This section describes how to obtain fertilized eggs and preparation of injection mixture.

• 11.Inject 30 U (150 μL) of Serotropin into females 2–3 days before use.

CRITICAL: The egg quality is the most important factor for successfully generating transgenic animals.

• 12.The day before fertilization, inject 450 U (450 μL) and 100 U (100 μL) of HCG into females and males, respectively. Keep all animals at 18°C thereafter. In our case, we injected the hormone 20 h prior to the desired time for egg laying.
• 13.
  Sperm preparation.

  • a.
    On the morning of the injection, deeply anesthetize two males by submersion in a bath of 0.2% MS222 for 15–30 min.
  • b.
    After euthanasia, isolate the testes and keep them in a 1.5-mL tube on ice.
  • c.
    Just before egg collection, grind gently one side of the testes from the two males with a pestle and approximately 1 mL of 1× MMR.
• 14.Collect 300–500 eggs by gently squeezing from two to three females and keep them in separate sterile Petri dishes.
• 15.Add sperm solution to each plate and mix gently with pipette tips. Leave for 5 min at 18°C.

CRITICAL: Start the count-up timer immediately to record the precise time after in vitro fertilization, because the injection step must be finished in the period 1–1.5 h after in vitro fertilization to reduce mosaicism.

• 16.Soak the dish with 0.1× MMR for 15 min at 18°C.
• 17.De-jelly the embryos with de-jelling solution containing L-cysteine within 3 min.
• 18.Rinse the embryos with 0.1× MMR several times.
• 19.Transfer the embryos into pre-cooled 0.1× MMR (11°C).
• 20.Keep the embryos at a low temperature (11°C) to delay the first cleavage.

Note: To reduce mosaicism, inject Cas9 Ribonucleoprotein (RNP) before the first cleavage.

CRITICAL: The first cleavage should occur after 2–2.5 h of incubation at 11°C. The embryos must be kept at 11°C in an incubator to control their development.

• 21.Dilute stock Cas9 protein to 1 μg/μL with 1× Cas9 buffer just before use.
• 22.Preparation of injection mixture. After transferring the embryos into an incubator, add 0.46 μL of 10× Cas9 buffer, 1 μL of Cas9 protein in 1× Cas9 buffer (1 μg/μL), 200 ng of sgRNA targeting tgfbr2l, and 50 ng of NEXTrans plasmid targeting tgfbr2l, and adjust the volume to 4.6 μL with nuclease-free water. The final concentration per egg is 1 ng of Cas9, 200 pg of sgRNA, 50 pg of NEXTrans plasmid. The Cas9 RNP and NEXTrans plasmid mixture must be kept at 25°C for at least 15 min. Prepare just before use.

Injection of Cas9 RNP and NEXTrans plasmid into fertilized eggs

Timing: 30 min for 400–500 embryos

This section describes the injection setup, dose, and rearing method after injection.

• 23.Make 3–6 lines of V-shaped grooves on an agarose-coated injection plate using a blade and align the fertilized eggs (embryos) on it. The eggs can be placed in any way during injection (e.g., agarose-coated dish or nylon grid).
• 24.Prepare the microneedles using a needle puller (Narishige; model PN-31) with the following settings: magnet main 60, magnet sub 20, and heater 86.8. Break off the tip of the glass needle with fine tweezers. Then, set up a microinjector and fill the microneedles with 1–2 μL of injection mixture containing Cas9 RNP and NEXTrans plasmid.

CRITICAL: The needles must be fine to efficiently perform injections for genome editing.

• 25.After 1 h of total incubation from in vitro fertilization, inject 4.6 nL of the pre-mixed Cas9 RNP and NEXTrans plasmid into the embryos. Complete the injections within 30–40 min.

CRITICAL: We recommend that this injection step be completed 1–1.5 h after in vitro fertilization. We found that injection in this period was the most efficient way of obtaining transgenic animals.

• 26.Incubate embryos at 18°C for 3–5 h in a Petri dish with injection medium.
• 27.Select injected embryos by transferring the embryos to 0.1× MMR at the morula or blastula stage because injection medium disturbs gastrulation, then store at 18°C. Using a fresh plate and rinsing multiple times are also recommended. Select normally developing embryos. troubleshooting 2.

CRITICAL: Avoid a high density of embryos on the Petri dish (100 mm) for embryo health (up to 100 embryos in the same dish). The next day, transfer the embryos at 20°C and keep them until they reach stage 45; normally 3–4 days is needed.

CRITICAL: To improve the development rate, the 0.1× MMR must be changed every day and dead and abnormally developing embryos should be removed.

• 28.Select the injected embryos with reporter gene expression. In the case of Xla.Tg(NEXT-fgk:egfp), strong GFP signals were observed in the tail and gill at stage 45 (Figure 3A). The developmental stage can be judged by Nieuwkoop (1967).¹⁵ troubleshooting 3.

Figure 3.

Representative transgenic X. laevis founders generated by NEXTrans

(A) Representative photograph of eGFP signals in Xla.Tg(NEXT-fgk:egfp) in a promoter/enhancer manner. Strong eGFP signals were detected in the fin and gill.

(B) Mosaic transgenic Xla.Tg(NEXT-fgk:egfp) embryo expressing eGFP only in the fin edge.

(C) Representative photograph of ubiquitous tdTomato signals in Xla.Tg(NEXT-cmv:tdtomato). Strong tdTomato signals were detected in the whole body.

(D) Half-transgenic Xla.Tg(NEXT-cmv:tdtomato) embryo expressing tdTomato signals only on one side of the body.

(E) Representative photograph of tdTomato signals in Xla.Tg(NEXT-cryga:tdtomato) in a promoter/enhancer manner.

(F) Fully transgenic Xla.Tg(NEXT-cryga:tdtomato) with tdTomato signals detected in both eyes completed the metamorphosis normally. Arrows indicate tdTomato signals in the eye; arrowheads indicate the gill; double arrowheads indicate the edge of the tail fin. Scale bars = 1 mm for (A–E) and 5 mm for (F).

Germline transmission

Timing: within approximately 1 year

This section describes the housing condition of transgenic X. laevis embryos.

• 29.Rear the transgenic animals until sexual maturation.

Note: We recommend keeping the embryos that exhibit strong transgene expression in the gill and tail region, not those with half-transgenesis or spotted ectopic expression, for the case of Tg(NEXT-fgk:egfp). In our case, we kept the transgenic animals in dechlorinated water at approximately 26°C for 8–9 months to accelerate animal growth.

CRITICAL: Rear the embryos and froglets before sexual maturation at approximately 26°C. According to the housing method, it is recommended that X. laevis adults are reared at 18°C to maintain egg and sperm quality. However, low-temperature rearing delays the growth and sexual maturation of the embryos and young froglets.

• 30.After 8–9 months, transfer all transgenic frogs to dechlorinated water at 18 °C at least 1 month before use.
• 31.Obtain the F₁ siblings by crossing sexually mature transgenic males and wild-type females using in vitro fertilization or natural mating.¹⁶

CRITICAL: We recommend using sexually mature transgenic males to generate F₁ siblings because males reach sexual maturity faster than females.

• 32.Check the transgene expression in the F₁ siblings. In the case of Tg(NEXT-fgk:egfp), eGFP-positive signals can be clearly seen in the gill and tail fin until stage 45. troubleshooting 4.

Genotyping by PCR

Timing: 6 h

This section describes a method for detecting the transgene by genomic PCR in F₁ embryos.

• 33.Rear reporter expressing F₁ embryos to the stage at which the phenotype is to be evaluated and collect samples individually.
• 34.Deeply anesthetize the embryos with 0.01% MS222 in 0.1x MMR, then euthanatize them for genomic DNA (gDNA) extraction.
• 35.Extract gDNA from each sample using a silica column-based DNA purification kit (Qiagen; Cat#69504) as per the manufacturer’s instructions. https://www.qiagen.com/nl/resources/download.aspx?id=68f29296-5a9f-40fa-8b3d-1c148d0b3030&lang=en
• 36.Elute gDNA with 30–50 μL of elution buffer, then use 1 μL for the following PCR genotyping template. Normally, 5–10 μg of gDNA is extracted from each embryo at stage 45.

Pause point: The gDNA can be stored at −20°C for subsequent experiments.

• 37.For the case of Tg(NEXT-fgk:egfp), the NEXTrans plasmid can be integrated into the tgfbr2l.L and/or tgfbr2l.S locus in both directions, giving a total of four possible patterns due to NHEJ-mediated integration. Prepare PCR primers (primers 1–4) designed for each locus (host genome) region and a common primer (primer 5) designed for the eGFP (transgene) region in the NEXTrans plasmid to detect the integration site (Figure 2 and key resources table).
• 38.Analyze the genotype by performing PCR genotyping of the gDNA. To detect the plasmid integration into the tgfbr2l locus, mix each of primers 1–4 with common primer 5. For PCR genotyping, we recommend using KOD One DNA polymerase (Toyobo; Cat#KMM-101) and the following conditions. troubleshooting 5.

PCR reaction master mix

Reagent	Amount
2× KOD One master mix	25.0 μL
Genomic DNA (up to 200 ng)	X μL
10 μM primer 1-4	1.5 μL
10 μM primer 5	1.5 μL
Nuclease free water	22-X μL
Total	50 μL

PCR cycling conditions

Steps	Temperature	Time	Cycles
Denaturation	98°C	10 s	32 cycles
Annealing	60°C	5 s
Extension	68°C	30 s
Hold	4°C	forever

• 39.Visualize the size of the PCR products using an electrophoresis system with high resolution, such as TapeStation (Figure 4). Agarose gel electrophoresis for routine work is also fine.

Figure 4.

Representative PCR genotyping for targeted integration of NEXTrans plasmid

PCR genotyping was performed using the primer pairs described in Figure 2 and key resources table to detect Tg(NEXT-fgk:egfp) integration in tgfbr2l loci. The genomic DNA was extracted from F₁ siblings (#2) generated by in vitro fertilization. Green arrowhead indicates expected PCR products, suggesting Tg(NEXT-fgk:egfp) was integrated into the tgfbr2l.S locus in the forward direction. Samples 1–4, strong eGFP signals were detected in the gill and the edge of the tail fin; sample 5, wild-type (WT) tadpole. HM, high molecular weight marker; LM, low molecular weight marker in the TapeStation electropherogram.

Expected outcomes

Approximately 7% (33/477) of faithful reporter expression in the gill or fin edge was detected in F₀ transgenic animals co-injected with Cas9 RNP (Figure 3A) and NEXTrans plasmid Tg(NEXT-fgk:egfp) in a tissue-specific manner, as reported previously.^1,17 Mosaic expression, weak but specific eGFP expression in only the gill or fin edge, was also observed in some embryos, probably due to the low integration rate (60/477) (Figure 3B). Targeted integration at the tgfbr2l.L or S locus was confirmed by PCR genotyping.¹ Because the NEXTrans plasmid is integrated into the target site by error-prone NHEJ repair, the double-strand break ends of 5′ or 3′ junctions should be predicted considering various deletions and/or insertions.^18,19,20 Additionally, a few copies are likely to be tandemly concatemerized in some cases. Thus, several different sizes of PCR genotyping products were detected in the electrophoresis images.¹

To evaluate whether our improved method could be versatilely applied to X. laevis, we tested two NEXTrans plasmids carrying the tdTomato reporter gene driven by the cmv promoter (ubiquitous) or the gamma-crystallin promoter (eye-specific), Tg(NEXT-cmv:tdtomato) or Tg(NEXT-cryga:tdtomato). At the end of embryogenesis, approximately 12% of each group of tadpoles expressed strong tdTomato signals in a promoter-dependent manner in full- or half-transgenesis (Figures 3C–3F).¹ Genotyping analysis confirmed that both NEXTrans plasmids were integrated into the tgfbr2l.L or S locus, which is consistent with the fgk results.¹ These results also show that targeted transgenesis at a novel safe harbor site was achieved using NEXTrans.

We confirmed the germline transmission of the transgenes in F₁ siblings from Tg(NEXT-fgk:egfp), Tg(NEXT-cmv:tdtomato), and Tg(NEXT-cryga:tdtomato) F₀ founders. In the case of fgk Tg animals, first, two F₀ Tg males were outcrossed with wild-type females by natural mating or by in vitro fertilization. Transgene expression in the gill and fin edge was observed in 35.3% (82/232) and 59.1% (124/210) of offspring obtained by natural mating and in vitro fertilization, respectively (Figure 5A).¹ Integration of the plasmids was confirmed by PCR genotyping (Figure 4). Second, cmv Tg males were outcrossed with wild-type females, and 71.4% (5/7) of the F₁ embryos showed ubiquitous transgene expression in the whole body (Figure 5B).¹ Finally, 60.9% (109/179) of F₁ offspring generated from the cryga Tg males had tdTomato expression in both eyes (Figure 5C).¹ The differences in the germline transmission rate among these embryos are caused by the germline mosaicism in each F₀ founder. In all Tg cases, we successfully generated F₁ Tg animals within 1 year in a short reproductive period, which is comparable to the germline transmission rate of X. tropicalis. Thus, NEXTrans is expected to contribute to the advancement of X. laevis functional genomics research. Furthermore, our study strongly suggested that the tgfbr2l site is a safe harbor site, like the ROSA26 site for mouse, for X. laevis transgenesis.

Figure 5.

Germline transmission of transgenic X. laevis generated by NEXTrans

Representative photographs of F₁ offspring of (A) Xla.Tg(NEXT-fgk:egfp), (B) Xla.Tg(NEXT-cmv:tdtomato), and (C) Xla.Tg(NEXT-cryga:tdtomato) embryos. Arrowheads indicate the gill; double arrowheads indicate the edge of the tail fin; arrow indicates the eye with tdTomato signal. Scale bars = 1 mm.

Limitations

Unexpectedly, when transgenic X. laevis animals were produced using the Sox2 promoter/N2 enhancer sequence derived from the X. tropicalis genome,^1,21 which specifically induces transgene expression in the central nerve system, mosaic or lower reporter expression was observed compared with that obtained with the other promoters. This finding may be the result of weak promoter/enhancer activity per se or low copy number of the integrated plasmid at the target site due to the principle of DNA integration by NHEJ repair. NEXTrans is based on NHEJ repair, and therefore the plasmid integration could be expected in up to two loci in the host sub-genome tgfbr2l.L/S with a single copy or few tandem copies. This may cause weak expression of the transgene in F₀ mosaic animals when the copy number of the transgene is low in the target sites. Conversely, with the restriction enzyme-mediated integration (REMI) method, up to 35 copies of the transgene were predicted to be transcribed from the incorporated donor plasmid, which provides stronger transgene expression when a promoter/enhancer with weak activity is used.² Therefore, if Tg animals generated by NEXTrans are likely to show inadequate reporter expression for the purpose (e.g., in vivo reporter assay), the REMI or ISce-I³ method should be considered because of the high copy number of the transgene. Lastly, we have not yet evaluated the performance of NEXTrans in X. tropicalis. However, because the tgfbr2l locus is located on chromosome 9 in both X. laevis and X. tropicalis, a model amphibian species with a diploid genome, NEXTrans may work just as well in X. tropicalis. If more safe harbor sites are discovered in the future, the NEXTrans method can be used to construct donor plasmids as was the case for the tgfbr2l site, and target integration of such plasmids into those sites can be performed.

Troubleshooting

Problem 1

Insufficient CRISPR sgRNA is synthesized or obtained (steps 6-10).

Potential solution

Insufficient CRISPR sgRNA yield can be caused by secondary structure of sgRNA, insufficient in vitro reaction time, and/or a transcription kit that is not good for CRISPR sgRNA synthesis.

Possible solutions to increase the sgRNA yields include:

• •Design new sgRNAs.
• •Incubate the reaction tube for up to 4 h at 37°C (step 9b).

Recommended: use a highly active T7 RNA polymerase, such as the CUGA7 gRNA Synthesis Kit (step 9).

Problem 2

Most injected eggs fail to initiate development or die before gastrulation (step 27).

Potential solution

This problem can be caused by bad egg quality (e.g., distorted egg shape, high number of dead eggs, and/or low fertilization rate), a high amount of Cas9 protein, and/or sgRNA or target plasmid DNA is excessive for the generation of transgenic animals.

Possible solutions include:

• •Breed and keep females that lay good eggs in the researchers’ laboratory.
• •Use two to three females in the experiment to avoid females that lay poor quality eggs (step 14).
• •Recommended: inject appropriate amounts of the injection mixture into the fertilized eggs; 1 ng Cas9, 200 pg sgRNA, and 50 pg plasmid (step 22). Excess amounts of plasmid DNA (over 100 pg/egg) are toxic to X. laevis embryos.

Problem 3

Injected embryos develop normally, but weak or no transgene expression is detected (step 28).

Potential solution

Possible reasons for the inadequate expression include the following: the target plasmid is not integrated into the host genome because sgRNA or Cas9 protein lacks activity; the amount of injected plasmid DNA is insufficient; and/or the promoter/enhancer activity is too low to mediate transgene expression.

Possible solutions include

• •Recommended: use the Cas9 protein with multiple nuclear localization signal (NLS) sequences such as IDT Cas9 (see key resources table) to increase the efficiency of transgenesis.
• •Use Tg(NEXT-fgk:egfp) as a positive control to check if the injection is successful and/or sgRNA and Cas9 work properly.
• •Increase the amounts of the injection mixture; 2 ng Cas9, 400 pg sgRNA, and up to 100 pgplasmid DNA per embryo (step 22).
• •Use a different tissue-specific promoter with higher transcriptional activity.

Problem 4

No or low germline transmission efficiency in the F₁ offspring (step 32).

Potential solution

This problem occurs when the integrated plasmid is not inherited by the germ cells.

Possible solution:

• •Rear the founder embryos that show as strong as possible reporter gene expression to generate the transgenic F₁ siblings (step 28).

Problem 5

Most injected embryos develop normally and show promoter-dependent transgene expression, but integration is not detected by PCR (steps 38, 39).

Potential solution

This problem occurs when the PCR fails to amplify the fragment because inappropriate DNA polymerase and/or a large insertion/deletion is introduced at the junction between the host genome and the plasmid.

Possible solutions include:

• •Design new primers further from the junction than in the original design (step 37).
• •Try several DNA polymerases from fresh genomic DNA for the PCR (step 38).

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Ken-ichi T. Suzuki (suzuk107@nibb.ac.jp).

Materials availability

The NEXTrans plasmid will be deposited and released from the National Bioresource Project (NBRP) Clawed frogs/Newts at Hiroshima University, Japan. If the materials are needed soon, please contact K.T.S. (suzuk107@nibb.ac.jp).

Data and code availability

No datasets or code were generated in this study.