Abstract
Enteroviruses (EV) cause a number of life-threatening infectious diseases. EV-D68 is known to cause respiratory illness in children that can lead to acute flaccid myelitis. Coxsackievirus B5 (CVB5) is commonly associated with hand-foot-mouth disease. There is no antiviral treatment available for either. We have developed an isoxazole-3-carboxamide analog of pleconaril (11526092) which displayed potent inhibition of EV-D68 (IC50 58 nM) as well as other enteroviruses including the pleconaril-resistant Coxsackievirus B3-Woodruff (IC50 6-20 nM) and CVB5 (EC50 1 nM). Cryo-electron microscopy structures of EV-D68 in complex with 11526092 and pleconaril demonstrate destabilization of the EV-D68 MO strain VP1 loop, and a strain-dependent effect. A mouse respiratory model of EV-D68 infection, showed 3-log decreased viremia, favorable cytokine response, as well as statistically significant 1-log reduction in lung titer reduction at day 5 after treatment with 11526092. An acute flaccid myelitis neurological infection model did not show efficacy. 11526092 was tested in a mouse model of CVB5 infection and showed a 3-log TCID50 reduction in the pancreas. In summary, 11526092 represents a potent in vitro inhibitor of EV with in vivo efficacy in EV-D68 and CVB5 animal models suggesting it is worthy of further evaluation as a potential broad-spectrum antiviral therapeutic against EV.
Keywords: Antiviral, Coxsackievirus B5, Cryo-electron microscopy, Enteroviruses, EV-D68
Graphical Abstract
Introduction
Enteroviruses (EVs) and coxsackieviruses (CVs) of the Enterovirus genus of the Picornaviridae family frequently cause lower respiratory infections (Malmstrom et al., 2006; Miller et al., 2007; Renois et al., 2013; Toivonen et al., 2016) which represent the main cause of death in low-income countries and the third largest cause of death worldwide. EVs and CVs also cause a wide range of acute and chronic diseases, such as aseptic meningitis, encephalitis, hand-foot-and-mouth disease, conjunctivitis, diarrhea, herpetic angina, acute and chronic myocarditis, etc. (Melnick, 1997). Enterovirus D68 (EV-D68), like all members of the Enterovirus genus, is a non-enveloped, single-stranded, positive sense RNA virus of the family Picornaviridae (Oberste et al., 2004). EV-D68 shares important biological and molecular properties with other EVs and rhinoviruses (RV) having emerged as an important global public health threat (Tokarz et al., 2012). Despite identification in 1962, EV-D68 disease outbreaks were not widely reported until the early 2000s. Beginning with an outbreak of severe acute respiratory disease in the Philippines in 2008–2009, an increase in confirmed cases of EV-D68 infection in children (mean age of onset between 3–8 years old (Helfferich et al., 2019)) led to the classification of EV-D68 as a re-emerging pathogen (Imamura and Oshitani, 2015). The Center for Disease Control and Prevention (CDC) described 1,395 confirmed cases of EV-D68 respiratory infections between August 2014-January 2015 (Steele and Walsh, 2015). Over 1000 additional cases of EV-D68 respiratory disease were also confirmed in Canada, Europe, Asia, and South America (Holm-Hansen et al., 2016). A recent CDC report has noted that the number of hospitalizations with pediatric patients with confirmed cases of RV/EV in 2022 has increased in the United States with 260 cases confirmed to be EV-D68 (representing 17.4% of the total RV/EV cases reviewed with patients hospitalized with acute respiratory illness) (Ma et al., 2022). Accumulating evidence also supports an association between EV-D68 and acute flaccid myelitis (AFM) (Messacar et al., 2018), a disease which afflicts approximately 1% of EV-D68 patients and which is similar to poliomyelitis (Martin et al., 2017). The majority of children with AFM also experience viral prodromal symptoms of fever and upper respiratory illness in the week prior to the onset of limb weakness (Helfferich et al., 2019). The severity of respiratory disease, however, does not appear to correlate with the development of paralysis (Messacar et al., 2018). Other viruses that have been associated with outbreaks of AFM include enterovirus A71 (EV-A71), West Nile virus, Japanese encephalitis virus, and the wild-type poliovirus (Arya, 1998; Glass et al., 2002; Huang et al., 1999). EV-D68 appears to occur in a cyclic pattern with a 2-year interval (Helfferich et al., 2019; Knoester et al., 2019; Messacar et al., 2018), though this is suggested to have been interrupted by the implementation of COVID-19 mitigation measures in 2020 (Ma et al., 2022). CVB5 is one of the main serotypes in EV B. It can cause numerous diseases in humans including hand, foot, and mouth disease (Andreoni and Colton, 2017), aseptic meningitis, viral encephalitis, and acute flaccid paralysis, with such infections increasingly seen in infants and children globally, in which they may cause severe illness and death (Yang et al., 2022). There has been limited research towards identifying antivirals for this virus (Bratslavska et al., 2007; Carta et al., 2018; Loddo et al., 2015; Zhong et al., 2009).
Clearly more research is needed (Morens et al., 2019), as are treatments to decrease morbidity and mortality resulting from these infections. Current treatment of EV and CV infections aims to reduce and shorten symptoms (e.g. fever and pain, fatigue, and nasal blockage in the case of common cold). Although several molecules have been evaluated and have shown in vitro activity, they have all failed in in vivo models. For example, fluoxetine did not reduce the viral load in the mouse model of EV-D68–associated AFM or improve motor function, and ultimately failed in clinical studies (Hixon et al., 2017; Messacar et al., 2019). The most promising results against EVs to date have been obtained with the capsid-binding inhibitors such as pleconaril and vapendavir (Matz, 2013; Pevear et al., 1999). However, due to insufficient effectiveness, emerging resistance, and/or side effects in the clinic, neither of these inhibitors has been approved by the FDA (Senior, 2002). Pleconaril and vapendavir bind in a hydrophobic pocket within VP1 of EVs and RVs, stabilize the viral capsid and prevent viral adsorption and/or uncoating (Braun et al., 2011). Therefore there is currently no approved antiviral treatment for EVs and CVs, and with the exception of the poliovirus vaccine no prophylaxis, to prevent the millions of lost school and working days (Rotbart, 2000).
We have previously developed new pleconaril-based molecules which displayed potent in vitro activity against a panel of CVs and RVs (Egorova et al., 2020). We have now discovered that one of these compounds, 3-(3-methyl-4-(3-(3-N,N-dimethylcarbamoyl-isoxazol-5-yl)propoxy)phenyl)-5-trifluoromethyl-1,2,4-oxadiazole (11526092), also displays potent in vitro inhibition across various EVs. This molecule demonstrated promising antiviral activity against EV-D68 in a mouse respiratory model of EV-D68 infection yet was not efficacious in a neurological model. We have now used cryo-electron microscopy (cryo-EM) to demonstrate that 11526092 binds to the EV-D68 VP1 from the MO strain similarly to pleconaril and in the process found that pleconaril binds differently to the Fermon and MO strains of EV-D68. We have additionally determined that 11526092 inhibits CVB5 in vitro and in vivo, and therefore may represent a promising new lead compound.
Materials and Methods
Study approval.
Ethics regulation of laboratory animals: This study was conducted in accordance with the approval of the Institutional Animal Care and Use Committee of Utah State University dated March 2, 2019 (expires March 1, 2022). The work was done in the AAALAC-accredited Laboratory Animal Research Center of Utah State University. The U.S. Government (National Institutes of Health) approval was renewed March 2, 2019 (PHS Assurance No. D16-00468[A3801-01], expires March 1, 2022) in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (Revision; 2011).
Chemicals and reagents.
All reagents and solvents were purchased from commercial suppliers and used without further purification. 1H Spectra were measured on Bruker AC-300 (300 MHz, 1H). Chemical shifts were measured in DMSO-d6 or CDCl3, using tetramethylsilane as an internal standard, and reported as units (ppm) values. The following abbreviations are used to indicate the multiplicity: s, singlet; d, doublet; t, triplet; m, multiplet; dd, doublet of doublets; brs, broad singlet; brm, broad multiplet. Mass spectra were recorded on Finnigan MAT INCO 50 mass spectrometer (EI, 70 eV) with direct injection. The purities of the final compounds were analyzed on an Agilent 1290 Infinity II HPLC system coupled to Agilent 6460 triple-quadrupole mass spectrometer equipped with an electrospray ionization source. The chromatographic separation was carried out on an Agilent Eclipse Plus C18 RRHD column (2.1 × 50 mm, 1.8 μm) at 40 °C; sample injection volume was 0.2 μL. The mobile phase comprising 0.1 % formic acid/water (A), and 0.1 % formic acid and 85 % acetonitrile / water (B) was programmed with gradient elution (0.0-3.0 min, 60 % B; 3.0-4.0 min, 60 % to 97 % B; 4.0-6.0 min, 97 % B; 6.0-6.1 min, 97 % to 60 % B) at a flow rate of 0.4 mL/min. The mass spectrometric detection was operated in positive ion mode. Optimal parameters were: capillary voltages of 3500 V, a nebulizer pressure of 35 psi, a gas temperature of 350 °C, a gas flow rate of 12 L/min.
Pleconaril was synthesized according to a previous publication (Diana et al., 1995) and its analytical data was identical to this published information. All final compounds were > 99 % pure.
Compound synthesis.
3-(3-Methyl-4-(3-(3-N,N-dimethylcarbamoyl-isoxazol-5-yl)propoxy)phenyl)-5-trifluoromethyl-1,2,4-oxadiazole 11526092 was synthesized in 5 steps, and complete experimental protocols have been described by Egorova et al. previously (Egorova et al., 2020), while the analogs 11526091 and 11526093 were also synthesized in a similar manner (Supplemental Methods).
In vitro antiviral assays
Coxsackievirus B3-Woodruff (CVB3).
Drugs were solubilized in DMSO and then serially diluted 2-fold in cell culture media and then drugs or DMSO vehicle were mixed with sufficient CVB3 for an MOI of 1 or 3 PFU per cell and used to immediately infect HeLa cell cultures in 96-well plates. After incubation for 48 hours, cell monolayers were stained with crystal violet, the optical density determined relative to DMSO-treated controls, and the Inhibitory Concentration 50% (IC50) calculated. N = 6 wells per case (e.g. dilution). In addition, the Cytotoxicity Concentration 50% (CC50) was assessed for each virus (using the same protocol in the absence of virus) and determined to be >100 μM (not tested at higher concentrations).
For low MOI infections, HeLa cell cultures in 96-well plates were infected with CVB3 at a low MOI such that only a fraction of cells was infected and then incubated for 6 hours to allow ample time for virus entry and establishment of infection. Two-fold serial dilutions of drug (as above) were added to the culture wells. After incubation for 48 hours to allow virus spread, cell monolayers were stained with crystal violet, the optical density determined relative to DMSO-treated controls, and the Inhibitory Concentration50 (IC50) calculated. N = 6 wells per compound.
Coxsackievirus B5 (CVB5).
The Coxsackievirus B5 (CVB5) virus used for in vitro testing originated from a clinical isolate that had previously been collected during the course of surveillance from a 4-y.o. male child previously vaccinated against poliomyelitis. The initial isolation was made in the HEp-2 cell line and this virus was typed using specific antisera and identified as CVB5. This isolate was deposited as 7002 in the database of St. Petersburg Pasteur Institute. Prior to experiments, the virus was adapted to Vero cells by three sequential passages.
Inhibition of virus activity was determined using CPE rescue in Vero cells. Vero cells were seeded in 96-well plates 24 h prior to assay. On the assay day, the cells were washed with saline and tested compounds in appropriate concentrations (0.1 – 0.0004 μg/mL) in DMEM were added to cells (4-fold dilution series (5 concentrations)). No compounds were added to virus control wells. The plates were incubated for 1 h at 37°C under5% CO2. The cells were then infected with CVB5 (MOI 0.01) and incubated for 72 h at 37°C under 5% CO2. No virus was added to the cytotoxicity control wells. Cell viability was then assessed using an MTT test with the following procedure: The cells were washed with saline, and a solution of 3-(4,5-dimethylthiazolyl-2) 2,5-diphenyltetrazolium bromide (ICN Biochemicals Inc., Aurora, OH, USA) (0.5 μg/mL) in DMEM was added to the wells (100 μL per well). After 2 h of incubation at 37°C in 5% CO2, the supernatant from wells was discarded, and the formazan residue was dissolved in DMSO (100 μL per well). The optical density (OD) of cells was then measured on a Multiskan multifunctional reader (Thermo Fisher Scientific, Shanghai, China) at a wavelength of 540 nm. The cytoprotective activity of compounds was considered to be their ability to increase the values of OD compared to control wells (using only a virus, without drugs). The IC50 was calculated using GraphPad Prism 9.5.0 software. N = 3 wells per compound.
Enterovirus D-68 (EVD68).
Preliminary EVD68 inhibition studies were done using a single concentration of 5 μM. Human rhabdomyosarcoma (RD) cells were treated with Pleconaril or indicated analogs (5 μM) for 24 hours prior to infection with EVD68, strain IL/14-18952 (IL52), at a multiplicity of infection of 0.1. At 24-, 48-, and 72-hours following infection, cells were harvested and total RNA was prepared using a Qiagen RNeasy Plus Micro Kit with RNA carrier (Hilden, GER) and used to make cDNA using a Bio-Rad iScript RT supermix (Berkley, CA). Equivalent volumes of cDNA were used for PCR with degenerate primers targeting the VP1 gene (Hixon et al., 2017). Samples were compared to a plasmid standard curve.
Reduction of virus-induced cytopathic effect (CPE rescue assay) and reduction of virus yield (VYR assay).
Follow up dose-response inhibition was also performed in RD cells to calculate EC50 via CPE rescue and an additional VYR assay was also used to calculate an EC90 value (Supplemental Methods).
In vivo studies
Maximum tolerated dose studies.
Maximum tolerated dose studies were performed for 10-day and 4-week-old AG129 mice. For each age group a total of 20 mice were randomized into four groups of 5 mice each enabling 3 different doses for each (Table S2). Mice were treated twice daily for five days with 11526092 in a suspension of 0.5% carboxymethylcellulose (CMC) and 0.5% Tween 20 in sterile water per os (p.o.). Mice were weighed prior to treatment and then daily thereafter to assess the effects of treatment on body weight. All mice were observed for morbidity and mortality through day 14.
In vivo EV-68 efficacy assay: Respiratory model.
Using previously described methods (Evans et al., 2019) four-week-old male and female AG129 mice from a specific-pathogen-free colony maintained at the Utah Science Technology and Research (USTAR) building at Utah State University (USU) for this experiment. The mice were bred and maintained on irradiated Teklad Rodent Diet (Harlan Teklad) and autoclaved tap water at the USTAR building of USU. 11526092 was prepared in 0.5% carboxymethylcellulose (CMC) and 0.5% Tween 20 in sterile water. Guanidine HCl (guanidine) was obtained from Sigma-Aldrich (St. Louis, MO) and served as a positive control at a dose of 100 mg/kg/day. Sterile saline was used as a vehicle for guanidine. EV D68 was obtained from BEI Resources, NIAID, NIH: Enterovirus D68, US/MO/14-18949, NR-49130. The virus was serially passaged 30 times in the lungs of 4-week-old AG129 mice and then plaque-purified three times in Rhabdomyosarcoma (RD) cells obtained from the American Type Culture Collection (Manassas, VA). The resulting virus stock was amplified twice in RD cells to create a working stock. The virus used for infection was designated EV-D68 mouse passage 30 (MP30), plaque purified (PP). A total of 65 mice were randomized into 5 groups of 12 mice each and one group of 6 mice (normal controls) (Table S3). Mice were anesthetized by IP injection of ketamine (100 mg/kg) and then infected via intranasal (IN) instillation of 1 x 104.5 CCID50 of EV-D68 MP30 PP in a 90 μl volume of MEM. Mice were treated per os (PO) with 11526092 once daily for 5 days beginning 2 hours pre-infection. Treatment with guanidine started 4 hours post-infection and continued twice daily for 5 days. The placebo (vehicle only) was administered by p.o. once daily for 5 days starting 2 hours pre-virus exposure. Mice were weighed prior to treatment and then daily thereafter to assess the effects of treatment on ameliorating weight loss due to virus infection. Four mice from each treatment group were euthanized on days 1, 3, and 5 post-infection for evaluation of blood and lung virus titers, and lung cytokine concentrations. In addition, one mouse from the normal controls was euthanized on days 1, 3, and 5 post-infection as a negative control for cytokine analysis. Viremia was evaluated in whole blood on human rhabdomyosarcoma (RD) cells in microtiter plates, as described previously (Evans et al., 2019; Hurst et al., 2019). In addition, each mouse lung was homogenized in minimal essential media (MEM) solution and assayed for infectious virus in RD cells (Evans et al., 2019; Hurst et al., 2019). Fifty percent cell culture infectious doses (CCID50) were converted to CCID50 per gram of lung tissue prior to statistical analysis. Virus titer differences were evaluated by analysis of variance (ANOVA) on log-transformed values assuming equal variance and normal distribution. Following ANOVA individual treatment values were compared to placebo control by Dunnett’s pair-wise comparison test using Prism 9.5.0. Lung cytokine/chemokine determinations: samples (200 μl) from lung homogenates were tested for cytokines and chemokines using a chemiluminescent ELISA-based assay according to the manufacturer’s instructions (Quansys Biosciences Q-PlexÔ Array, Logan, UT). The Quansys multiplex ELISA is a quantitative test in which 16 distinct capture antibodies have been applied to each well of a 96-well plate in a defined array. Each sample supernatant was tested at 2 dilutions for the following: IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-12p70, IL-17, MCP-1, IFN-γ, TNFα, MIP-1α, GM-CSF, and RANTES. Cytokine and chemokine titers are reported in pg/ml of lung lavage fluid. Titer differences were evaluated by ANOVA on values assuming equal variance and normal distribution. In addition, treatment group mean values were evaluated by two-way ANOVA for effects based on the day post-infection using Prism 9.5.0. Mean body weights were analyzed by one-way analysis of variance (ANOVA) followed by Dunnett’s multiple comparison tests using Prism 9.5.0 (GraphPad Software Inc.). For each day post-infection, lung and blood virus titers from treated groups were compared to lung and blood titers from placebo-treated mice using a one-way analysis of variance (ANOVA) followed by Tukey’s pair-wise comparison test. For each cytokine/chemokine, the concentrations from treated mice were compared to placebo treated mice using a two-way ANOVA for effects based on the day post-infection.
In vivo EV-68 efficacy assay: neurological model.
Animals:
10-day-old AG129 mice from a specific-pathogen-free colony maintained at the Utah Science Technology and Research (USTAR) building at Utah State University. The mice were bred and maintained on irradiated Teklad Rodent Diet (Harlan Teklad) and autoclaved tap water at the USTAR building of Utah State University. 11526092 was prepared in 0.5% carboxymethylcellulose (CMC) and 0.5% Tween 20 in sterile water. Using previously described methods (Hurst et al., 2019) two antiviral efficacy studies evaluating 11526092 were completed (Table S4 and S5). One study had antiviral drug treatment begin 4 hours post-infection, and the second study had the drug treatment begin 2 hours pre-infection. A total of 42 mice were randomized into five groups of 8 mice each as shown in Tables 1 and 2. The virus used for infection was designated EV-D68 mouse passage 30 (MP30), plaque purified (PP). Mice were anesthetized by IP injection of ketamine (100 mg/kg) and then infected intraperitoneally via 1 x 106.7 CCID50 of EV-D68 MP30 PP in a 50 μl volume of MEM.
Table 1.
Isoxazole-3-carboxamide derivatives testing with CVB3-Woodruff versus pleconaril. EC50 is defined as the concentration (μM) for half maximal effects on cell death in HeLa cells. Not all compounds reached a plateau showing a total CPE rescue with all MOIs tested and therefore these were not compared to pleconaril. Values were statistically significantly lower than for pleconaril (p<0.0001) for 11526091 and 11526092, independent of adding drug pre- or post-infection for those that had full rescue. “±” represents the SEM (n ≥ 6) as calculated in Prism 9.5.0
Inhibitory concentration EC50 against CVB3-Woodruff, μM |
|||
---|---|---|---|
Name | Adding drug to virus and then infecting at indicated multiplicity of infection (MOI): |
Infecting at low MOI and adding drug after infection is established: |
|
1 PFU / cell | 3 PFU / cell | 0.1 PFU / cell | |
Pleconaril | 0.045 ± 0.00 | 0.333 ± 0.21 | 0.150 ± 0.01 |
11526091 | 0.006 ± 0.00 | 0.021 ± 0.00 | 0.016 ± 0.00 |
11526092 | 0.006 ± 0.00 | 0.020 ± 0.00 | 0.016 ± 0.00 |
11526093 | 0.009 ± 0.00 | 0.025 ± 0.00 | 0.183 ± 0.01 |
Bold = Less than full CPE rescue
Table 2.
Testing of 11526092 against several viruses of interest (N.D. = not determined). EC50 (μM) represents the concentration of compound required to reduce the CPE in the indicated cell line by 50%. A virus yield reduction assay (endpoint dilution; reduction of CPE in cells) was used to calculate EC90. CC50 (n=3, 8 concentrations (0.5 log10 dilution series)) was calculated based on either neutral red or MTT assays
Virus Serotype | Strain Name | Cell Line |
50% Effective concentration EC50 (μM) |
90% Effective concentration EC90 (μM) |
50% Cytotoxic concentration CC50 (μM) |
---|---|---|---|---|---|
Coxsackie B3 | HA 201933 | Vero 76 | 1.01 | 7.78 | 8.0 |
Coxsackie B3 | Nancy | Vero 76 | 1.27 | N.D. | 8.0 |
&Coxsackie B5 | &Unidentified | Vero | 0.001 | N.D. | 59.1 |
EV-D68 | US/KY/14-18953 | RD | 0.042 | 0.078 | 2.4 |
*EV-D68 | US/MO/14-18949 | RD | <0.1 | N.D. | 28 |
ma-EV-D68 | #US/MO/14-18949 (Mouse adapted) | RD | 0.028 | N.D. | 9.4 |
EV-71 | Tainan/4643/98 | Vero 76 | 4.24 | 2.45 | 8.25 |
Polio virus 1 | Mahoney | Vero 76 | 0.57 | 0.52 | 10.8 |
Influenza H1N1 | California/07/2009 | MDCK | 25.9 | 9.4 | 44.8 |
Human Echovirus-11 | Gregory | RD | <0.032** | <0.032** | 18 |
Human Echovirus-30 | Bastianni | RD | <0.032** | <0.032** | 11 |
SARS-CoV-2 | USA/WA1/2020 | Vero 76 | >7.54 | N.D. | 7.54 |
n=3, 5 concentration (4-fold dilution series), antisera identified
n=3, 4 concentrations (log10 dilution series)
lowest concentration tested 0.032 μM
serially passaged 30x in lungs of AG120 mice to increase virulence
Mice were treated twice daily for five days with 11526092 in a suspension of 0.5% carboxymethylcellulose (CMC) and 0.5% Tween 20 in sterile water per os (p.o.). Mice were weighed prior to treatment and then daily thereafter to assess the effects of treatment on body weight. In addition, all mice were observed for morbidity, neurological scores and mortality through day 14. Statistical analysis: Kaplan-Meier survival curves were generated and compared by the Log-rank (Mantel-Cox) test followed by pairwise comparison using the Gehan-Breslow-Wilcoxon test in Prism 9.5.0 (GraphPad Software Inc., La Jolla, CA). The mean body weights were analyzed by analysis of variance (ANOVA) followed by Tukey’s multiple comparison test using Prism 9.5.0. Neurological scores were graphed and evaluated using a Kruskal-Wallis test with a Dunn’s post-test for statistical significance compared to placebo-treated mice. Tissue virus titers were compared by a one-way ANOVA for each day with treated groups compared to placebo-treated mice.
In vivo CVB5 efficacy assay.
Male BALB/c mice, 4-5 weeks old were obtained from the animal breeding facility of Russian Academy of Medicine “Rappolovo” (Rappopolovo, Russia). The mice were quarantined 48 h prior to the experimental manipulation and were fed standard rodent chow and had ad libitum access to water. Animal experiments were conducted in accordance with the principles of laboratory animals care (Guide for the Care and Use of Laboratory Animals, National Academy Press, Washington DC, 1996) and approved by the Institutional Ethical Committee. Prior to animal infection, CVB5 was adapted to mouse using the following protocol: Balb/c mice were infected intraperitoneally by virus-containing culture (10^6 TCID50 in 0.2 mL). After three days their pancreases were removed, homogenized in 10 volumes of MEM cell culture medium, diluted ten-fold, and Vero cells were infected with the homogenate. After appearance of advanced CPE cells were undergone three cycles of freezing/thawing, and the medium was used for infecting mice. Infectious titer of the virus was determined in all materials by end-point titration in Vero cells. For the experiment, the material after cell cultivation was used (5×107 TCID50 per mL). In order to evaluate anti-viral activity of compounds in vivo, mice (6 per group) were infected intraperitoneally with 6×106 TCID50/0.2 mL of previously titrated virus. Compounds were applied intraperitoneally (100 mg/kg per day) twice a day in a volume of 0.2 mL for days 1 to 5 post infection (p.i.) starting 12 hours before infecting. Control animals were treated with distilled water. 10 uninfected untreated mice were used as intact control. To determine viral load in target organs, animals were sacrificed, their pancreas removed, and each pancreas was divided into two equal parts. One halves of pancreas were weighed and homogenized in ten volumes of sterile phosphate-buffered saline. To determine TCIC50, serial ten-fold dilutions (10−1-108) were prepared from each homogenate following by infecting of Vero cells and determination of infectious titer of the virus using endpoint dilution(Reed and Muench, 1938). The activity of the compounds was evaluated by their ability to decrease the infectious titer of the virus in pancreatic tissue. Quantitative PCR was used in parallel to determine viral RNA. RNA was isolated from of the sterile phosphate-buffered saline pancreas extracts by phenol-chloroform extraction according to the manufacturer's instructions. cDNA was synthesized with the MMLV RT kit (Evrogen, Russia) using a mixture of primer oligodT and random hexamers and stored at −80. Before RT-PCR, cDNA was diluted 2-fold with water for PCR. qPCR was set up using the qPCR-UDG-mix kit (Russia). For the detection of CVB5, the following primers were used: FevI AGATCAGGYCGATGAGYCACYG and EvR3 CACGGWCACCCARAGTASTCGl. SYBR-Green was purchased from Evrogen, (Russia), and the PCR amplification program was run as following: 37° C 10 min, 95° C 10 min, 39 times: 95° C 30 sec, 61° C 30 sec, 72° C 45 sec; Melt curve 65°C to 95°C increments 0,5°C. The mouse actin B gene was chosen as a reference gene and amplified with the following primers and probe: actb_mouse_F TCAGAAGGACTCCTATGTGG, actb_mouse_R GTA CAT GGC TGG GGT GTT G, probe JOE-GTC TCA AAC ATG ATC TGG GTC ATC -BHQ1. The following PCR amplification program was used: 37° C 10 min, 95° C 10 min, 44 times: 95° C 30 sec, 59,5°v 40 sec, 72° C 40 sec. Statistical significance was calculated using an ordinary one-way ANOVA followed by a Holm-Šídák's multiple comparisons test for the log10(TCID50) comparison or Kruskal-Wallis with Dunn’s multiple comparisons test for relative fold gene expression comparisons using Graphpad Prism 9.5.0 for macOS *GraphPad Software Inc., La Jolla, CA). The other halves of pancreas were used for the histology study. Pancreas were fixed in 4% PBS-buffered formaldehyde, dehydrated in graded ethanol, and embedded in paraffin. Four-micrometer sections were cut and stained with haemotoxylin-eosin.
Cryo-EM.
Cells and viruses:
Human Rhabdomyosarcoma cells (RD cells, CCL-136, American Type Culture Collection) were grown in medium composed of Dulbecco’s Modified Eagle Medium (DMEM, Sigma-Aldrich), 10% heat inactivated fetal bovine serum (HI-FBS, Sigma-Aldrich) together with 1X of nonessential amino acid (NEAA, Life Technologies). EV-D68 US/MO/14-18947 (EV-D68 MO) (GenBank accession no. AIS73051.1) was obtained from BEI Resources, National Institute of Allergy and Infectious Diseases, National Institute of Health. After passage in RD cells the virus was frozen and stored at −80°C.
Virus propagation and purification:
The EV-D68 MO used in structural studies was prepared using the following methods. RD cells were infected with EV-D68 MO with a multiplicity of infection of around 0.01. Two days post infection, the cells and supernatant were collected and spun down using a JA-10 rotor at 9,500 RPM. The cell pellets were frozen and thawed multiple times and spun down to remove cell debris. The combined supernatants were pelleted using a Ti 50.2 rotor at 48,000 RPM. The pellets were then incubated and resuspended in 250 mM HEPES, 250 mM NaCl buffer (pH=7.5) and 5mM (final concentration in the suspension) MgCl2 solution, 0.01mg/ml DNAse (Sigma-Aldrich), 0.8 mg/ml trypsin, 15mM EDTA, 1% (w/v) n-lauryl-sarcosine solution was added. Then the sample was pelleted down using a Ti 50.2 rotor at 48,000 RPM, resuspended and applied onto a potassium tartrate gradient (10%-40%, w/v) for the last round of ultracentrifugation using an SW41 rotor at 36,000 RPM. The purified virus sample was observed as a dominant blue band at the middle to lower part of the tube and was extracted and buffered exchanged to remove potassium tartrate.
Cryo-Sample preparation:
For each of the inhibitors (11526091, 11526092 and 11526093) a 10mg/ml stock solution was made by dissolving the powder in DMSO. The three stock solutions were further diluted to 0.5mg/ml in PBS. Purified EV-D68 particles (approximately 1mg/ml in 20mM Tris, 120mM NaCl, pH=8.0 buffer) were mixed with each inhibitor at a molar ratio of 1:1500. After incubating for 6 hours at 4 °C, for each of the virus-inhibitor mixtures and a control (EV-D68 MO alone), 3.5 μL solution was added to a glow-discharged 400 mesh lacey carbon film copper grid (Ted Pella Inc.). All samples were blotted for 4 seconds at 75%-80% humidity, and plunge frozen (Cryoplunge 3 system, Gatan) in liquid ethane.
Cryo-EM and data collection:
The Cryo-EM datasets were collected using two 300 kV Titan Krios Cryo-Transmission Electron Microscope (Thermo Fisher Scientific). Movies were collected using EPU or Leginon (Suloway et al., 2005)with a K3 Direct Detection Camera (Gatan) at a magnification of 64,000X, resulting in a super resolution pixel size of 0.666 or 0.664 Å, with a defocus range from 0.4 to 2 μm (Table S6). A total electron dose of 36.06 or 36.3 electrons/Å2 over 2.6 seconds of exposure was recorded over 40 frames. Overall, 10,095 movies, 12,366 movies, 5,677 movies, 6789 movies and 3,972 movies were acquired for EV-D68 in complex with 11526091, 11526092, 11526093, pleconaril and control, respectively.
Image processing, model building and refinement:
For all datasets, motion correction, contrast transfer function (CTF), particle picking and extraction, 2-dimensional (2D) classification, 3D reconstruction and refinement were done using cryoSPARC (Punjani et al., 2017). The final resolutions for all maps were estimated based on a gold-standard Fourier shell correlation cutoff of 0.143 (Scheres and Chen, 2012). For model building and refinement, the same methods described below were applied for all datasets. The cryo-EM model of EV-D68 MO (PDB code: 6CSG) was selected as a template for model building and was manually fitted into the density maps using the program Chimera (Pettersen et al., 2004). Based on the initial fittings, the models were rebuilt in COOT (Emsley et al., 2010)and processed in PHENIX (Adams et al., 2010) for real space refinements. The final validation of the atomic models was done through MolProbity (Chen et al., 2010), Chimera (Pettersen et al., 2004), COOT (Emsley et al., 2010) and CCP4i2-PISA (Potterton et al., 2018), which were used to visualize and determine the residues associated with the bound inhibitors. Refinement statistics are summarized in Table S6.
Docking.
Compounds were docked in the various crystal structures that were previously published (PDB codes noted in legends) before our own cryo-EM work. The docking sphere was centralized from the position of the crystallized ligand with the default diameter (~10 Å depending on ligand shape). CHARMm based docking (CDOCKER) (Wu et al., 2003) was used to generate a maximum of 10 poses of each compound within this sphere using rigid docking. CDOCKER, a simulated annealing-based docking algorithm, was run within Discovery Studio (Biovia, San Diego, CA) using the following default parameters: 1000 dynamic steps, which included electrostatic interactions, 2000 heating steps, 5000 cooling steps, and a final cooling target temperature of 300 K.
In Vitro ADME assays.
In vitro ADME studies were performed as described in Supplemental Methods.
Statistics.
Ordinary ANOVA or Ordinary two-way ANOVA followed by a Dunnett’s T3 multiple comparisons test was performed in Graphpad Prism versions 9.2, 9.3 and 9.5.0 for macOS (GraphPad Software, San Diego, California USA).. Asterisks represent statistical significance using the GP style, where P values of ≤0.0001, ≤0.001, ≤0.01, ≤0.05 and ≥0.05 are summarized with “****”, “***”, “**”, “*”, and ns, respectively.
Results
In vitro antiviral assays for 11526092 and analogs.
Following our earlier in vitro studies in which potent activity was observed against many different pleconaril-resistant EV’s including several CVs and RVs (Egorova et al., 2020) we focused on three isoxazole-3-carboxamide derivatives of pleconaril (Fig. 1). We tested these molecules in vitro using CVB3-Woodruff, a previously untested strain (for more information see the Supplementary Materials and Methods sections) and showed that 11526091 and 11526092 had IC50 values that were statistically significantly lower than for pleconaril (p<0.0001) at MOIs 0.1 and 1. This inhibition was independent of the addition of molecules in either pre- or post-infection settings (Table 1; Fig. S1). While no cytotoxicity was detected with any of the compounds tested in the absence of virus, at 3 PFU a full CPE rescue was not seen with the experimental compounds suggesting an increased toxicity in infected cells. Interestingly, 11526092 also displayed the greatest antiviral effect in preliminary work with human rhabdomyosarcoma (RD) cells infected with EV-D68 (Fig. S2). 11526092 was then profiled against several viruses and showed activity against CVB3, CVB5, EV-D68, polio, less activity against EV-71 in Vero cells (Table 2). For example, 11526092 against CVB5 (EC50 1.1 nM), was slightly less potent than pleconaril (EC50 0.66 nM) (Fig. S3).
Fig. 1.
Structures of isoxazole-3-carboxamide pleconaril derivatives
Cryo-EM structures for 11526092 in EV-D68.
Pleconaril is known to bind the capsid protein VP1 (Braun et al., 2011) and we expected our analogs would also bind similarly. VP1 is structurally highly similar in multiple proteins encoded by the Picornaviridae family (Fig. S4). The potency in vitro against EV-D68 and maEV-D68 (EC50 23-60 nM, Table 2) prompted us to pursue the cryo-EM structure of EV-D68 MO in complex with 11526092 in order to confirm the target and investigate a potential mechanism. Compound 11526092 binds to the capsid VP1 (Fig. 2) in a manner like pleconaril and this is also similar to our initial docking prediction made with previous cryo-EM structures (Fig. S5) (Liu et al., 2015b). We have also now solved the cryo-EM structure of EV-D68 and another isoxazole-3-carboxamide analog of pleconaril, namely 11526093, although the density of compound is too weak to fit into the pocket. For the reconstructions of EV-D68 MO in complex with 11526091 and 11526093, there is only weak density in the VP1 hydrophobic pocket region, indicating a low occupancy or no binding (Fig. S6). This is more pronounced for 11526093 than for 11526091, suggesting that the former binds slightly stronger than the latter. In addition, compared to the control, no structural changes are observed in EV-D68 complexes with the two compounds (Fig. S7). This low density and lack of structural changes for both 11526093 and 11526091 indicates a possibility that these molecules inhibit the virus using a different mechanism than 11526092. Moreover, the reconstruction of EV-D68 MO in complex with pleconaril shows a similar conformational change as EV-D68 MO in complex with inhibitor 11526092, which is different to the movement observed in EV-D68 Fermon in complex with pleconaril (Fig. S8-S11), suggesting that the same compound may have variable anti-viral mechanisms among viral strains. This difference also correlates well with the strain-specific sequences as there are multiple residue differences between the Fermon and MO strains as shown in Fig. S12. An example of typical map densities (VP2 and VP3 sections) at 2 Å resolution are shown in Fig. S13 for reference. Estimates of map resolution are also shown in Fig. S14.
Fig. 2.
Cryo-EM structure of Enterovirus 68 (EV-D68) inhibitor 11526092 bound to the capsid Viral Protein 1 (VP1) of EV-D68 (MO strain). (A) An icosahedral asymmetric unit of the EV-D68-inhibitor 11526092 complex. VP1, VP2, VP3 and VP4 are colored in blue, green, red, and magenta, respectively. The density of inhibitor 11526092 is shown as a grey mesh. (B) A zoomed in view of the inhibitor 11526092 (grey) in the VP1 pocket (blue). (C) An enlarged view of inhibitor 11526092 fitted into the density (contour level 0.8) and the interfacing residues. (D) Comparison of the VP1s between EV-D68-inhibitor 11526092 complex (blue) and control (light purple). Large movements are highlighted by magenta dashes
The 3-methyl group on the benzene ring of 11526092 is involved in multiple hydrophobic interactions with TRP-93, ILE-95, ILE-119, VAL-239, while the other analogs 11526091 and 11526093 have a nitro- or fluorine group at this position, respectively, which would either interfere or weaken this interaction. Among the three EV-D68 and inhibitor reconstructions, only the EV-D68-11526092 complexes show clear densities for the inhibitor in the VP1 hydrophobic pocket region at a contour level of 0.8 (Fig. 2A-C), demonstrating good occupancy of 11526092. When compared to the structure of EV-D68 (Fermon strain) complexed with pleconaril (PDB: 4wm7), 11526092 binds to the VP1 hydrophobic pocket in a similar manner with highly conserved interfacing residues (Fig. S8). However, comparison between the structures of EV-D68 MO in complex with 11526092 and the native EV-D68 MO strain shows conformational changes in the VP1 GH and EF loops (Fig. 2D). Residues 216-218 on the GH loop move more than 2 Å away from the hydrophobic pocket (based on the Cα atoms) (Fig. 2D, Fig. S9). Similarly, obvious outward movements are observed for EF loop, residues 150-152 (Fig. 2D, Fig. S9). Because the VP1 GH and EF loops are closely associated with the canyon region, these residue movements likely contribute to binding dynamics, affecting the area where receptor binding would occur and potentially interfering with binding and cell tropism (Liu et al., 2015a).
In vitro ADME for 11526092.
In order to assess the utility of 11526092 for further study as a lead compound the in vitro ADME properties for 11526092 were determined (Table 3) and demonstrated it possessed low solubility, low μM inhibition of CYP2C9 and CYP2C19 and poor mouse microsomal stability. In contrast, in human liver microsomes 11526092 is metabolically stable. The protein binding data indicate that it is also highly protein bound. The Caco-2 data suggest that 11526092 is likely a P-gp substrate and this may affect the oral pharmacokinetics of 11526092. Neither appreciable hERG inhibition or PXR agonist activity were observed for this molecule (Table 3).
Table 3.
ADME properties for 11526092
ADME property | Data |
---|---|
Solubility | 0.11 μM in Buffer pH 7.4, 12.05 μM in Fasted State Simulated Intestinal Fluid (FaSSIF), 0.55 μM in Fasted State Simulated Gastric Fluid (FaSSGF). |
CYP inhibition | CYPs1A2, 2D6, 3A4* (>50 μM), 2C9 (5 μM), 2C19 (2.1 μM) |
Mouse liver microsomes | t1/2 = 19.6 min (unstable), CLint = 70.6μL/min/mg protein |
Human liver microsomes | T1/2 = 55.3 min (stable), 25.1 μL /min/mg protein |
Mouse plasma protein binding | 99.8% bound, 88.1% stability |
Human plasma protein binding | 99.7% bound, 93.9% stability |
Mouse plasma stability | 81.1% @ 5 hr, 37°C |
Human plasma stability | 93.9% @ 5 hr, 37°C |
Caco-2 | Papp A-B = 8.8 x 10-4 cm/s; B-A = 30.9 x 10-4 cm/s Efflux ratio = 3.5 (likely P-gp substrate) |
hERG inhibition | IC50 >100 μM |
PXR | EC50 > 100 μM |
CYP3A4 demonstrates activation with 11526092
In vivo studies with 11526092.
Prior to studying the therapeutic potential of our compounds in vivo the maximum tolerated dose for 11526092 was determined in 2-week-old and 10-day-old AG129 mice dosed either by oral (PO) or intraperitoneal (IP) administration, respectively (Fig. S15, Table S2). The maximum tolerated dose of 11526092 in AG129 mice was found to be >100 mg/kg when given PO and >10 mg/kg when given IP. This study was followed by determining the efficacy of 11526092 for treatment of an EV-D68 respiratory infection in four-week-old AG129 mice (Table S3). The EV-D68 respiratory model (Evans et al., 2019), based on intranasal infection of 4-week-old AG129 mice, is a non-lethal model that includes viremia with rapid tissue distribution of virus, including high virus titers in lung tissues and an elevation of proinflammatory cytokines in the lung. Treatment with 11526092 at 100 mg/kg/d alone provided significant protection from weight loss (as a percentage of initial body weight, P<0.05) following infection (Fig. S16). Titers of virus in the blood from mice following 11526092 treatment and virus challenge showed all doses were able to reduce viremia (P≤0.0001) on days 1 and 3 post-infection (p.i.) (Fig. 3A). No virus was detected for any group on day 5 p.i. Lung titers on days 1, 3, and 5 p.i. were measured after treatment and these results showed that only the guanidine-treated group showed a reduction (P≤0.05) in virus titers for days 1 and 3 p.i. compared to placebo (Fig. 3B). However, on day 5 p.i. mice treated with the 30 mg dose of 11526092 also showed a significant reduction (P≤0.05) in virus titer (Fig. 3B). Interestingly, during animal model development pleconaril did not demonstrate any antiviral activity when lung virus titers were determined day 3 p.i. (Hurst et al., 2019) and this was also observed for 11526092 in this study.
Fig. 3.
EV-D68 respiratory model viremia levels in (A) whole blood and (B) lung. Infectious virus was determined for viremia and viral lung titers by assessing the infection of human rhabdomyosarcoma (RD) cells in microtiter plates. Fifty percent cell culture infectious doses (CCID50) were converted to CCID50 per gram of lung prior to statistical analysis. Ordinary ANOVA followed by a Dunnett’s T3 multiple comparisons test was performed in Graphpad Prism 9.5.0 for macOS. Asterisks represent statistical significance using the GP style, where P values of ≤0.0001, ≤0.001, ≤0.01, ≤0.05 and ≥0.05 are summarized with “****”, “***”, “**”, “*” and ns, respectively. Error bars represent the SEM.
Early activation of the innate immune system is essential for immediate control of a respiratory virus replication and spread. Production of antiviral type I interferons (IFNs), for example, by lung epithelial cells, macrophages, and dendritic cells leads to the expression of IFN-stimulated genes with antiviral and immune-modulatory functions (Ivashkiv and Donlin, 2014; Iwasaki and Pillai, 2014). All doses of 11526092 significantly reduced lung concentrations of IL-3 (P≤0.05), IL-5 (P≤0.05), GM-CSF (P≤0.01 - P≤0.001), and RANTES (P≤0.01 - P≤0.0001) - on day 1 after treatment and challenge infection (Fig. 4, and Fig. S17). Additional reductions in cytokine concentrations after treatment and infection included IFN-γ and MCP-1 on day 1 for the 10 and 100 mg/kg treatment groups, respectively. An increase in IL-1α, IL-1β, IL-4, and IL-6 were observed on day 3 for the 100 mg/kg treatment groups (Fig. 4, Fig S17 and Supplementary text).
Fig. 4.
Select cytokine and interleukins levels in lung homogenates of AG129 mice following ma-EV-D68 challenge in the AFM respiratory mouse model. A. IL-1α, B. IL-1β, C. IL-6, D. GM-CSF, E. IL-3, F. IL-5, Each cytokine/interleukin level was compared to the placebo group for statistical significance. Ordinary two-way ANOVA followed by a Dunnett’s T3 multiple comparisons test was performed in Graphpad Prism 9.5.0 for macOS. Error bars represent the SEM. For additional cytokines see Fig. S17.
The antiviral efficacy of 11526092 for treatment of mouse-adapted (ma) EV-D68 neurological infection in 10-day-old AG129 mice was assessed in two studies where 11526092 was administered either 2 hours pre-infection or 4 hours post-infection (Fig. S18, Table S4-S5). None of the 1526092-treated mice were protected from challenge infection in this model. Guanidine, used as positive control, protected >80% of the mice in the post-challenge study. None of the treatment groups provided significant protection from weight loss (Fig. S19) and none of the 1526092-treated mice showed a statistically significant reduction in neurological scores while guanidine reduced the neurological score on day 3 post-infection. Only the guanidine treated group survived past day 4 in the post challenge study. None of the 1526092-treated mice showed a significant reduction in virus titers on days 1 or 3 and only the guanidine treated mice survived to day 5 post-infection (P≤0.001 - P≤0.0001). None of the pre-challenge 1526092-treated mice were protected from challenge infection, while guanidine protected 100% of the mice and provided a significant protection (P≤0.0001) from weight loss with pretreatment (Fig. S19). Treatment with 11526092 increased the mean day of death for mice that died following challenge, although that increase in survival was not significant. The mean day of death for the placebo group was 5.5 days and the mean day of death for each treatment group was 6.3, 5.4, and 4.3 days, for the 1, 3 and 10 mg 11526092-treated groups, respectively. Too few animals in the placebo and 11526092-treated groups survived past day 5 to complete statistical comparisons for later time points.
To assess the efficacy of our molecules against Coxsackievirus B5 virus, we tested them on a mouse model of CVB5-induced pancreatitis. This virus generally affects the pancreas and can lead to disseminated infection (Muehlenbachs et al., 2015; Sin et al., 2015). A 5-day course of treatment with the compound 11526092 showed a greater than 4-log decrease in pancreatic viral load, similar to that seen with pleconaril treatment (Fig. 5A). In the pancreas only 11526092 showed a statistically significant (P≤0.05) decrease in relative fold gene expression (Fig. 5B). Histology of pancreatic tissue in CVB5-infected mice demonstrated no signs of tissue damage in either pleconaril- or 11526092-treated animals, in contrast to the vehicle group which had severe tissue damage with inflammatory infiltration and eosinophilic cell dystrophy (Fig. S20).
Fig. 5.
Viral load in mice infected with ma-CVB5. CVB5 viral load in pancreatic tissue from CVB5-challenged mice treated with vehicle, pleconaril or 11526092 (100 mg/kg per day, twice a day, n=6/group). A virus titer in the supernatant was determined by (A) TCID50 titration (endpoint dilution) (B) and relative fold gene expression in the pancreas of CVB5-infected mice using qPCR (2−ΔΔCt) with actin B as the reference gene. Statistical significance was calculated using an ordinary one-way ANOVA followed by a Holm-Šídák's multiple comparisons test (A) or Kruskal-Wallis with Dunn’s multiple comparisons test (B) in Graphpad Prism 9.5.0 for macOS
Discussion
Many efforts towards the development of anti-picornaviral compounds have focused on the capsid-binding mechanism of action (Egorova et al., 2019). The most advanced compound, pleconaril was tested on 215 clinical isolates of EV serotypes and demonstrated promising activity (e.g. IC50 ≤ 0.03 μM for all isolates tested and IC90 inhibition of ~90% of isolates were ≤ 0.18 μM) (Pevear et al., 1999). Pleconaril also inhibits EV-71 in vitro (IC50 0.34-1.42 μM) and in the mouse model (Zhang et al., 2012), but these results are contradicted by more recent studies (Smee et al., 2016; Tijsma et al., 2014). Clinical trials of pleconaril have reported ambiguous results despite the antiviral activity in vitro. In one study, pleconaril proved effective in 2 of 3 neonates with severe enteroviral hepatitis (Aradottir et al., 2001). It also resulted in clinical improvement in 78% of the patients with chronic meningoencephalitis (Aradottir et al., 2001; Rotbart et al., 2001). However, a double-blind placebo-controlled trial in infants with EV meningitis found no significant cumulative survival increase in the treatment group among EV-confirmed subjects treated with pleconaril (Abzug et al., 2003). It also had no statistically significant effect on the treatment of the common cold at a dose of 400 mg given three times a day over five days, while adverse effects (headache and menstrual dysfunction) were common, causing some women to bleed between menstrual periods, interfering with hormonal birth control and leading to unintended pregnancy (Hayden et al., 2003). This and subsequent studies suggested that pleconaril induced CYP3A4, as this enzyme is known to be primarily responsible for the metabolism of birth control medication (Hall et al., 2003; Hayden et al., 2003; Thurman et al., 2014). Viruses with resistance to pleconaril were also found in 10.7% of pleconaril-treated patients (Pevear et al., 2005; Rotbart et al., 2001). With the clinical failure of this and other related compounds, it is imperative to restart the antiviral pipeline in in order to develop a treatment for the numerous diseases caused by EVs, RVs and CVs, as there is still a high unmet therapeutic need.
We have now described the development of an isoxazole-3-carboxamide pleconaril analog 11526092, which is a more potent inhibitor of CVB3 (Table 1) and EV-D68 (EC50 59 nM for 11626092 versus 430 nM for pleconaril (Liu et al., 2015b)). The capsid of EV-D68 consists of 60 copies of the viral protein (VP) 1, VP2, VP3 and VP4 and has an icosahedral pseudo-T=3 symmetry (Hogle et al., 1985; Liu et al., 2015b; Rossmann et al., 1985). VP 1, 2 and 3 follow the typical jelly roll-fold pattern and form the capsid surface, whereas VP4 is located inside the capsid and contributes to the stability of the capsid and genome (Chow et al., 1987; Filman et al., 1989; Paul et al., 1987; Rossmann, 1994). Each of the five-fold axes is surrounded by a deep depression called the “canyon” which is the receptor binding site for a large number of EV’s (Fields et al., 2007; Hogle et al., 1985; Rossmann, 1994; Rossmann et al., 1985). Underneath the canyon and within VP1 there is a hydrophobic region called the VP1 pocket (Fields et al., 2007; Liu et al., 2015b; Rossmann, 1994). The cryo-EM structure shows that 11526092 is bound to the VP1 hydrophobic pocket of EV-D68 (MO strain) in a similar manner as pleconaril was previously shown in EV-D68 (Fermon strain) (Liu et al., 2015b) with residues associated with the binding pocket being highly conserved (Fig. S8). In the previously reported structure of EV-D68 (Fermon) in complex with pleconaril, ILE211 on the VP1 GH loop shifts towards the pocket and thus likely locks the pocket (Liu et al., 2015b). In contrast, 11526092 in EV-D68 (MO strain) pushes the VP1 GH loop and EF loop away from the pocket (Fig. 2D, Fig. S9). This was also observed for pleconaril in EV-D68 (MO strain) (Fig. S9, S11) suggesting it both destabilizes the protein and opens it up (Liu et al., 2015a). Thus, pleconaril demonstrates different mechanisms towards EV-D68, stabilizing Fermon and destabilizing MO strains. These strains differ by several amino acids in the loop whereas there is only one ligand-binding residue difference (Fig. S12). Our cryo-EM structures provide new atomic level information on the inhibition mechanism that may be beneficial for future EV-D68 inhibitor design and suggest that the determination of how molecules bind to the VP1 in different strains may be of some importance.
We have demonstrated the efficacy of 11526092 for treatment of an EV-D68 respiratory infection in four-week-old AG129 mouse model (Fig. 3). The EV-D68 respiratory model based on intranasal infection of 4-week-old AG129 mice is a non-lethal model that includes viremia with rapid tissue distribution of virus, including high virus titers in lung tissues and an elevation of proinflammatory cytokines in the lung. Treatment with all doses of 11526092 significantly reduced blood virus (viremia) on days 1 and 3 p.i.. No virus was detected in the blood of animals treated on day 5 post-infection indicating virus clearance from the blood by this time. In addition, a dose of 30 mg/kg/day reduced lung virus titers on day 5 p.i. compared to placebo-treated mice. Interestingly, a full elimination of detectable viremia without full tissue-specific clearance is not unprecedented, even while providing full survival protection for other viruses (Lo et al., 2019). This would suggest that full viremia suppression may be a strong indicator of full disease progression for viral infections related to human disease.
Production of inflammatory cytokines such as IL-1β, IL-6, and TNF-α is key in control of many respiratory infections (Dienz et al., 2012; Ichinohe et al., 2009; Iwasaki and Pillai, 2014; Pang et al., 2013; Schmitz et al., 2005; Yang et al., 2017). An increase in IL-1α/β is important for survival, acting through the recruitment and priming of CD4+ T-cells (Platania-Solazzo et al., 1992). IL-6 also recruits and prime T-cells in a similar manner (Dienz and Rincon, 2009). IL-6−/− knockout mice showed reduced viral clearance 7 days p.i. (Lauder et al., 2013). Previously, dexamethasone was found to exacerbate the symptoms and increased viral titers in the mouse model of EV71 infection while recombinant interferon protected against infection (Liu et al., 2005). A recent publication showed how the kinase inhibitor vandetanib reduces lung inflammation and tissue damage caused by SARS-CoV-2 in a 3-day mouse infection model without reducing viral load, essentially suppressing the cytokine storm (Puhl et al., 2022). In the current EV-D68 study cellular immunity was evaluated by quantitation of cytokines and chemokines using a multiplex ELISA of lung lavage samples collected on days 1, 3, and 5 p.i.. All doses of 11526092 significantly reduced lung concentrations of IL-3, IL-5, GM-CSF, and RANTES on day 1 after treatment and challenge infection (Fig. 4). Additional reductions in cytokine concentrations after treatment and infection included IFNγ and MCP-1 on day 1 for the 10 and 100 mg/kg treatment groups, respectively. An increase in IL-1α, IL-1β, IL-4, and IL-6 was observed on day 3 for the 100 mg/kg treatment groups. In addition, an increase in IL-10 and MIP-1α was observed on day 5 for the 10 and 30 mg/kg treatment groups, respectively (Fig. S17). Evaluating the efficacy of 11526092 administered therapeutically (after virus infection) in this model would be valuable to determine the window for administration of 11526092 in future.
In stark contrast, EV-D68 neurological studies demonstrated a lack of the prophylactic and therapeutic efficacy of 11526092 (dosed up to 10 mg/kg/day IP) in terms of survival, weight loss, neurological scores, and virus titers in the blood when treated at either 2-hour pre-infection or 4 hours post-infection (Fig. S18). The positive control guanidine (100 mg/kg/day IP) was more effective in this model, but this is not considered a clinically viable option. The lack of efficacy of 11526092 in this mouse model could be due to the level of exposure as demonstrated in our earlier in vitro ADME studies (e.g. poor mouse metabolic stability (Table 3)) and pharmacokinetics in mouse (Egorova et al., 2020) and this suggests we may require substantially higher concentrations when dosed IP. In humans, pharmacokinetics may be improved as 11526092 was considered stable when assessed for metabolic stability in human microsomes (Table 3) and this may improve exposure to this drug.
As the previously demonstrated failure of pleconaril in the clinic and breakthrough pregnancies were proposed as due to CYP3A4 induction (Hall et al., 2003; Thurman et al., 2014) we have now evaluated whether 11526092 behaves similarly in vitro. We had previously tested 11526092 in cryopreserved human hepatocytes from a single donor in duplicate using rifampicin as positive control (Lu and Li, 2001). At 1 μM pleconaril resulted in 1.7x induction (13% of control) vs 11526092 1.2x (3% of control). These results suggest 11526092 is less likely to be a CYP3A induction risk versus pleconaril. We have now also demonstrated that neither 11526092 nor pleconaril is an agonist of the pregnane X-receptor (PXR), which is involved in induction of CYP3A4. Instead of inhibiting CYP3A4 in human liver microsomes both pleconaril and 11526092 demonstrate what we propose is activation (or autoactivation) of CYP3A4 at higher concentrations (Fig. S21). Whether this is clinically significant is unknown and these in vitro observations may be considered further for future study. Due to 11526092 possessing more potent antiviral activity in vitro, this observed effect on CYP3A4 may be less pronounced than for pleconaril, which has a reduced antiviral activity and will require a higher dose. Another important observation of our work to date is that 11526092 also retains activity against pleconaril-resistant viruses (Egorova et al., 2020) which could suggest resistance to this compound may be less of an issue than for pleconaril, which may also be further explored in future.
As CVB5 causes numerous important diseases in humans (Yang et al., 2022) we tested the in vitro efficacy of 11526092 against CVB5 (Fig. S3) and in the infected mouse model which was treated for 5 days p.i. starting at 12h p.i.. 11526092 demonstrated a statistically significant, greater than 4 log decrease in pancreatic viral load (Fig. 5A) and fold gene expression (Fig. 5B) with no signs of pancreatic damage (Fig. S20).
Limitations of this study include the few analogs that were explored in vitro and in vivo while it is possible that we may be able to improve the molecule characteristics further to improve the efficacy. We carefully selected compounds that seemed ideal based on our earlier in vitro work with other viruses. The animal models used may not represent ideal representations of these infections, but we are clearly constrained by what is currently available for EV-D68 and CVB5.
In conclusion, 11526092 is a new antiviral compound for EVs, which binds to EV-D68 in a similar manner to pleconaril, and we have now described the unique mechanism of action for compounds binding to different strains of the EV-D68 virus. 11526092 is well-tolerated in mice and demonstrates promising antiviral efficacy in in vivo mouse models of EV-D68 (respiratory model) and CVB5 infection. Based on this study and in the absence of any suitable antiviral treatments for these viruses, further testing of 11526092 may be warranted against these and other related EV’s.
Supplementary Material
Highlights.
Enterovirus-D68 (EV-D68) and Coxsackie B5 (CVB5) have no approved treatment.
Our lead molecule 11526092 demonstrates protein destabilization by Cryo-EM
11526092 displays in vitro potency against multiple enteroviruses
11526092 also displays in vivo efficacy against EV-D68 and CVB5
11526092 represents a future treatment for EV-D68, CVB5 and other enteroviruses
Acknowledgments:
Dr. Eun-Chung Park, Dr. Mindy Davis and colleagues are kindly acknowledged for their support of this project and assistance with the NIAID virus in vivo testing and screening capabilities. Dr. Patricia Vignaux and Dr. Ana Puhl are also acknowledged for careful reading. Dr. Michaela Schmidtke is acknowledged for our earlier work on this series of compounds.
Funding:
National Institutes of Health (National Institute of Neurological Disorders and Stroke (NINDS) grant 1R01NS102164-01 (SE)
National Institutes of General Medical Sciences grant: R44GM122196-02A1 (SE)
National Institute of Allergy and Infectious Diseases (NIAID) program for non-clinical and pre-clinical services (SE)
This work was supported R01-AI011219 (R.J.K), and by NIH/NIAID contract HHSN272201700060C (R.J.K; PI: K. Satchell).
Funding was provided by the National Institute of Health contract number HHSN27220100041I, Task Order A16, from the Virology Branch, Division of Microbiology and Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institute of Health, USA.
Footnotes
Competing interests:
SE is owner, TRL is an employee at Collaborations Pharmaceuticals, Inc. SE and VM are co-inventors on a patent submitted for 11526092. All other co-authors have no competing interests.
Data and materials availability:
All data are available in the main text or the supplementary materials consisting of Supplemental Text, Supplemental Methods, Supplemental references, Fig S1-S2, Tables S1-S6.
Cryo-EM files have been published in the PDB.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Abzug MJ, Cloud G, Bradley J, Sanchez PJ, Romero J, Powell D, Lepow M, Mani C, Capparelli EV, Blount S, Lakeman F, Whitley RJ, Kimberlin DW, National Institute of, A., Infectious Diseases Collaborative Antiviral Study, G., 2003. Double blind placebo-controlled trial of pleconaril in infants with enterovirus meningitis. Pediatr Infect Dis J 22, 335–341. [DOI] [PubMed] [Google Scholar]
- Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, Zwart PH, 2010. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213–221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Andreoni AR, Colton AS, 2017. Coxsackievirus B5 associated with hand-foot-mouth disease in a healthy adult. JAAD Case Rep 3, 165–168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Aradottir E, Alonso EM, Shulman ST, 2001. Severe neonatal enteroviral hepatitis treated with pleconaril. Pediatr Infect Dis J 20, 457–459. [DOI] [PubMed] [Google Scholar]
- Arya SC, 1998. Japanese encephalitis virus and poliomyelitis-like illness. Lancet 351, 1964. [DOI] [PubMed] [Google Scholar]
- Bratslavska O, Platace D, Miklasevics E, Fuchs D, Martinsons A, 2007. Influence of neopterin and 7,8-dihydroneopterin on the replication of Coxsackie type B5 and influenza A viruses. Med Microbiol Immunol 196, 23–29. [DOI] [PubMed] [Google Scholar]
- Braun H, Makarov VA, Riabova OB, Wutzler P, Schmidtke M, 2011. Amino Acid Substitutions At Residue 207 of Viral Capsid Protein 1 (VP1) Confer Pleconaril Resistance in Coxsackievirus B3 (CVB3). Antiviral Research 90, A54–A55. [Google Scholar]
- Carta A, Sanna G, Briguglio I, Madeddu S, Vitale G, Piras S, Corona P, Peana AT, Laurini E, Fermeglia M, Pricl S, Serra A, Carta E, Loddo R, Giliberti G, 2018. Quinoxaline derivatives as new inhibitors of coxsackievirus B5. Eur J Med Chem 145, 559–569. [DOI] [PubMed] [Google Scholar]
- Chen VB, Arendall WB 3rd, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, Murray LW, Richardson JS, Richardson DC, 2010. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr 66, 12–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chow M, Newman JF, Filman D, Hogle JM, Rowlands DJ, Brown F, 1987. Myristylation of picornavirus capsid protein VP4 and its structural significance. Nature 327, 482–486. [DOI] [PubMed] [Google Scholar]
- Diana GD, Rudewicz P, Pevear DC, Nitz TJ, Aldous SC, Aldous DJ, Robinson DT, Draper T, Dutko FJ, Aldi C, et al. , 1995. Picornavirus inhibitors: trifluoromethyl substitution provides a global protective effect against hepatic metabolism. J Med Chem 38, 1355–1371. [DOI] [PubMed] [Google Scholar]
- Dienz O, Rincon M, 2009. The effects of IL-6 on CD4 T cell responses. Clin Immunol 130, 27–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dienz O, Rud JG, Eaton SM, Lanthier PA, Burg E, Drew A, Bunn J, Suratt BT, Haynes L, Rincon M, 2012. Essential role of IL-6 in protection against H1N1 influenza virus by promoting neutrophil survival in the lung. Mucosal Immunol 5, 258–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Egorova A, Ekins S, Schmidtke M, Makarov V, 2019. Back to the future: Advances in development of broad-spectrum capsid-binding inhibitors of enteroviruses. Eur J Med Chem 178, 606–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Egorova A, Kazakova E, Jahn B, Ekins S, Makarov V, Schmidtke M, 2020. Novel pleconaril derivatives: Influence of substituents in the isoxazole and phenyl rings on the antiviral activity against enteroviruses. Eur J Med Chem 188, 112007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Emsley P, Lohkamp B, Scott WG, Cowtan K, 2010. Features and development of Coot. Acta Crystallogr D Biol Crystallogr 66, 486–501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Evans WJ, Hurst BL, Peterson CJ, Van Wettere AJ, Day CW, Smee DF, Tarbet EB, 2019. Development of a respiratory disease model for enterovirus D68 in 4-week-old mice for evaluation of antiviral therapies. Antiviral Res 162, 61–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fields BN, Knipe DM, Howley PM, Griffin DE, 2007. Fields Virology, 5th ed. Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia. [Google Scholar]
- Filman DJ, Syed R, Chow M, Macadam AJ, Minor PD, Hogle JM, 1989. Structural factors that control conformational transitions and serotype specificity in type 3 poliovirus. EMBO J 8, 1567–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Glass JD, Samuels O, Rich MM, 2002. Poliomyelitis due to West Nile virus. N Engl J Med 347, 1280–1281. [DOI] [PubMed] [Google Scholar]
- Hall SD, Wang Z, Huang SM, Hamman MA, Vasavada N, Adigun AQ, Hilligoss JK, Miller M, Gorski JC, 2003. The interaction between St John's wort and an oral contraceptive. Clin Pharmacol Ther 74, 525–535. [DOI] [PubMed] [Google Scholar]
- Hayden FG, Herrington DT, Coats TL, Kim K, Cooper EC, Villano SA, Liu S, Hudson S, Pevear DC, Collett M, McKinlay M, Pleconaril Respiratory Infection Study, G., 2003. Efficacy and safety of oral pleconaril for treatment of colds due to picornaviruses in adults: results of 2 double-blind, randomized, placebo-controlled trials. Clin Infect Dis 36, 1523–1532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Helfferich J, Knoester M, Van Leer-Buter CC, Neuteboom RF, Meiners LC, Niesters HG, Brouwer OF, 2019. Acute flaccid myelitis and enterovirus D68: lessons from the past and present. Eur J Pediatr 178, 1305–1315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hixon AM, Clarke P, Tyler KL, 2017. Evaluating Treatment Efficacy in a Mouse Model of Enterovirus D68-Associated Paralytic Myelitis. J Infect Dis 216, 1245–1253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hogle JM, Chow M, Filman DJ, 1985. Three-dimensional structure of poliovirus at 2.9 A resolution. Science 229, 1358–1365. [DOI] [PubMed] [Google Scholar]
- Holm-Hansen CC, Midgley SE, Fischer TK, 2016. Global emergence of enterovirus D68: a systematic review. Lancet Infect Dis 16, e64–e75. [DOI] [PubMed] [Google Scholar]
- Huang CC, Liu CC, Chang YC, Chen CY, Wang ST, Yeh TF, 1999. Neurologic complications in children with enterovirus 71 infection. N Engl J Med 341, 936–942. [DOI] [PubMed] [Google Scholar]
- Hurst BL, Evans WJ, Smee DF, Van Wettere AJ, Tarbet EB, 2019. Evaluation of antiviral therapies in respiratory and neurological disease models of Enterovirus D68 infection in mice. Virology 526, 146–154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ichinohe T, Lee HK, Ogura Y, Flavell R, Iwasaki A, 2009. Inflammasome recognition of influenza virus is essential for adaptive immune responses. J Exp Med 206, 79–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Imamura T, Oshitani H, 2015. Erratum: Global reemergence of enterovirus D68 as an important pathogen for acute respiratory infections. Rev Med Virol 25, 268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ivashkiv LB, Donlin LT, 2014. Regulation of type I interferon responses. Nat Rev Immunol 14, 36–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iwasaki A, Pillai PS, 2014. Innate immunity to influenza virus infection. Nat Rev Immunol 14, 315–328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Knoester M, Helfferich J, Poelman R, Van Leer-Buter C, Brouwer OF, Niesters HGM, Group, E.-D.A.W., 2019. Twenty-nine Cases of Enterovirus-D68-associated Acute Flaccid Myelitis in Europe 2016: A Case Series and Epidemiologic Overview. Pediatr Infect Dis J 38, 16–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lauder SN, Jones E, Smart K, Bloom A, Williams AS, Hindley JP, Ondondo B, Taylor PR, Clement M, Fielding C, Godkin AJ, Jones SA, Gallimore AM, 2013. Interleukin-6 limits influenza-induced inflammation and protects against fatal lung pathology. Eur J Immunol 43, 2613–2625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu ML, Lee YP, Wang YF, Lei HY, Liu CC, Wang SM, Su IJ, Wang JR, Yeh TM, Chen SH, Yu CK, 2005. Type I interferons protect mice against enterovirus 71 infection. J Gen Virol 86, 3263–3269. [DOI] [PubMed] [Google Scholar]
- Liu Y, Sheng J, Baggen J, Meng G, Xiao C, Thibaut HJ, van Kuppeveld FJ, Rossmann MG, 2015a. Sialic acid-dependent cell entry of human enterovirus D68. Nat Commun 6, 8865. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu Y, Sheng J, Fokine A, Meng G, Shin WH, Long F, Kuhn RJ, Kihara D, Rossmann MG, 2015b. Structure and inhibition of EV-D68, a virus that causes respiratory illness in children. Science 347, 71–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lo MK, Feldmann F, Gary JM, Jordan R, Bannister R, Cronin J, Patel NR, Klena JD, Nichol ST, Cihlar T, Zaki SR, Feldmann H, Spiropoulou CF, de Wit E, 2019. Remdesivir (GS-5734) protects African green monkeys from Nipah virus challenge. Sci Transl Med 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loddo R, Novelli F, Sparatore A, Tasso B, Tonelli M, Boido V, Sparatore F, Collu G, Delogu I, Giliberti G, La Colla P, 2015. Antiviral activity of benzotriazole derivatives. 5-[4-(Benzotriazol-2-yl)phenoxy]-2,2-dimethylpentanoic acids potently and selectively inhibit Coxsackie Virus B5. Bioorg Med Chem 23, 7024–7034. [DOI] [PubMed] [Google Scholar]
- Lu C, Li AP, 2001. Species comparison in P450 induction: effects of dexamethasone, omeprazole, and rifampin on P450 isoforms 1A and 3A in primary cultured hepatocytes from man, Sprague-Dawley rat, minipig, and beagle dog. Chem Biol Interact 134, 271–281. [DOI] [PubMed] [Google Scholar]
- Ma KC, Winn A, Moline HL, Scobie HM, Midgley CM, Kirking HL, Adjemian J, Hartnett KP, Johns D, Jones JM, Lopez A, Lu X, Perez A, Perrine CG, Rzucidlo AE, McMorrow ML, Silk BJ, Stein Z, Vega E, New Vaccine Surveillance Network, C., Hall AJ, 2022. Increase in Acute Respiratory Illnesses Among Children and Adolescents Associated with Rhinoviruses and Enteroviruses, Including Enterovirus D68 - United States, July-September 2022. MMWR Morb Mortal Wkly Rep 71, 1265–1270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malmstrom K, Pitkaranta A, Carpen O, Pelkonen A, Malmberg LP, Turpeinen M, Kajosaari M, Sarna S, Lindahl H, Haahtela T, Makela MJ, 2006. Human rhinovirus in bronchial epithelium of infants with recurrent respiratory symptoms. J Allergy Clin Immunol 118, 591–596. [DOI] [PubMed] [Google Scholar]
- Martin JA, Messacar K, Yang ML, Maloney JA, Lindwall J, Carry T, Kenyon P, Sillau SH, Oleszek J, Tyler KL, Dominguez SR, Schreiner TL, 2017. Outcomes of Colorado children with acute flaccid myelitis at 1 year. Neurology 89, 129–137. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matz J, 2013. Vapendavir significantly improves upper respiratory symptoms of naturally acquired rhinovirus infection in asthmatic adults: Results of a phase 2 clinical trial. Eur Respir J 42, 1493. [Google Scholar]
- Melnick JL, 1997. Poliovirus and other enteroviruses, in: Evans AS, Kaslow RA (Eds.), Viral infections of humans: epidemiology and control. Plenum Publishing, New York, pp. 583–663. [Google Scholar]
- Messacar K, Asturias EJ, Hixon AM, Van Leer-Buter C, Niesters HGM, Tyler KL, Abzug MJ, Dominguez SR, 2018. Enterovirus D68 and acute flaccid myelitis-evaluating the evidence for causality. Lancet Infect Dis 18, e239–e247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Messacar K, Sillau S, Hopkins SE, Otten C, Wilson-Murphy M, Wong B, Santoro JD, Treister A, Bains HK, Torres A, Zabrocki L, Glanternik JR, Hurst AL, Martin JA, Schreiner T, Makhani N, DeBiasi RL, Kruer MC, Tremoulet AH, Van Haren K, Desai J, Benson LA, Gorman MP, Abzug MJ, Tyler KL, Dominguez SR, 2019. Safety, tolerability, and efficacy of fluoxetine as an antiviral for acute flaccid myelitis. Neurology 92, e2118–e2126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miller EK, Lu X, Erdman DD, Poehling KA, Zhu Y, Griffin MR, Hartert TV, Anderson LJ, Weinberg GA, Hall CB, Iwane MK, Edwards KM, New Vaccine Surveillance, N., 2007. Rhinovirus-associated hospitalizations in young children. J Infect Dis 195, 773–781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morens DM, Folkers GK, Fauci AS, 2019. Acute Flaccid Myelitis: Something Old and Something New. mBio 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Muehlenbachs A, Bhatnagar J, Zaki SR, 2015. Tissue tropism, pathology and pathogenesis of enterovirus infection. J Pathol 235, 217–228. [DOI] [PubMed] [Google Scholar]
- Oberste MS, Maher K, Schnurr D, Flemister MR, Lovchik JC, Peters H, Sessions W, Kirk C, Chatterjee N, Fuller S, Hanauer JM, Pallansch MA, 2004. Enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses. J Gen Virol 85, 2577–2584. [DOI] [PubMed] [Google Scholar]
- Pang IK, Ichinohe T, Iwasaki A, 2013. IL-1R signaling in dendritic cells replaces pattern-recognition receptors in promoting CD8(+) T cell responses to influenza A virus. Nat Immunol 14, 246–253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paul AV, Schultz A, Pincus SE, Oroszlan S, Wimmer E, 1987. Capsid protein VP4 of poliovirus is N-myristoylated. Proc Natl Acad Sci U S A 84, 7827–7831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE, 2004. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, 1605–1612. [DOI] [PubMed] [Google Scholar]
- Pevear DC, Hayden FG, Demenczuk TM, Barone LR, McKinlay MA, Collett MS, 2005. Relationship of pleconaril susceptibility and clinical outcomes in treatment of common colds caused by rhinoviruses. Antimicrob Agents Chemother 49, 4492–4499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pevear DC, Tull TM, Seipel ME, Groarke JM, 1999. Activity of pleconaril against enteroviruses. Antimicrob Agents Chemother 43, 2109–2115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Platania-Solazzo A, Field TM, Blank J, Seligman F, Kuhn C, Schanberg S, Saab P, 1992. Relaxation therapy reduces anxiety in child and adolescent psychiatric patients. Acta Paedopsychiatr 55, 115–120. [PubMed] [Google Scholar]
- Potterton L, Agirre J, Ballard C, Cowtan K, Dodson E, Evans PR, Jenkins HT, Keegan R, Krissinel E, Stevenson K, Lebedev A, McNicholas SJ, Nicholls RA, Noble M, Pannu NS, Roth C, Sheldrick G, Skubak P, Turkenburg J, Uski V, von Delft F, Waterman D, Wilson K, Winn M, Wojdyr M, 2018. CCP4i2: the new graphical user interface to the CCP4 program suite. Acta Crystallogr D Struct Biol 74, 68–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Puhl AC, Gomes GF, Damasceno S, Fritch EJ, Levi JA, Johnson NJ, Scholle F, Premkumar L, Hurst BL, Lee-Montiel F, Veras FP, Batah SS, Fabro AT, Moorman NJ, Yount BL, Dickmander RJ, Baric RS, Pearce KH, Cunha FQ, Alves-Filho JC, Cunha TM, Ekins S, 2022. Vandetanib Blocks the Cytokine Storm in SARS-CoV-2-Infected Mice. ACS Omega 7, 31935–31944. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Punjani A, Rubinstein JL, Fleet DJ, Brubaker MA, 2017. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290–296. [DOI] [PubMed] [Google Scholar]
- Reed LJ, Muench H, 1938. A simple method of estimating fifty percent endpoints. Am J Hyg 27, 493–498. [Google Scholar]
- Renois F, Leveque N, Deliege PG, Fichel C, Bouin A, Abely M, N'Guyen Y, Andreoletti L, 2013. Enteroviruses as major cause of microbiologically unexplained acute respiratory tract infections in hospitalized pediatric patients. J Infect 66, 494–502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rossmann MG, 1994. Viral cell recognition and entry. Protein Sci 3, 1712–1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rossmann MG, Arnold E, Erickson JW, Frankenberger EA, Griffith JP, Hecht HJ, Johnson JE, Kamer G, Luo M, Mosser AG, et al. , 1985. Structure of a human common cold virus and functional relationship to other picornaviruses. Nature 317, 145–153. [DOI] [PubMed] [Google Scholar]
- Rotbart HA, 2000. Antiviral therapy for enteroviruses and rhinoviruses. Antivir Chem Chemother 11, 261–271. [DOI] [PubMed] [Google Scholar]
- Rotbart HA, Webster AD, Pleconaril Treatment Registry, G., 2001. Treatment of potentially life-threatening enterovirus infections with pleconaril. Clin Infect Dis 32, 228–235. [DOI] [PubMed] [Google Scholar]
- Scheres SH, Chen S, 2012. Prevention of overfitting in cryo-EM structure determination. Nat Methods 9, 853–854. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schmitz N, Kurrer M, Bachmann MF, Kopf M, 2005. Interleukin-1 is responsible for acute lung immunopathology but increases survival of respiratory influenza virus infection. J Virol 79, 6441–6448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Senior K, 2002. FDA panel rejects common cold treatment. Lancet Infect Dis 2, 264. [DOI] [PubMed] [Google Scholar]
- Sin J, Mangale V, Thienphrapa W, Gottlieb RA, Feuer R, 2015. Recent progress in understanding coxsackievirus replication, dissemination, and pathogenesis. Virology 484, 288–304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Smee DF, Evans WJ, Nicolaou KC, Tarbet EB, Day CW, 2016. Susceptibilities of enterovirus D68, enterovirus 71, and rhinovirus 87 strains to various antiviral compounds. Antiviral Res 131, 61–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Steele MT, Walsh I, 2015. Commentary. Severe Respiratory Illness Associated With Enterovirus D68-Missouri and Illinois, 2014. Ann Emerg Med 65, 335. [DOI] [PubMed] [Google Scholar]
- Suloway C, Pulokas J, Fellmann D, Cheng A, Guerra F, Quispe J, Stagg S, Potter CS, Carragher B, 2005. Automated molecular microscopy: the new Leginon system. J Struct Biol 151, 41–60. [DOI] [PubMed] [Google Scholar]
- Thurman AR, Anderson S, Doncel GF, 2014. Effects of hormonal contraception on antiretroviral drug metabolism, pharmacokinetics and pharmacodynamics. Am J Reprod Immunol 71, 523–530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tijsma A, Franco D, Tucker S, Hilgenfeld R, Froeyen M, Leyssen P, Neyts J, 2014. The capsid binder Vapendavir and the novel protease inhibitor SG85 inhibit enterovirus 71 replication. Antimicrob Agents Chemother 58, 6990–6992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Toivonen L, Schuez-Havupalo L, Karppinen S, Teros-Jaakkola T, Rulli M, Mertsola J, Waris M, Peltola V, 2016. Rhinovirus Infections in the First 2 Years of Life. Pediatrics 138. [DOI] [PubMed] [Google Scholar]
- Tokarz R, Firth C, Madhi SA, Howie SRC, Wu W, Sall AA, Haq S, Briese T, Lipkin WI, 2012. Worldwide emergence of multiple clades of enterovirus 68. J Gen Virol 93, 1952–1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu G, Robertson DH, Brooks CL 3rd, Vieth M, 2003. Detailed analysis of grid-based molecular docking: A case study of CDOCKER-A CHARMm-based MD docking algorithm. J Comput Chem 24, 1549–1562. [DOI] [PubMed] [Google Scholar]
- Yang ML, Wang CT, Yang SJ, Leu CH, Chen SH, Wu CL, Shiau AL, 2017. IL-6 ameliorates acute lung injury in influenza virus infection. Sci Rep 7, 43829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang P, Shi D, Fu J, Zhang L, Chen R, Zheng B, Wang X, Xu S, Zhu L, Wang K, 2022. Atomic Structures of Coxsackievirus B5 Provide Key Information on Viral Evolution and Survival. J Virol 96, e0010522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang G, Zhou F, Gu B, Ding C, Feng D, Xie F, Wang J, Zhang C, Cao Q, Deng Y, Hu W, Yao K, 2012. In vitro and in vivo evaluation of ribavirin and pleconaril antiviral activity against enterovirus 71 infection. Arch Virol 157, 669–679. [DOI] [PubMed] [Google Scholar]
- Zhong Q, Yang Z, Liu Y, Deng H, Xiao H, Shi L, He J, 2009. Antiviral activity of Arbidol against Coxsackie virus B5 in vitro and in vivo. Arch Virol 154, 601–607. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.