Skip to main content
NCBI home page
Ibrain logoLink to Ibrain
. 2021 Sep 28;7(3):192–199. doi: 10.1002/j.2769-2795.2021.tb00083.x

Sevoflurane inhalation has a cognitive impairing effect of aging rats involving the regulation of AChE and ChAT

Xin‐Xin Yang 1, Zhen‐Yu Wu 1, Yang Yang 1, Chao Zhang 1, Xia‐Fei Lin 2, Lin Zhou 1, Feng‐Lin Wang 1, Liang Dong, Zhao‐Qiong Zhu 3,✉
PMCID: PMC10529151  PMID: 37786796

Abstract

Background

Acetylcholinesterase (AChE) and choline acetyltransferase (ChAT) are closely related to the regulation of learning and memory. Nevertheless, whether sevoflurane has influence on cognition through regulating the expression of AChE and ChAT remains unclear.

Methods

Aging rat model was established by subcutaneously injection of D‐galactose for 6 consecutive weeks. To determine the role of AChE and ChAT in sevoflurane‐induced cognitive impairment, the Morris water maze (MWM) was used to assess the cognitive and memory function after sevoflurane exposure. Then, the variations of AChE and ChAT was detected by western blotting analysis and quantitative real‐time polymerase chain reaction (qRT‐PCR) respectively.

Results

Our result indicated that aging model rats had showed cognition decline at 2 hours and 1week after exposure to sevoflurane. Moreover, the expression of AChE and ChAT enhanced in rats that had inhaled sevoflurane. Interestingly, our study also found that the increase of oxygen concentration had a positive impact on the gene expression of ChAT.

Conclusion

We have identified that the overexpression of AChE and ChAT improved significantly cognitive function after sevoflurane exposure.

Keywords: Perioperative neurocognitive disorders, AChE, ChAT

Introduction

The elderly always experience impairments on cognitive ability in the postoperative period (Chung W, 2015). These impairments include postoperative delirium and deficits in the domains of attention, emotion and personality (Lin, et al., 2020). The symptoms could relieve in weeks or in months. However, some could continue or reemerge after improvement. Recently, these impairments are called perioperative neurocognitive disorders (PND) (Eckenhoff, et al., 2020). Studies have identified risk factors of PND as age, infection, and preexisting cognitive disorders (Zhao, et al., 2020). It’s noticeable that the highest incidence of PND was found in elderly patients (Veeramuthu, et al., 2015). However, it’s uncertain about the relationship between postoperative cognitive impairment with anesthetic. Therefore, it is now considered essential to find out whether anesthesia has influence on cognition. As a commonly used volatile anesthetic in clinic, sevoflurane was verified that it could lead to neurodegenerative changes in brain and long‐term learning and memory impairments (Chung, et al., 2015). However, how sevoflurane causes those adverse effects is still not fully understood. Therefore, it is essential to find out the specific mechanism underlying sevoflurane‐induced neurotoxicity and thereby to develop an effective approach against PND.

Acetylcholine receptors (AchRs) are widely expressed in the brain and maintain various neuronal functions (Muramatsu, et al., 2018). Acetylcholine (Ach) is the main neuro‐transmitter in the cholinergic system which involves in the regulation of learning and memory (Ballinger, et al., 2016). At the same time, acetylcholinesterase (AChE) and choline acetyltransferase (ChAT) are necessary for the synthesis and decomposition of Ach. AChE acts as a high selectively enzyme that could hydrolyze Ach into choline and acetic acid, Meanwhile, ChAT is synthesized by the soma of neurons and can be a marker of cholinergic neurons which can promote the synthesis of Ach (Hut, et al., 2011). The expression of AChE and ChAT are sensitive indicators of Ach. Study showed that the expression of AChE and ChAT were down‐regulated when cognitive impairment happened (Chauhan, et al., 2016). Precious studies found that inhalation anesthetics could inhibit expression of ChAT to reduce the content of Ach to impair cognition (Shichino, et al., 1998). This phenomenon is likely to be related to hippocampus (Azimaraghi, et al., 2019).

In this study, we used aging model of Sprague–Dawley rats that had been injected D‐galactose for 42 days (Hadzi‐Petrushev, et al., 2015) to inhale sevoflurane for 6 hours (h). Then, with neurobehavioral assessment and the detection of biochemical index located in the hippocampus, our aim is to demonstrate the hypothesis that AChE and ChAT is a crucial molecule in sevoflurane‐induced cognitive dysfunction of the old. Investigating the function of AChE and ChAT may provide a novel strategy for PND.

Materials and methods

Main reagents and instruments

3‐month‐old Male Sprague–Dawley (S‐D) rats in the range of 375 ± 25 g were purchased from the Tianqin Biotechnology Co., Ltd (Hunan, China); D‐galactose (batch No:914E54, America, Solarbio company); sevoflurane was obtained as a gift sample from Shandong Lunanbeite Pharmaceutical Limited (Shandong, China); sodium lime (batch No: 2179000, UK inter‐surgical company); Fabius anesthesia machine (Germany Drager company); Vamos gas detector (Germany Drager company); Mt‐200 Morris water maze (MWM)(Chengdu Taimeng Technology Co., Ltd.); Quantitative reverse transcription PCR (qRT‐PCR) Primers (Lvzesen Biotechnology Co., Ltd, Beijing, China); AChE Antibody and ChAT Antibody (Abcam company, UK). All other reagents used were of analytical grade. Double‐distilled water was used throughout the experimental work.

Establishment of aging rat model

All rats were maintained in a pathogen‐free facility under controlled room temperature (21 ± 2℃) and relative humidity (50‐60%) with 12‐/12‐h light/dark cycle in the departmental animal house. After adaptive feeding of one week, rats were subcutaneously injected D‐galactose at the back of the neck with a dose of 0.125 mg/kg/d consecutively for 42 days to establish aging rat model (Figure  1 ).

Figure 1.

Figure 1

Open in a new tab

The general process of this experiment. S‐D rats were used to carry out our experiment. Injection of D‐galactose lasted for 42 days after seven‐day adaptive feeding. Then behavioral test was performed. The inhalation experiments were followed. Afterwards, we examined the behavior again. Finally, we harvested the hippocampus and did biochemical experiments.

Sevoflurane inhalation

A total of 54 D‐gal‐induced aging rats were randomly divided into three groups (n = 18 rats/group): Control, Air oxygen (A/O) and Sevoflurane (Sev). A 75 cm × 40 cm × 15 cm inhalation anesthesia box was made by ourselves. There was a hole on both sides of the anesthesia box, which was connected with the screw pipe and gas detector (Figure  2A ). The bottom of the box was paved with 1‐cm‐thick sodium lime to absorb water and carbon dioxide (Figure  2B ). Rats in the the control group were fed naturally without special treatment while rats in the A/O group inhaled carrier gas (2 L/min air + 2 L/min O2) for 6 h. Rats in the sevoflurane group were exposed to 3.2% sevoflurane and carrier gas for 6 h. The concentration of sevoflurane in the anesthesia box was under continuous detection during inhalation.

Figure 2.

Figure 2

Open in a new tab

The sketch map of our anesthesia box. (A) Our anesthesia box has 2 air inlets and an air outlet. A mixture of air and oxygen and sevoflurane can enter from the air inlet while exhaust gas exits through the air outlet. (B) From the lateral view it can be seen that soda lime is placed at the bottom of the box to absorb carbon dioxide and water vapor as the rats exhaling. The cotton cushion on it is for protecting rats from scald after sodium lime reaction.

Cognition measurements

The MWM tasks include orientation navigation experiment, space exploration trials and working memory testing.

Orientation navigation experiment aims at developing rats’ stable memory to the platform hid in third quadrants of the poor and determining whether the behavioral abilities of the three groups of rats are at the same baseline level. Rats are released in proper order from the midpoint of the four quadrants facing the poor wall. Each rat has 120 second (s) to find the platform. Each rat’s swimming distance, trajectory and time to find the platform in the water are recorded. If the rats fail to complete the above objectives, they were guided to the platform and stayed for 30 s. Their escape latency was recorded as 120 s.

Space exploration is carried out at 2 h, 1 week and 4 weeks after the rats were awakened from inhalation treatment. Underwater platform is removed. Then the rats are placed into the water at the midway of the third quadrant facing the basin wall. The swimming trajectory of the rats is recorded within 120 s and calculate the times of crossings of the original platform, the time of crossings of the original platform quadrant, the time of effective area crossings and the percentage of the time of crossings of the platform quadrant. The purpose of this experiment is to evaluate the long‐term memory ability of rats in each group.

Working memory testing is for judging the short‐term learning and memory ability of rats in each group. Place the platform in any quadrant randomly except the third quadrant. Choose a fixed entry point and put the rat into the water at this entry point facing the wall of the basin. If the rat finds the platform within 60 s, make it stay on the platform 20 s. Guide the rat which fails to find the platform to the platform and make it stay there for 20 s. Release the rat again at the same location after 30 s. Record the time that the rat spends in finding the platform within 60 s as the incubation period. If the rat fails to find the platform within 60 s, the incubation period is recorded as 60 s. The incubation period is used as the rat's working memory score.

Western blotting analysis

The hippocampus was harvested at 2 h, 1 week and 4 weeks after sevoflurane exposure for the determination of AChE and ChAT expression. Hippocampus were removed immediately on ice and stored at ‐80℃. Then, the tissues were dissolved in RIPA buffer and PMSF and homogenised with ultrasonic wave. The mixture was centrifuged at 14,000 ×g at 4°C for 5 min. The supernatants were collected and the protein concentrations were quantified with a BCA assay kit. Boil the sample at 100°C for 7 min. Next divide it into new centrifuge tube and store at −80°C for later use. Then, tissues were dissociated and homogenized by RIPA buffer containing protease inhibitor cocktail. A volume of about 80 µg proteins was resolved in 15% sodium dodecyl sulfate (SDS)‐polyacrylamide gel with electrophoresis buffer at 80 V for 30 min, then 120 V for 70 min. The proteins bands were transferred to a polyvinylidenedifluoride (PVDF) membrane with 300 mA for 90 min. The membrane was incubated in 5% skim milk at room temperature for 2 h for blocking. Then incubate the membrane with the primary antibody of AChE (1:1000, Abcam, UK) and ChAT (1:1000, Abcam, UK) at 4°C overnight. The membrane was rinsed with 1 × TBS containing 0.2% Tween‐20 (TBST) for three times. Then, the membrane was incubated with 1:2,500 secondary antibody. Finally, the membrane was rinsed in TBST for three times. The immune complexes were developed with enhanced chemiluminescence reagent and visualized with a gel imaging system.

Quantitative real‐time polymerase chain reaction (qRT‐PCR)

Total RNA was isolated from fresh or temporarily frozen samples by Trizol method after harvesting the hippocampus. The conditions for PCR amplification were as follows: initial denaturation at 95°C for 30 s, denaturation at 95°C for 5 s, amplification at 60°C for 30 s and extension at 60°C, which lasted for a total of 40 cycles. The critical threshold (Ct) of each specimen was collected. All data were normalized to β‐actin values by the 2−M M Ct method. The primers of AChE and ChAT were shown in Table  1 .

Table 1.

Nucleotide sequences for real‐time RT‐PCR primers

Genes Forward (5’→3’) Reverse (5’→3’)
AChE ACTGAACTACACCGTGGAGGAGAG TTCAGGTTCAGGCTCACGTATTGC
ChAT TCTGCCTGGTATGCCTGGATGG CCAGCGATTGGCTCCGTTCAG
Open in a new tab

Data analysis

The experimental data was analyzed by SPSS software 19.0 and expressed as mean ± standard deviation (SD). Hypothesis testing methods included one‐way or two‐way ANOVA. Statistical significance was set to a minimum of p < 0.05.

Results

During the experiment, the growth of rats in each group were stable. Under the sevoflurane anesthesia, the lips and limbs of the rats were rosy. Their breathing was smooth. They recovered well after anesthesia.

Sevoflurane impairs neurological dysfunction in memory and learning

To determine the long‐term effects of sevoflurane exposure on cognition and brain pathology, we selected rats which shared 95% gene homology with human for experiment. The spatial learning and memory ability of rats were compared by Morris water maze. The orientation navigation experiment showed that the behavioral ability of the rats in each group was at the same baseline level. The rats gradually learned to locate the hidden platform with an increasing level of efficiency over 5 training days (Figure  3A , Figure  4 ). Space exploration suggested that sevoflurane exposure significantly prolonged the crossing times of target quadrant of rats compared with the control group in 2 hours and 1 week (p < 0.05) (Figure  3B ). Moreover, sevoflurane significantly decreased the times of platforms that were crossed by the aged rat models in 2 h (p < 0.05) (Figure  3C ). In the working memory test, rats of the sevoflurane group had a weakened recent learning and memory ability in 2 hours and 1 week (p < 0.05) (Table  2 ). Nevertheless, there was no statistically significant difference in each group after 4 weeks. Together, these results indicated that rats with a prior history of sevoflurane exposure had exacerbated cognition decline. Differences were considered statistically significant when p < 0.05.

Figure 3.

Figure 3

Open in a new tab

Impaired spatial learning and memory ability of sevoflurane‐exposure rats. A: the escape latency of three groups of rats. B: the crossing times of target quadrant of rats. C: the times of platforms crossed by the aged rat models. *p values ≤ 0.05. h: hours. w:week/weeks.

Figure 4.

Figure 4

Open in a new tab

Swimming paths of orientation navigation experiment. From the characteristic swimming paths of orientation navigation experiment, we found rats progressively learned to locate the platform over days.

Table 2.

The working memory of sevoflurane group

Group N Escape latency (s)
2 h 1 w 4 w
Control 6 7.43 ± 2.77 5.40 ± 3.51 7.63 ± 4.25
A/O 6 5.50 ± 3.17 9.18 ± 7.24 8.20 ± 2.83
Sev 6 18.42 ± 13.00 * 23.52 ± 3.60 * 12.92 ± 6.25
Open in a new tab

Note: Sev group showed a weakened recent learning and memory ability compared with control group and A/O group. *p values ≤ 0.05.

Sevoflurane regulates AChE and ChAT

The expression of AChE and ChAT was confirmed by Western blot. The result indicated that the expression of them had changed in the sevoflurane group in 2 h. The level of AChE increased while ChAT had an opposite effect (p < 0.05) (Figure  5A, B ). However, this kind of change did not happen after 1 week and 4 weeks. Meanwhile, the genetic expression of AChE and ChAT enhanced after 1 week and 4 weeks (p < 0.05) (Figure  5C, D ). Based on the behavioral test, we found that sevoflurane exposure deduced cognitive function by increasing the expression of AChE at short notice while its subsequent regulation of genes had an improvement for cognitive function. Differences were considered statistically significant when p < 0.05.

Figure 5.

Figure 5

Open in a new tab

Sevoflurane and oxygen regulated the expression of AChE and ChAT. A, B: the protein levels of AChE and ChAT in the hippocampus of aged rat model. C, D: the relative expression of AChE and ChAT of three groups. *p values ≤ 0.05.

Hyperoxia boosts the expression of ChAT

In this study, we discovered an interesting phenomenon by accident. There was an increase in content of ChAT in the control group compared with the other two groups after procession in 2 h (p < 0.05). Meanwhile, the air oxygen group had more expression of ChAT than that of the sevoflurane group (p < 0.05) (Figure  5B ). Nevertheless, the relative transcript level of ChAT mRNA had a different change at this point. The level of ChAT mRNA in the oxygen group was continued higher than that of the control group (p < 0.05) (Figure  5D ). However, gene expression of ChAT in the sevoflurane group had two different effects. There was a lower expression level of ChAT in the sevoflurane group after procession in 2 h (p < 0.05) while it was higher in 4 weeks compared with the control group (p < 0.05) (Figure  5D ). Differences were considered statistically significant when p < 0.05.

Discussion

In this study, we successfully established cognition impaired model by sevoflurane inhalation. The result showed that the expression of AChE significantly up‐regulated after sevoflurane exposure. Over‐expression of AChE could improve cognitive function. The result suggests that AChE may be an effective target for PND treatment.

In the past few years, PND has become one of the most major health problems that the elderly face in perioperative period (Luo, et al., 2019). It refers to the impairment of memory, thinking and orientation. Some patients even have changes in social ability, cognitive ability and personality (Nakao, et al., 2019). Hence, it is urgent to clarify the correlation between anesthetic exposure and the cognitive impairment. Based on the research available, the exact pathogenesis of PND is not simple. What’s more, it is affected by multiple factors. It has already been proved to be related with astrocytic gliosis and amyloid beta deposition (Dong, et al., 2009). In recent years, Many scientists think that central cholinergic function has a close affinity with cognition. At the same time, the injury of the central cholinergic system can even be used as a marker of cognitive impairment and a breakthrough point for treatment (Jabir, et al., 2018; Kant Misra, et al., 2019). A bulk of the research shows that immune cells have an independent cholinergic system that contains ChAT and AChE (Kawashima, et al., 2004; Kawashima, et al., 2003) . As the main immune cells in the central nervous system, microglia can modulate learning ability and cognitive function which widely expressed in the hippocampus (Bisht, et al., 2018; Rajendran, et al., 2018). It has been widely regarded as a truism that the hippocampus is an important brain structure involved in learning and memory (Royo, et al., 2006). Meanwhile, its function can weaken with age (Albert, et al., 1987). Studies have found that anesthetics exposure can damage the cognitive function of aging rats by acting on the hippocampus (Cao, et al., 2019; Yang, et al., 2019). Therefore, the hippocampus of an old patient is more vulnerable under external stimulus. However, it is not clear about the correlation between the cholinergic in the hippocampus and PND.

In this study, we established aging rat model. On this basis, the changes that happened in cognitive and behavioral abilities were tested after rats were exposed to anesthetics. Sevoflurane, the most commonly used volatile anesthetic, was selected in our experiment. Meanwhile, the Morris water maze (MWM) was used to assess whether cognitive and behavioral abilities were impaired. MWM test is a classic behavioral test that could judge the changes of learning and memory ability of experimental animals after physical or drug intervention (Diniz, et al., 2014). Moreover, hippocampus were harvested to detect levels of AChE and ChAT by western blot and quantitative PCR. In this way, our study provided a new sight into understanding the mechanism of AChE and ChAT in PND induced by sevoflurane inhalation.

In our study, we found that the variation of AChE and ChAT expression was associated with behavioral changes. The cognitive decline occurred quickly after treatment which were in accord with the levels of AChE and ChAT regulation. It might be connected with the synthesis and decomposition of Ach. Furthermore, gene expression of AChE and ChAT were increasingly involved with the passage of time along with improvements in cognitive function. This study outlines the mechanism behind cognition changes with the central cholinergic system, which can be explained by the content of Ach associated with the regulation of AChE and ChAT by the engine body after sevoflurane exposure.

We also noticed that oxygen concentration is associated with the expression of ChAT. Hyperoxia could increase gene expression of AChE and ChAT but this effect diminishes over time. A previous study demonstrated that high oxygen tension is a vasoconstrictor stimulus for the vasculatures which connected with inactivation of endothelium‐derived relaxing factors such as nitric oxide (NO) while Ach could induce the release of NO to relax blood vessels (McNulty, et al., 2005). Moreover, it’s indicated that hyperoxia could significantly attenuate the endothelium‐dependent vasodilatation elicited by Ach. Above studies suggests that oxygen level have an effect on Ach. From here, we make a conjecture on the basis of our laboratory finding that oxygen uptake could alleviate the change in cognitive function caused by Ach. Whereas, this conjecture still needs further experimental verification.

Conclusion

In conclusion, we have identified that AChE and ChAT is important in hippocampus of aging rats, in which overexpression of AChE and ChAT could decrease the content of Ach and improve cognitive function significantly. The crucial founding may contribute to an indication about how Ach‐related drugs were applied in future clinic trials. In this study, we also noticed that oxygen enhanced the gene expression of AChE and ChAT, but it made no difference on behavior. However, some limitations still exist in the current study. First, the molecular mechanisms that contribute the regulatory role of AChE and ChAT is still not clear and need to be solved in further research. Moreover, due to practical constraints, our theory is not integrated with practice, we should apply our current findings in clinic.

Ethical statement

All operations and procedures were reviewed and approved by the Animal Ethics Committee of Zunyi Medical University (Approval No.[2019] 2‐044). All experiments conformed to the Guide for the care and Use of Laboratory Animals published by the US National Institutes off Health.

Conflict of interest

There is no conflict of interest in this study.

Funding

This study was supported by grant from the National Natural Science Foundation of China (Grant Number 81660193, Grant Number 81960214 and Grant Number 82160223).

Transparency statement

All the authors affirm that this manuscript is an honest, accurate, and transparent account of the study being reported; that no important aspects of the study have been omitted; and that any discrepancies from the study as planned (and, if relevant, registered) have been explained.

Authors' contribution

Xin‐Xin Yang and Zhao‐Qiong Zhu contributed the central idea, analysed most of the data, and wrote the initial draft of the paper. Zhen‐Yu Wu, Yang Yang, Xia‐Fei Lin, Chao Zhang, Lin Zhou, Feng‐Lin Wang and Liang Dong contributed to refining the ideas, carrying out additional analyses and finalizing this paper.

References

  1. Albert M, Duffy F. Naeser MJCjop. Nonlinear changes in cognition with age and their neuropsychologic correlates. Canadian journal of psychology 1987; 41 (2): 141–157. [PubMed] [Google Scholar]
  2. Azimaraghi O, Sistani Nezhad M, Abdollahifar MA, Movafegh A, Maleki A, Soltani E, Shahbazkhani A, Atef‐Yekta R. Effects of repeated exposure to different concentrations of sevoflurane on the neonatal mouse hippocampus. Brazilian journal of anesthesiology (Elsevier) 2019; 69 (1): 58–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ballinger EC, Ananth M, Talmage DA, Role LW. Basal Forebrain Cholinergic Circuits and Signaling in Cognition and Cognitive Decline. Neuron 2016; 91 (6): 1199–1218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bisht K, Sharma K. Tremblay MJNos. Chronic stress as a risk factor for Alzheimer's disease: Roles of microglia‐mediated synaptic remodeling, inflammation, and oxidative stress. Neurobiol Stress 2018; 9: 9–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao YY, Li ZQ, Ma LJ, Yang N, Guo XY. Isoflurane‐Induced Postoperative Neurovascular and Cognitive Dysfunction Is Associated with VEGF Overexpression in Aged Rats. Journal of molecular neuroscience 2019; 69 (2): 215–223. [DOI] [PubMed] [Google Scholar]
  6. Chauhan P, Misra U, Kalita J, Chandravanshi LP, Khanna VK. Memory and learning seems to be related to cholinergic dysfunction in the JE rat model. Physiology & behavior 2016; 156: 148–155. [DOI] [PubMed] [Google Scholar]
  7. Chung W, Park S, Hong J, Chandravanshi LP, Khanna VK. Sevoflurane exposure during the neonatal period induces long‐term memory impairment but not autism‐like behaviors. Paediatr Anaesth 2015; 25 (10): 1033–1045. [DOI] [PubMed] [Google Scholar]
  8. Diniz B, Teixeira A, Machado‐Vieira R, Talib LL, Radanovic Marcia M, Gattaz WF, Forlenza OV. Reduced cerebrospinal fluid levels of brain‐derived neurotrophic factor is associated with cognitive impairment in late‐life major depression. The journals of gerontology. Series B, Psychological and social sciences 2014; 69 (6): 845–851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dong Y, Zhang G, Zhang B, Moir RD, Xia W, Marcantonio ER, Culley DJ, Crosby G, Tanzi RE, Xie Z. The common inhalational anesthetic sevoflurane induces apoptosis and increases beta‐amyloid protein levels. Arch Neurol 2009; 66 (5): 620–631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Eckenhoff RG, Maze M, Xie Z, Culley DJ, Goodlin SJ, Zuo Z, Wei H, Whittington RA, Terrando N, Orser BA, Eckenhoff MF. Perioperative Neurocognitive Disorder: State of the Preclinical Science. Anesthesiology 2020; 132 (1): 55–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hadzi‐Petrushev N, Stojkovski V, Mitrov D, Mladenov M. D‐galactose induced changes in enzymatic antioxidant status in rats of different ages. Physiological research 2015; 64 (1): 61–70. [DOI] [PubMed] [Google Scholar]
  12. Hut RA, Van der Zee EA. The cholinergic system, circadian rhythmicity, and time memory. Behavioural brain research 2011; 221 (2): 466–480. [DOI] [PubMed] [Google Scholar]
  13. Jabir NR, Khan FR, Tabrez S. Cholinesterase targeting by polyphenols: A therapeutic approach for the treatment of Alzheimer's disease. CNS neuroscience & therapeutics 2018; 24 (9): 753–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kant Misra U, Kalita J, Singh Chauhan P. Evaluation of cholinergic functions in patients with Japanese encephalitis and Herpes simplex encephalitis. Brain search 2019; 1707: 227–232. [DOI] [PubMed] [Google Scholar]
  15. Kawashima K, Fujii T. Expression of non‐neuronal acetylcholine in lymphocytes and its contribution to the regulation of immune function. Frontiers in bioscience 2004; 9: 2063–2085. [DOI] [PubMed] [Google Scholar]
  16. Kawashima K. Fujii T. The lymphocytic cholinergic system and its contribution to the regulation of immune activity. Life Sciences 2003; 74 (6): 675–696. [DOI] [PubMed] [Google Scholar]
  17. Lin X, Chen Y, Zhang P, Chen G, Zhou Y, Yu X. The potential mechanism of postoperative cognitive dysfunction in older people. Experimental gerontology 2020; 130: 1 10791. [DOI] [PubMed] [Google Scholar]
  18. Luo A, Yan J, Tang X, Zhao Y, Zhou B, Li S. Postoperative cognitive dysfunction in the aged: the collision of neuroinflammaging with perioperative neuroinflammation. Inflammopharmacology 2019; 27 (1): 27–37. [DOI] [PubMed] [Google Scholar]
  19. McNulty PH, King N, Scott S, Hartman G, McCann J, Kozak M, Chambers CE, Demers LM, Sinoway LI. Effects of supplemental oxygen administration on coronary blood flow in patients undergoing cardiac catheterization. American journal of physiology Heart and circulatory physiology 2005; 288 (3): H1057–1062. [DOI] [PubMed] [Google Scholar]
  20. Muramatsu I, Masuoka T, Uwada J, Yoshiki H, Yazama T, Lee KS, Sada K, Nishio M, Ishibashi T, Taniguchi T. A New Aspect of Cholinergic Transmission in the Central Nervous System. Nicotinic Acetylcholine Receptor Signaling in Neuroprotection 2018; 45–58.
  21. Nakao S, Yamamoto T, Kimura S, Mino T, Iwamoto T. Brain white matter lesions and postoperative cognitive dysfunction: a review. Journal of Anesthesia 2019; 33 (2): 336–340. [DOI] [PubMed] [Google Scholar]
  22. Rajendran L, Paolicelli RC. Microglia‐Mediated Synapse Loss in Alzheimer's Disease. J Neurosci 2018; 38 (12): 2911–2919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Royo NC, Conte V, Saatman KE, Shimizu S, Belfield CM, Soltesz KM, Davis JE, Fujimoto ST, McIntosh TK. Hippocampal vulnerability following traumatic brain injury: a potential role for neurotrophin‐4/5 in pyramidal cell neuroprotection. The European journal of nuroscience 2006; 23 (5): 1089–1102. [DOI] [PubMed] [Google Scholar]
  24. Shichino T, Murakawa M, Adachi T, Arai T, Miyazaki Y, Mori K. Effects of inhalation anaesthetics on the release of acetylcholine in the rat cerebral cortex in vivo . British journal of anaesthesia 1998; 80 (3): 365–370. [DOI] [PubMed] [Google Scholar]
  25. Veeramuthu V, Narayanan V, Kuo TL, Delano‐Wood L, Chinna K, Bondi MW, Waran V, Ganesan D, Ramli N. Diffusion Tensor Imaging Parameters in Mild Traumatic Brain Injury and Its Correlation with Early Neuropsychological Impairment: A Longitudinal Study. Journal of neurotrauma 2015; 32 (19): 1497–1509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Yang F, Shan Y, Tang Z, Wu X, Bi C, Zhang Y, Gao Y, Liu H. The Neuroprotective Effect of Hemin and the Related Mechanism in Sevoflurane Exposed Neonatal Rats. Frontiers in neuronscience 2019; 13: 537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zhao S, Chen F, Wang D, Han W, Zhang Y, Yin Q. NLRP3 inflammasomes are involved in the progression of postoperative cognitive dysfunction: from mechanism to treatment. Neurosurgical review 2020. [DOI] [PubMed]

Articles from Ibrain are provided here courtesy of Affiliated Hospital of Zunyi Medical University (AHZMU) and Wiley-VCH GmbH

RESOURCES