Skip to main content
Iranian Journal of Medical Sciences logoLink to Iranian Journal of Medical Sciences
. 2023 Sep;48(5):501–509. doi: 10.30476/IJMS.2023.88390.2811

Protective Effect of Docetaxel Against Autophagy-Related Genes in Vitrification of Mouse Metaphase II Oocytes

Hamed Daneshpazhouh 1, Nasim Hayati Roodbari 1, Yaser Tahamtani 2, Zahra Khodabandeh 3, Mehdi Dianatpour 1,3
PMCID: PMC10541544  PMID: 37786462

Abstract

Background:

Autophagy is a conservative mechanism for cell survival as the main response of cells to stress conditions. The present study aimed to assess the effect of docetaxel on the survival, fertilization, and expression of autophagy-related genes in vitrified oocytes.

Methods:

The study was conducted in 2018 at the Stem Cells Technology Research Center, Shiraz University of Medical Sciences (Shiraz, Iran). Denuded oocytes were randomly selected and assigned to five groups, namely control (n=133), docetaxel (n=136), docetaxel+cryoprotectants (n=146), docetaxel+vitrification (n=138), and vitrification (n=145). The effect of vitrification on the expression of autophagy-related gene 5 (ATG5) and Beclin-1 was determined using a real-time polymerase chain reaction. Data were analyzed using SPSS software (version 26.0) and GraphPad Prism 9.

Results:

Survival and fertilization rates in each experimental group were significantly reduced compared to the control group (P=0.001). After in vitro fertilization of oocytes, the 2-cell formation rate was significantly reduced in the docetaxel+vitrification and vitrification groups compared to the control and docetaxel groups (P=0.001 and P=0.001, respectively). Pre-incubation of oocytes with docetaxel reduced gene expression levels of Beclin-1 and ATG5 in the docetaxel+cryoprotectants and docetaxel+vitrification groups (P=0.001 and P=0.019, respectively). The expression level of these genes was also reduced in the docetaxel group compared to the control group (P=0.001).

Conclusion:

Incubation of mouse metaphase II oocytes with docetaxel prior to vitrification reduced the expression of autophagy-related genes and increased survival and fertilization rates compared to untreated oocytes.

Keywords: Oocytes, Vitrification, Docetaxel, Autophagy, Beclin-1, Atg5


What’s Known

  • Vitrification is a fast-freezing technique to preserve human oocytes. High concentrations of cryoprotectants are used to prevent ice crystal formation. Vitrification quality depends on cryoprotectant concentration and cell exposure time.

  • To date, there are limited studies on the effect of vitrification on oocyte maturation and transcriptional regulation of autophagy.

What’s New

  • Incubation of mouse metaphase II oocytes with docetaxel before vitrification reduced the expression of autophagy-related genes.

  • Pre-incubation with docetaxel significantly improved the viability and developmental competence of oocytes.

Introduction

Autophagy is a highly conserved cellular recycling process, which plays an important role in maintaining cellular homeostasis by recycling long-lived proteins and damaged organelles. 1 , 2 This process involves the removal of subcellular structures, such as redundant peroxisomes and damaged mitochondria and endoplasmic reticulum. 3 Conserved energy through the autophagy of intracellular protein and organelles allows the body to adapt to different conditions. Some studies showed the association of autophagy with physiological and pathological processes of the body, such as cell growth, differentiation, and development; immune responses, cancer, neurodegeneration, and metabolic diseases. 4 , 5 It is also reported that autophagy plays a role in aging, illnesses, antigen presentation, and bacterial infections. 6 Moreover, it affects fertilization by degrading cytoplasmic components in the lysosome. A previous study on mouse embryos reported that after fertilization, degradation of maternal proteins in oocytes occurred and new proteins were synthesized by the zygotic genome. Breakdown of autophagy-related gene 5 (Atg5), as maternal protein, is compromised in the Atg5-null sperm and affects the normal translational regulation and possibly the transcription regulation. 7 In addition to Atg5, there are several other autophagy-related genes, such as Atg6/Beclin-1, Atg8/LC3, GABARAP, Atg4A, and Atg4B. These genes are involved in the molecular mechanism of autophagy and have been studied in various cells. 8

Atg5 and Beclin1, the mammalian orthologue of yeast Atg6, are critical factors in autolysosome formation that induces autophagy. 9 In the absence of Atg5 and Atg7, essential for the formation of autophagosomes, oocytes are normally fertilized in vivo. 10 Tsukamoto and colleagues showed that when autophagy-deficient oocytes (derived from Atg5 knockout mice) are fertilized with Atg5-null sperm, they only develop up to the 4- and 8-cell stages. However, they can fully develop if fertilized by wild-type sperm. 7 Beclin-1, a homolog of Atg6, is a coiled-coil protein in mammals that mediates autophagy. 11 A recent study has shown that Beclin-1 is associated with class III phosphatidylinositol 3-kinase and generates phosphatidylinositol 3-phosphate, resulting in the initiation of autophagy. 12 It can also normalize chromosome congression and kinetochore assembly during mitosis. 13

Vitrification is a fast-freezing technique that has become the most effective method to preserve human oocytes and embryos. Using highly concentrated cryoprotectants (CPAs), rapid freezing prevents the formation of ice crystals. 14 However, vitrification may disturb oocytes due to factors such as toxicity from high concentrations of CPAs, cold shock, and osmotic stress. Moreover, it may disturb organelles, hardens the zona pellucida, and affects gene expression. It was proposed that stabilization of cytoskeleton fiber during vitrification with stabilizers such as docetaxel could improve the cryotolerance of oocytes. 15 Docetaxel prevents depolymerization of microtubules by stabilizing their structure through binding with the β-subunit of tubulin of the microtubules, i.e., the vitrification-warming process improves the viability of oocytes. 16 The quality of vitrified-warmed oocytes was evaluated in terms of embryonic growth rate after fertilization, the condition of the meiotic spindle, DNA damage, generation of reactive oxygen species, and ultrastructural changes in oocytes. 17 Given the importance of autophagy in the viability and developmental competence of oocytes, the present study aimed to assess the impact of docetaxel on the survival, fertilization, and expression of Atg5 and Beclin-1 genes in vitrified oocytes.

Materials and Methods

The present experimental study was conducted in 2018 at the Stem Cells Technology Research Center, Shiraz University of Medical Sciences (Shiraz, Iran). The study and the animal care protocol for research were approved by the Ethics Committee of Shiraz University of Medical Sciences, Shiraz, Iran (IR.SUMS.REC.1395.S855).

Animals

Female (8-10 weeks old) and male (10-12 weeks old) Naval Medical Research Institute (NMRI) mice were used in the study. They were purchased from Royan Institute (Karaj, Iran) and housed under controlled temperature (22±2 °C), humidity of 40-50%, and 12:12 hours light:dark cycle. The mice had access to standard rodent chow (Behparvar®, Tehran, Iran) and water ad libitum. 18

Oocyte Retrieval

To obtain the highest possible number of oocytes for vitrification, female mice were superovulated by intraperitoneal injection of 10 IU pregnant mare serum gonadotropin (PMSG; Gonaser, HIPRA, Spain) and 48 hours later by intraperitoneal injection of 10 IU human chorionic gonadotropin (HCG; Organon, Oss, The Netherlands). Aspiration of oocyte cumulus complexes from the antral follicle was done 12 to 15 hours after HCG administration. Incubation was performed for 30 to 60 seconds in a basal medium (G-MOPSTM, Vitrolife, Sweden) supplemented with 300 μg/mL hyaluronidase (code: 4272, Sigma, UK). Identification of matured metaphase II (MII) oocytes was performed using a light microscope (Olympus, Tokyo, Japan) and determined by the presence of the first polar body and the size of perivitelline space. Except for the control and vitrified oocytes, other oocytes were pre-incubated with docetaxel (Sigma Aldrich, Gillingham, Dorset, UK) at a concentration of 0.05 µM for 20 min. 19 , 20

Experimental Design

Mature oocytes were randomly assigned to five groups, namely (i) control group (n=133): untreated oocytes as fresh controls, (ii) docetaxel group (n=136): oocytes pre-incubated with docetaxel for 20 min, (iii) docetaxel+CPA group (n=146): oocytes pre-incubated with docetaxel for 20 min and exposed to CPAs without vitrification, (iv) docetaxel+vitrification group (n=138): oocytes pre-incubated with docetaxel for 20 min and vitrified, and (v) vitrification group (n=145): vitrified oocytes. Vitrification of oocytes was performed using a cryotop® container (KITAZATO Co., Tokyo, Japan).

Vitrification and Warming Solution

The vitrification solution was supplemented with 15% ethylene glycol together with 15% glycerol and 0.5 M sucrose (all from Sigma, USA) as basal medium. The equilibration solutions contained half of the CPAs of the vitrification solution without sucrose. Warming solutions (WS1, WS2, and WS3) were prepared by adding low concentrations of sucrose (1, 0.5, and 0.25 M, respectively) to the basal medium.

Vitrification and Warming

Vitrification: The denuded MII oocytes in batches of 15 were vitrified in a cryotop container according to protocols described in a previous study. 20 In brief, the oocytes in the basal medium were gradually exposed to the equilibration solution for 3 min and then incubated in the vitrification solution for 1 min. Each batch was loaded onto the cryotop container, and the excess solution was removed. The container with the oocytes was sealed, immersed in liquid nitrogen, and stored.

Warming: The cryotop containing oocytes was exposed to the warming solution in three steps, namely in WS1 for 1 min, WS2 for 3 min, and WS3 for 5 min. It was then transferred to a washing solution for 5 min and collected for further analysis (figure 1).

Figure 1.

Figure 1

The vitrification-warming procedure is illustrated.

The complete vitrification process was performed at room temperature (25 ˚C) in accordance with the protocol described in previous studies. 14 , 21

In Vitro Fertilization

The fresh and vitrified-warmed oocytes were transferred to a pre-warmed G-IVF medium (Vitrolife, Sweden) covered with mineral oil (CAS: 8410; Sigma, USA). The cauda epididymis of adult male mice was excised, and several incisions were made to extract the sperms. The sperms were capacitated by incubation in a pre-warmed G-IVF medium drop in 5% CO2 at 37 °C for 45 min. The final concentration of 2×106 spermatozoa/mL was added to each G-IVF medium containing 15 oocytes and incubated in 5% CO2 at 37 °C for 5 hours. The pronuclei in each group were inspected after 24 hours under an inverted microscope (Nikon, Japan), and the formation of at least two pronuclei was considered as the fertilization rate.

RNA Extraction and Real-time Polymerase Chain Reaction (PCR)

Total cellular RNA was extracted from the vitrified and non-vitrified oocytes using an RNA extraction kit (CinnaGen Co., Tehran, Iran). The quantity and quality of RNAs were assessed using a NanoDropTM spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) with 260/280 nm optical density ratio and 1% agarose gel. The cDNA was synthesized with 1000 ng of the total RNA using RevertAidTM first strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. Quantitative real-time PCR (qPCR) was performed using Applied Biosystems StepOneTM and RealQ Plus 2x Master Mix Green (Ampliqon A/S, Odense, Denmark). Based on the mouse DNA sequences found in GenBank and BLAST query, 22 the sequence of primers was determined (table 1). β-actin was used as an internal control (housekeeping gene). Amplification signals of various samples were normalized with β-actin to determine the cycle threshold (Ct). The fold-change was determined using the 2-ΔΔCT method by comparing the activated versus controlled levels of mRNA. 23 All experiments were performed in triplicate.

Table 1.

Primer sequences used for the real-time polymerase chain reaction

Gene Sequence Size (bp)
M-Atg5 Forward: AACTGAAAGAGAAGCAGAACCA 105
Reverse: TGTCTCATAACCTTCTGAAAGTGC
M-Beclin-1 Forward: AATCTAAGGAGTTGCCGTTATAC 187
Reverse: CCAGTGTCTTCAATCTTGCC
M-β-actin Forward: AGTGTGACGTTGACATCCGT 120
Reverse: TGCTAGGAGCCAGAGCAGTA

M: Mouse; bp: Base pair

Statistical Analysis

Data were analyzed using SPSS software (version 26.0) with one-way analysis of variance (ANOVA). Tukey’s test was used to determine the difference between the mean value of the survival and fertilization of MII oocytes. Gene expression levels were analyzed using GraphPad Prism 9 software (GraphPad Software Inc. La Jolla, California, USA). The normality and homogeneity of the data were examined prior to data analysis. P<0.05 was considered statistically significant.

Results

Assessment of Oocytes Viability and Fertilization

The viability of the oocytes was assessed by comparing the morphology of each of the treatment groups with the control group (figure 2).

Figure 2.

Figure 2

The morphology of vitrified metaphase II oocytes is shown after warming. (A) Control, (B) Vitrification, and (C) Docetaxel+vitrification.

The viability of oocytes in all groups was compared to controls (tables 2 and 3). The survival rate of oocytes was significantly reduced in both the docetaxel+vitrification and vitrification groups compared to controls (P<0.001). However, there was no statistically significant reduction in the survival rate of oocytes in the docetaxel+CPA and docetaxel+vitrification groups compared to the docetaxel group (P=0.610 and P=0.190, respectively). The results showed a significant reduction in the fertilization rate in all treatment groups compared to controls. We found significant variations in the fertilization rate observed in the docetaxel group compared to the docetaxel+vitrification and vitrification groups (P<0.001). The two-cell formation rate after IVF was significantly lower in the docetaxel+CPA, docetaxel+vitrification, and vitrification groups than the controls (P<0.001).

Table 2.

The survival and fertilization rate of the MII oocytes in the studied groups

Variables Control Docetaxel Docetaxel+cryoprotectant Docetaxel+vitrification Vitrification P value*
Survival of oocytes after vitrification 130/133 (97.79±0.73) 124/136 (91.15±1.23) 130/146 (88.99±1/27) 121/138 (87.68±0.43) 120/145 (82.75±1.33) <0.001
Fertilization of oocytes (2-cell formation) 84/94 (89.47±2.003) 73/98(83.86±1.55) 97/121 (80.22±0.83) 65/98 (66.26±1.45) 61/98 (62.26±2.15) <0.001

Data are presented as the total number of three replicates in each group and expressed as mean±SEM (standard error of the mean). Two-cell formation was observed 24 hours after in vitro fertilization.

*

One-way analysis of variance (statistical significance: P<0.001).

Table 3.

The results of pairwise comparison using Tukey’s test

Variables Survival of oocytes after vitrification Fertilization of oocytes (two-cell formation)
Mean±SEM P value Mean±SEM P value
Group I vs. Group II 6.64±1.5 0.004* 5.61±2.35 0.17
Group I vs. Group III 8.8±1.5 <0.001** 9.24±2.35 0.01*
Group I vs. Group IV 10.11±1.5 <0.001** 23.21±2.35 <0.001**
Group I vs. Group V 15.04±1.5 <0.001** 27.21±2.35 <0.001**
Group II vs. Group III 2.15±1.5 0.61 3.63±2.35 0.55
Group II vs. Group IV 3.46±1.5 0.19 17.59±2.35 <0.001**
Group II vs. Group V 8.4±1.5 <0.001** 21.59±2.35 <0.001**
Group III vs. Group IV 1.3±1.5 0.9 13.96±2.35 <0.001**
Group III vs. Group V 6.24±1.5 0.006* 17.96±2.35 <0.001**
Group IV vs. Group V 4.93±1.5 0.03* 3.99±2.35 0.46
*

Significance at P=0.05;

**

Significance at P=0.001; Group I: Fresh control; Group II: Docetaxel; Group III: Docetaxel+CPA; Group IV: Docetaxel+vitrification; Group V: Vitrified oocytes

Autophagy-related Gene Expression

The expression of Beclin-1 and Atg5 mRNA was examined in the vitrified-warmed and non-vitrified groups compared to controls. Beclin-1 gene expression level was significantly higher in the docetaxel+vitrification (P=0.003) and vitrification (P=0.001) groups than the controls. The results showed that pre-incubation of oocytes with docetaxel decreased Beclin-1 gene expression levels in the docetaxel+CPA group compared to the docetaxel+vitrification group (P=0.004). As shown in figure 3, there was a significant decrease in Beclin-1 gene expression level in the docetaxel group compared to controls (P=0.008). Atg5 gene expression levels were also significantly higher in the vitrified groups (docetaxel+vitrification [P=0.005] and vitrification [P=0.001]) than the non-vitrified groups. The results showed that pre-incubation of oocytes with docetaxel decreased Atg5 gene expression levels in the docetaxel+CPA group compared to the docetaxel+vitrification group (P=0.459). Besides, there was a significant decrease in Atg5 gene expression levels in the docetaxel group compared to controls (P=0.001).

Figure 3.

Figure 3

The expression levels of Beclin-1 (A) and Atg5 (B) genes are shown in vitrified and non-vitrified MII oocyte groups. *Significant difference with the docetaxel+CPA (P=0.047), docetaxel+vitrification (P=0.003), and vitrification (P<0.001) groups. **Significant difference with the control (P=0.008), docetaxel+CPA (P<0.001), docetaxel+vitrification (P<0.001) and vitrification (P<0.001) groups. ***Significant difference with the docetaxel+CPA (P=0.007), docetaxel+vitrification (P=0.005), and vitrification (P<0.001) groups. ****Significant difference with the control (P=0.018), docetaxel+CPA (P=0.002) and docetaxel+vitrification (P=0.001) groups.

Discussion

The vitrified-warmed mouse oocytes exhibited autophagic activation, whereas docetaxel had a protective effect on the survival and fertilization of autophagy-related genes of the vitrified oocytes. Docetaxel also reduced Atg5 and Beclin-1 gene expression levels in vitrified compared to non-vitrified oocytes. The results showed that incubation of oocytes with docetaxel before vitrification inhibited the spindle abnormalities and chromosomal distribution during vitrification and led to the downregulation of autophagic activities. We found that without pre-treatment with docetaxel, the expression level of autophagy-related genes (Atg5, Beclin-1) was increased, leading to cell damage and subsequently induced autophagy. In line with our results, Bang and colleagues reported that the expression of Atg5 and Beclin-1 increased in vitrified-warmed oocytes in response to the warm and cold stresses during vitrification. 24 Another study concluded that immature oocyte cryopreservation exhibited autophagic activation, with negative effects on viability, cleavage, and blastocyst formation rates. 2 Our findings showed that survival and fertilization rates in vitrified-warmed oocytes pre-incubated with docetaxel were higher than the untreated oocytes. Therefore, it is suggested that the viability of normal cytoskeleton fiber, cortical granule, and mitochondria after the vitrification-warming process might be due to cell metabolism, proliferation, and differentiation. In natural fertilization, there is a homogenous cortical distribution in MII oocytes. 25 , 26 Docetaxel, as a microtubule inhibitor, stabilizes the cytoskeleton fiber by preventing the disassembly of tubulin during vitrification. 25 Docetaxel positively affects the rate and extent of tubulin binding, promoting microtubule stability. After vitrification and warming, recovery of the oocyte meiotic spindle was promoted and embryo development was enhanced. Thus, the vitrified-warmed oocyte had similar cleavage timing, cell number, and DNA methylation patterns as the fresh oocytes. 25 , 27 Chasombat and colleagues showed that 0.05 μM docetaxel had no toxic effect on oocyte survival and fertilization. They also showed that incubation of bovine oocytes with 0.05 μM docetaxel before vitrification resulted in oocytes with normal metaphase plate configuration as well as higher survival rate, division rate, and blastocyst formation after fertilization. 19

Autophagy is induced as the main response of cells to stress conditions such as starvation, temperature changes, or hypoxia. It is hypothesized that autophagy is induced in response to stress conditions during oocyte meiosis. 28 Lee and colleagues found that Atg5 and Atg6 were highly expressed at the 1-cell stage, and then decreased through the morula and blastocyst stages in a steady manner. 29 Cells exposed to freezing conditions are damaged due to cold shock and osmotic stress. A previous study reported that autophagy played a role in stallion sperm death during storage in a fridge. 30 Although CPAs may induce osmotic damage and result in toxicity, they also play a fundamental role in minimizing cell dehydration and preventing the formation of ice crystals. 31 , 32 Other studies suggested that autophagy is induced in oocytes during the vitrification-warming process to recycle damaged organelles. However, inhibition of autophagy may lead to apoptosis, since there is a correlation between autophagy and apoptosis. 2 , 33 Similarly, in our previous study, 21 we showed that the expression of B-cell lymphoma-extra large (Bcl-xl) significantly increased in vitrified mature oocytes compared to controls. This indicates the initiation of a defense mechanism by vitrified-warmed oocytes to prevent apoptosis. Among all Atg genes, Atg5 plays a significant role in autophagy activation through Atg12-Atg5 conjugate and LC3 lipidation. Some studies indicated that autophagy in mammalian cells is caused by the overexpression of Atg genes. 34 , 35 In line with our results, Pyo and colleagues suggested that although overactivation of excessive autophagy might not always be beneficial, ectopic expression of Atg5 in mice regulates autophagic flux. 36

The main limitations of the study were budget and time constraints. In addition, we only focused on oocytes. The developmental competence of blastocyst-stage embryos was not evaluated due to the lack of access to media with cultures of cells from the zygote stage to the blastocyst stage.

Conclusion

Mouse MII oocytes incubated with docetaxel prior to the vitrification-warming process had higher survival and fertilization rates than the untreated oocytes. The pre-incubation also reduced the activity of autophagy-related genes. These findings may have significance in assisted reproductive technology in terms of oocyte developmental competence after vitrification.

Acknowledgment

The present manuscript was extracted from a thesis by H. Daneshpazhouh. The study was jointly funded by the Stem Cells Technology Research Center, Shiraz University of Medical Sciences (Shiraz, Iran) and the Department of Biology, Faculty of Basic Sciences, Tehran Science and Research Branch, Islamic Azad University (Tehran, Iran).

Authors’ Contribution

H.D: Study design and data analysis. N.HR: Data collection and interpretation. Z.Kh, M.D: Data analysis. All authors have contributed to the drafting and revising of the manuscript. They have read and approved the final manuscript and are responsible for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Conflict of Interest:

None declared.

References

  • 1.Yang Z, Klionsky DJ. Eaten alive: a history of macroautophagy. Nat Cell Biol. 2010;12:814–22. doi: 10.1038/ncb0910-814. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gao HH, Li JT, Liu JJ, Yang QA, Zhang JM. Autophagy inhibition of immature oocytes during vitrification-warming and in vitro mature activates apoptosis via caspase-9 and -12 pathway. Eur J Obstet Gynecol Reprod Biol. 2017;217:89–93. doi: 10.1016/j.ejogrb.2017.08.029. [DOI] [PubMed] [Google Scholar]
  • 3.Bergamini E, Cavallini G, Donati A, Gori Z. The role of autophagy in aging: its essential part in the anti-aging mechanism of caloric restriction. Ann N Y Acad Sci. 2007;1114:69–78. doi: 10.1196/annals.1396.020. [DOI] [PubMed] [Google Scholar]
  • 4.Rabinowitz JD, White E. Autophagy and metabolism. Science. 2010;330:1344–8. doi: 10.1126/science.1193497. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lin FH, Zhang WL, Li H, Tian XD, Zhang J, Li X, et al. Role of autophagy in modulating post-maturation aging of mouse oocytes. Cell Death Dis. 2018;9:308. doi: 10.1038/s41419-018-0368-5. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Klionsky DJ. The autophagy connection. Dev Cell. 2010;19:11–2. doi: 10.1016/j.devcel.2010.07.005. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Tsukamoto S, Kuma A, Murakami M, Kishi C, Yamamoto A, Mizushima N. Autophagy is essential for preimplantation development of mouse embryos. Science. 2008;321:117–20. doi: 10.1126/science.1154822. [DOI] [PubMed] [Google Scholar]
  • 8.Mizushima N, Yamamoto A, Hatano M, Kobayashi Y, Kabeya Y, Suzuki K, et al. Dissection of autophagosome formation using Apg5-deficient mouse embryonic stem cells. J Cell Biol. 2001;152:657–68. doi: 10.1083/jcb.152.4.657. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Maiuri MC, Criollo A, Kroemer G. Crosstalk between apoptosis and autophagy within the Beclin 1 interactome. EMBO J. 2010;29:515–6. doi: 10.1038/emboj.2009.377. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Funderburk SF, Wang QJ, Yue Z. The Beclin 1-VPS34 complex--at the crossroads of autophagy and beyond. Trends Cell Biol. 2010;20:355–62. doi: 10.1016/j.tcb.2010.03.002. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rouschop KM, van den Beucken T, Dubois L, Niessen H, Bussink J, Savelkouls K, et al. The unfolded protein response protects human tumor cells during hypoxia through regulation of the autophagy genes MAP1LC3B and ATG5. J Clin Invest. 2010;120:127–41. doi: 10.1172/JCI40027. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jaber N, Dou Z, Chen JS, Catanzaro J, Jiang YP, Ballou LM, et al. Class III PI3K Vps34 plays an essential role in autophagy and in heart and liver function. Proc Natl Acad Sci U S A. 2012;109:2003–8. doi: 10.1073/pnas.1112848109. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fremont S, Gerard A, Galloux M, Janvier K, Karess RE, Berlioz-Torrent C. Beclin-1 is required for chromosome congression and proper outer kinetochore assembly. EMBO Rep. 2013;14:364–72. doi: 10.1038/embor.2013.23. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Khodabandeh Jahromi Z, Amidi F, Nori Mugehe S, Sobhani A, Mehrannia K, Abbasi M, et al. Expression of heat shock protein (HSP A1A) and MnSOD genes following vitrification of mouse MII oocytes with cryotop method. Cell Journal (Yakhteh). 2010;12:113–9. [Google Scholar]
  • 15.Jimenez-Trigos E, Naturil-Alfonso C, Vicente JS, Marco-Jimenez F. Post-warming competence of in vivo matured rabbit oocytes treated with cytoskeletal stabilization (Taxol) and cytoskeletal relaxant (Cytochalasin B) before vitrification. Reprod Domest Anim. 2013;48:15–9. doi: 10.1111/j.1439-0531.2012.02018.x. [DOI] [PubMed] [Google Scholar]
  • 16.Jimenez-Trigos E, Naturil-Alfonso C, Vicente JS, Marco-Jimenez F. Effects of cryopreservation on the meiotic spindle, cortical granule distribution and development of rabbit oocytes. Reprod Domest Anim. 2012;47:472–8. doi: 10.1111/j.1439-0531.2011.01906.x. [DOI] [PubMed] [Google Scholar]
  • 17.Tatone C, Di Emidio G, Barbaro R, Vento M, Ciriminna R, Artini PG. Effects of reproductive aging and postovulatory aging on the maintenance of biological competence after oocyte vitrification: insights from the mouse model. Theriogenology. 2011;76:864–73. doi: 10.1016/j.theriogenology.2011.04.017. [DOI] [PubMed] [Google Scholar]
  • 18.Council NJDTNAP. Guide for the Care and Use of Laboratory Animals. National Academies: Washington; 2011. [DOI] [Google Scholar]
  • 19.Chasombat J, Nagai T, Parnpai R, Vongpralub T. Pretreatment of in vitro matured bovine oocytes with docetaxel before vitrification: Effects on cytoskeleton integrity and developmental ability after warming. Cryobiology. 2015;71:216–23. doi: 10.1016/j.cryobiol.2015.07.002. [DOI] [PubMed] [Google Scholar]
  • 20.Amidi F, Khodabandeh Z, Nori Mogahi MH. Comparison of The Effects of Vitrification on Gene Expression of Mature Mouse Oocytes Using Cryotop and Open Pulled Straw. Int J Fertil Steril. 2018;12:61–7. doi: 10.22074/ijfs.2018.5112. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Khodabandeh Z, Jamhiri I, Dehghani N, Daneshpazhouh H, Namavar Jahromi B, Dianatpour M, et al. The effect of docetaxel on survival, fertilization rate and apoptosis-related genes mRNA expression in mouse metaphase II oocytes following vitrification. Iran J Vet Res. 2021;22:40–7. doi: 10.22099/ijvr.2020.38128.5554. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13:134. doi: 10.1186/1471-2105-13-134. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2^(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath. 2013;3:71–85. [ PMC Free Article ] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bang S, Shin H, Song H, Suh CS, Lim HJ. Autophagic activation in vitrified-warmed mouse oocytes. Reproduction. 2014;148:11–9. doi: 10.1530/REP-14-0036. [DOI] [PubMed] [Google Scholar]
  • 25.Xiao H, Verdier-Pinard P, Fernandez-Fuentes N, Burd B, Angeletti R, Fiser A, et al. Insights into the mechanism of microtubule stabilization by Taxol. Proc Natl Acad Sci U S A. 2006;103:10166–73. doi: 10.1073/pnas.0603704103. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhou CJ, Wang DH, Niu XX, Kong XW, Li YJ, Ren J, et al. High survival of mouse oocytes using an optimized vitrification protocol. Sci Rep. 2016;6:19465. doi: 10.1038/srep19465. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhang Y, Tan R, Wang L, Shi X, Li Y, Zhong X, et al. Shoutai pills improve the quality of oocytes exposed to the chemotherapeutic drug Hydroxyurea. Aging (Albany NY). 2020;12:8473–83. doi: 10.18632/aging.103152. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Smith DM, Patel S, Raffoul F, Haller E, Mills GB, Nanjundan M. Arsenic trioxide induces a beclin-1-independent autophagic pathway via modulation of SnoN/SkiL expression in ovarian carcinoma cells. Cell Death Differ. 2010;17:1867–81. doi: 10.1038/cdd.2010.53. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lee SE, Hwang KC, Sun SC, Xu YN, Kim NH. Modulation of autophagy influences development and apoptosis in mouse embryos developing in vitro. Mol Reprod Dev. 2011;78:498–509. doi: 10.1002/mrd.21331. [DOI] [PubMed] [Google Scholar]
  • 30.Gallardo Bolanos JM, Miro Moran A, Balao da Silva CM, Morillo Rodriguez A, Plaza Davila M, Aparicio IM, et al. Autophagy and apoptosis have a role in the survival or death of stallion spermatozoa during conservation in refrigeration. PLoS One. 2012;7:e30688. doi: 10.1371/journal.pone.0030688. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Choi JK, Huang H, He X. Improved low-CPA vitrification of mouse oocytes using quartz microcapillary. Cryobiology. 2015;70:269–72. doi: 10.1016/j.cryobiol.2015.04.003. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sharma Y, Sharma M. Sperm cryopreservation: principles and biology. Journal of Infertility and Reproductive Biology. 2020;8:43–8. doi: 10.47277/JIRB/8(3)/43. [DOI] [Google Scholar]
  • 33.Zhang JM, Guo R, Cao YZ. THE PI3K/Akt/mTOR Signaling Pathway Plays a Role in Regulating Autophagy in Mouse Oocytes During Vitrification-warming and in vitro Maturation. Cryo Letters. 2020;41:31–7. [PubMed] [Google Scholar]
  • 34.Yousefi S, Perozzo R, Schmid I, Ziemiecki A, Schaffner T, Scapozza L, et al. Calpain-mediated cleavage of Atg5 switches autophagy to apoptosis. Nat Cell Biol. 2006;8:1124–32. doi: 10.1038/ncb1482. [DOI] [PubMed] [Google Scholar]
  • 35.Bao F, Xiao J, Zhou L, Xie Y, Li Y, Wu Y, et al. Autophagy-independent mitochondrial quality control: Mechanisms and disease associations. MedComm–Future Medicine. 2022;1:e25. doi: 10.1002/mef2.25. [DOI] [Google Scholar]
  • 36.Pyo JO, Yoo SM, Ahn HH, Nah J, Hong SH, Kam TI, et al. Overexpression of Atg5 in mice activates autophagy and extends lifespan. Nat Commun. 2013;4:2300. doi: 10.1038/ncomms3300. [ PMC Free Article ] [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Medical Sciences are provided here courtesy of Shiraz University of Medical Sciences

RESOURCES