A comparative study on feeding timing and additive types of broilers in a high-temperature environment

Abstract

Antioxidants such as vitamin C (VC) and green tea extract (GTE) have been reported to have various antioxidant functions and are used as one of the nutritional approaches to alleviate heat stress (HS) in chickens. However, studies on the feeding timing that can produce optimal effects have not been reported. In this study, the stress-relieving effect of VC and GTE addition timing was investigated in high-temperature broiler chickens. A total of 880 1-d-old male chickens were used, and the treatments were as follows: no feed additives provided, CON; VC 250 mg/kg added from 1 d, VC1; GTE 600 mg/kg added from 1 d, GTE1; VC 250 mg/kg added from 22 d, VC22; GTE 600 mg/kg added from 22 d, GTE22. The HS environment was provided for 2 wk from the 22 d and was set at 33 ± 1 °C, 55 ± 10% for 24 h. Feed and water were provided ad libitum. Broiler production was similar in all treatments. In chicken meat quality, the addition of VC and GTE had an effect on meat color and pH (P < 0.05). In particular, GTE had a positive effect on the antioxidant capacity and quality preservation of breast meat (P < 0.05). In blood characteristics, GTE1 significantly lowered the level of total cholesterol, and VC1 affected AST and IgM (P < 0.05). Interestingly, the VC1 group had a positive effect on the maintenance and development of intestinal morphology, a lower rectal temperature, and showed to relieve stress. In conclusion, the addition of VC and GTE has been shown to alleviate the high-temperature stress of broilers, and in the case of VC in particular, feeding from 1 d appeared to alleviate stress more effectively. This study suggests that it is important to determine the appropriate timing of addition of functional substances in order to effectively reduce various stresses that occur in livestock rearing.

Antioxidants can help mitigate oxidative stress induced by heat stress, and it may be important to supplement them before stress to increase their effectiveness.

Introduction

Climate change worldwide, including recent global warming, poses major challenges to poultry production systems (Nawab et al., 2018). According to the survey, temperatures are rising at a rate of 0.2 °C per decade and are likely to continue increasing in the future (Hajati et al., 2015). Among all bioclimatic parameters, temperature is considered the most important factor affecting livestock, as it has a direct impact on animals and often causes heat stress (HS; Nyoni et al., 2019). In the poultry industry, HS affects a wide range of productivity, starting with reduced feed intake (Nawab et al., 2018). In the case of chicken meat, HS causes deterioration in meat quality due to loss of water-holding capacity, pH, and juiciness, resulting in changes in normal color, taste, and texture (Nawaz et al., 2021). In addition, HS affects protein synthesis and produces undesirable fat, resulting in poor meat quality (Nawaz et al., 2021). Therefore, it is necessary to explore effective strategies to improve the thermo-tolerance and production of poultry raised in HS conditions (Nawab et al., 2018).

HS induces excess reactive oxygen species, including dysfunction of mitochondria, poor nutrient metabolism, and antioxidant system, causing oxidative stress (Hu et al., 2019). Many studies have been conducted to alleviate the effects of HS by adding natural antioxidant supplements such as vitamin C (ascorbic acid; VC) and green tea extract (GTE) to poultry feed (Attia et al., 2017; Hoan et al., 2021). The VC is an essential nutrient for poultry, is known for its anti-inflammatory, antioxidant properties, improving animal health, and increases the growth performance (Van Hieu et al., 2022). VC is used to reduce the stress response during the dry season in tropical countries, improves resistance to disease, and helps the body’s oxidation process through stress control (Van Hieu et al., 2022). In particular, VC has been recommended as a supplement to overcome HS because although it is regularly synthesized in broilers, absorption is reduced and requirements are increased in high-temperature environments (Mohamed et al., 2020). Addition of 250 mg/kg VC to broiler diets under high-temperature conditions has been reported to improve live weight gain, feed efficiency, and carcass traits and alleviate stress hormones and lipid peroxidation (Sahin et al., 2003).

The GTE has been shown to be effective in reducing HS-induced oxidative stress by activating the antioxidant system in poultry (Sahin et al., 2010; Hu et al., 2019). Catechin, a substance with excellent antioxidant power, is contained in many dietary products, plants, and fruits such as green tea, white tea, red wine, apples, kiwi, persimmon, and cacao, but green tea contains the most (Yilmazer-Musa et al., 2012; Zanwar et al., 2014; Kara et al., 2016; Isemura, 2019). Green tea’s catechins account for 30% of its dry weight and contain a large amount of polyphenols, which have antioxidant effects such as cardiovascular protection, antimutagenic, antiviral, and anticancer activities (Du et al., 2012). When green tea and feed supplemented with GTE were fed to poultry in a HS condition, feed intake, feed efficiency, live body weight, and egg production rate increased, and antioxidant status such as reduction of stress hormones, and increased activities of antioxidant enzymes was improved (Abd El-Hack et al., 2020; Abdel‐Moneim et al., 2020; Hoan et al., 2021). Especially, epigallocatechin-3-gallate (EGCG) found in GTE is able to prevent damage from regulating heat shock proteins in the liver (Hoan et al., 2021).

Supplementation of antioxidants to diet is an effective approach to relieve negative effects of heat-stressed broilers. The addition of 100 mg/kg vitamin E and 100 mg/kg polyphenol to the diet of broilers exposed to HS did not improve production compared to the control, but did increase blood antioxidant activity (Mazur-Kuśnirek et al., 2019). However, it has been reported that most polyphenolic components are unstable and have low bioavailability. Hatano et al (2008) reported that polyphenols can maintain stable antimicrobial activity in the presence of ascorbic acid.

Some researchers have reported that improvements are greater when animals consume functional substances before they are subjected to various stresses. Keerqin et al (2017) reported that amino acid intake in broilers immediately after hatching improved immunity and was more effective in preventing necrotic enteritis than those consumed after 2 d of fasting. In addition, Jain et al. (2008) compared the infection prevention effect by varying the duration (2 d or 7 d) of probiotic feeding to mice before infection with Salmonella enteritidis. As a result, the proliferation of antibodies and lymphocytes was improved in mice fed 7 d before infection, and S. enteritidis infection was more effectively prevented. Guo et al. (2006) reported that 6 wk of vitamin E supplementation in the diet of pre-slaughter pigs was more effective in reducing lipid oxidation in pork than 3 or 9 wk.

Therefore, in this study, the effects of adding VC and GTE, which are effective in relieving HS in broilers, were compared, and in particular, differences in improvement effects were investigated by varying the feeding start date. The additional amount of each additive was set to an appropriate level by referring to the reported studies.

Materials and Methods

Ethics statements

The experimental protocol was reviewed and approved by the Institutional Animal Care and Welfare Committee of the National Institute of Animal Science, Rural Development Administration, Republic of Korea (Approval number: 2020-470).

Experimental design

A total of 880 one-day-old male Ross 308 broilers were weighed and randomly assigned to 5 different treatment groups with four replicates of 44 birds each. The five groups were as follows: fed the basal diet without feed additive (CON); fed the basal diet with 250 mg/kg VC from birth (VC1); fed with 600 mg/kg GTE from birth (GTE1); fed with 250 mg/kg VC from 22 d (VC22); fed with 600 mg/kg GTE from 22 d (GTE22). The ingredient composition and chemical nutrient composition of the basal diet without mixing each feed additive are shown in Table 1, and each treatment feed was provided by adding each feed additive to the feed for each phase.

Table 1.

Feed compositions and nutritional compositions of starter, grower, and finisher feed of broilers

Item	Starter (1–7 d)	Grower (8–21 d)	Finisher (22–35 d)
Ingredient composition, %
Corn	51.35	56.06	58.15
Soybean meal	37.45	32.55	30.43
Wheat	4.00	4.00	4.00
Soybean oil	3.07	3.57	4.03
Mono dicalcium phosphate	1.35	1.18	0.95
Limestone	1.60	1.58	1.57
Sodium chloride	0.25	0.25	0.25
Methionine, 99%	0.33	0.25	0.22
Lysine, 78%	0.20	0.16	0.00
Vitamin mix 1	0.20	0.20	0.20
Sodium bicarbonate	0.20	0.20	0.20
Total	100.00	100.00	100.00
Calculated nutrients composition
AMEn, kcal/kg	3,025	3,100	3,150
Crude protein, %	22.00	20.00	19.00
Crude fiber, %	4.76	4.54	6.19
Calcium, %	0.95	0.90	0.85
Phosphorus, %	0.45	0.40	0.35
Lys, %	1.42	1.25	1.10
Met+Cys, %	1.05	0.92	0.87

¹Vitamin mix provided the following per kilogram of diet: vitamin A (from vitamin A acetate), 12,500 IU; vitamin D₃, 2,500 IU; vitamin E (from dL-α-tocopheryl acetate), 20 IU; vitamin K₃, 2 mg; vitamin B₁, 2 mg; vitamin B₂, 5 mg; vitamin B₆, 3 mg; vitamin B₁₂, 18 µg; calcium pantothenate, 8 mg; folic acid, 1 mg; biotin, 50 µg; niacin, 24 mg. Fe (as FeSO₄·7H₂O), 40 mg; Cu (as CuSO₄·H₂O), 8 mg; Zn (as ZnSO₄·H₂O), 60 mg; Mn (as MnSO₄·H₂O) 90 mg; mg (MgO) as 1,500 mg.

The products of VC (l-ascorbic acid (purity: 99.8%), CSPC Weisheng Pharmaceutical Co., Ltd. Hebei, China), and GTE (Anhui Redstar Pharmaceutical Co. Ltd., Xuancheng, China) used were purchased after reference to previous studies (Bozakova et al., 2012; Huang et al., 2015). The catechins of GTE include EGCG (18.7%), epigallocatechin (EGC, 17.8%), epicatechin-3-gallate (ECG, 3.8%), and epicatechin (EC, 3.0%), in addition to which 53.4% of tea polyphenol is contained. All birds were raised at recommended environmental conditions until 21 d of age. HS environmental conditions (33 ± 1 °C, 55 ± 10% for 24 h) were introduced for 2 wk. Two gas heaters with a sensor thermostatic controller were used to maintain the high temperature, and were controlled to minimize the temperature difference of each pen. The average relative humidity is controlled by means of an electronic controller humidifier. The birds were provided with food and water ad-libitum.

Performance parameters

Body weight and feed intake of each pen were determined at 1, 21, and 35 d of age. The feed intake and weight gain were recorded in periods and feed conversion ratio was calculated.

Collection of samples

At the end of 35-d experimental period, three broilers per pen (12 per treatment group) were randomly selected for blood, breast meat, liver, and small intestine (jejunum) samples collection. Blood samples 5 mL were collected from the wing vein and placed into serum separator tubes (BD Bioscience, NJ, USA). To estimate the serum biochemical parameters, corticosterone, and superoxide dismutase (SOD) activity, blood samples were centrifuged at 3,000 rpm at 4 °C for 15 min to separate the serum and were stored at −70 °C before analysis.

The section in small intestine used for intestinal histology analysis was the jejunum that the most distal point of insertion of the mesentery to 5 cm before Meckel’s diverticulum (Lee et al., 2022). After slaughter, the gastrointestinal tract was immediately removed and samples were collected at 8 cm lengths proximal to the Meckel’s diverticulum (Calik and Ergün, 2015). Then the segment was flushed gently with physiological saline to remove intestinal contents, and fixed in 10% formalin in 0.1 M phosphate buffer (pH = 7.0) for morphology measurement (Lee et al., 2022).

Breast meat samples were taken for meat quality and antioxidant capacity measurements and stored at 4 °C until analysis. Liver samples were frozen quickly in liquid nitrogen and then stored at −80 °C until further analysis for gene expression of heat shock protein 70.

Determination of meat quality

The pH of the breast meat was measured using an Orion 230A pH meter (Thermo Fisher Scientific, Waltham, MA, USA) as described by Son et al., (2022). For cooking loss measurement, the meat samples were weighed, put in a plastic bag, and then immersed in a water bath at 80 ºC for 20 min. After cooking, the samples were cooled at 25 °C for 10 min, and cooking loss was calculated as the percentage of loss in relation to the initial weight. To measure shear force, the above-cooked samples were cut into 1 × 2 × 2 cm pieces, then their shear force was measured using a texture analyzer TA1 (Lloyd Instruments, Fareham, UK) with a V blade. Meat color of breast meat was measured with a colorimeter (CR-300; Minolta Co., Osaka, Japan), in terms of lightness (L*), redness (a*), and yellowness (b*) values. The breast meat was evaluated for changes in color, three times in different locations of each sample.

Antioxidant capacity of breast meat

The 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity was analyzed using the supernatant collected from breast meat (Pectoralis major) modified by Blois (1958). Briefly, 5 g of breast meat was homogenized in 25 mL of distilled water. Then, 10 μL of supernatant meat was mixed with 90 μL distilled water and 100 μL of 0.2 mM DPPH solution and kept in a dark room at room temperature for 30 min. The absorbance was read at 517 nm using a microplate reader (Epoch2, Biotek Instruments, Winooski, VT, USA). The DPPH radical scavenging activity was calculated as follows:

$$\text{DPPH radical scavenging activity}\left(\text{\%}\right)=\left(1-\left(\text{absorbance of sample}/\text{absorbance of control}\right)\right)\times 100.$$

The ferric reducing antioxidant power (FRAP) assay was performed according to the method of Benzie and Strain (1996). The FRAP solution containing 10 mM 2,4,6-tripyridyl-s-triazine and 20 mM ferric chloride in 300 mM sodium acetate buffer (pH 3.6), at a ratio of 1:1:10 (v:v:v), was added to a tube and incubated at 37 °C for 30 min. The absorbance of the solution was measured at 593 nm. The FRAP value of each sample was calculated from a Trolox standard curve and expressed as μM Trolox. The thiobarbituric acid reactive substance (TBARS) was measured after storage at 4 °C for 10 d using the method described by Buege and Aust (1978). The 5 g of breast meat samples was homogenized in 15 mL of distilled water and 50 μL of 10% butylated hydroxyl anisole solution. Then, 1 mL of the supernatant was mixed with 2 mL of 20 mM 2-thiobarbituric acid solution (in 15% trichloroacetic acid solution). The mixture was heated in a water bath at 80 °C for 15 min, and cooled on ice for 10 min. It was then centrifuged at 3,000 rpm at 4 °C for 10 min. The absorbance was measured at 531 nm. The TBARS value was expressed as milligrams of malondialdehyde (MDA) per kilogram of meat (mg MDA/kg meat).

Serum biochemistry

Serum biochemistry indicators, including total cholesterol, triglycerides, glucose, total protein, albumin, aspartate aminotransaminase (AST), alanine aminotransferase (ALT), creatinine, and lactate dehydrogenase (LDH) were measured using an automatic biochemistry analyzer (AU480 Chemistry Analyzer, Beckman Coulter Inc., Brea, CA, USA) and commercially available reagents(total cholesterol, OSR6116; triglycerides, OSR61118; glucose, OSR6121; total protein, OSR6132; albumin, OSR6102; AST, OSR6109; ALT, OSR6107; creatinine, OSR6178; LDH, OSR6128). The concentrations of corticosterone in serum were measured using a commercial enzyme-linked immunosorbent assay (ELISA) kit (ADI-900-097, Enzo Life Science, Inc., Farmingdale, NY, USA), performed according to the protocol. The SOD activity of serum was assayed using the SOD assay kit-water soluble tetrazolium salt (Dojindo, Tokyo, Japan). Absorbance at 450 nm was read using a microplate reader, and the superoxide inhibition rate was calculated according to the protocol. The SOD activity was used to calculate the inhibition rate of the competitive WST-1 reaction.

Real-time quantitative PCR

Ribonucleic acid (RNA) extraction from the liver samples was performed using the AccuZol Total RNA extraction kit (Bioneer, Daejeon, Korea) according to the manuals. RNA purity and concentration were analyzed using a Synergy 2 multi-mode microplate reader, the Take3 plate on a microplate reader. The complementary DNA (cDNA) was synthesized using AccuPower Cycle Script RT Premix (Bioneer, Daejeon, Korea). Quantitative real-time polymerase chain reaction (qPCR) analysis was performed in QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) and using PowerUp SYBR Green Master Mix (Applied Biosystems, Thermo Fisher Scientific, USA). Annealing temperatures were set with reference to the Tm value (Table 2). Candidate mRNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using calculated via the 2^−ΔΔCt method

Table 2.

Primer sequences for target genes

Gene	Primer sequence (5ʹ-3ʹ)	T mʹ °C
HSP70	F: GGTAAGCACAAGCGTGACAATGCT R: TCAATCTCAATGCTGGCTTGCGTG	60
GAPDH	F: AGAACATCATCCCAGCGT R: AGCCTTCACTACCCTCTTG	55

Intestinal morphology

The fixed intestinal samples were placed in paraffin, and sliced at 5 μm, then stained with hematoxylin and eosin. The stained slides were scanned by fluorescence microscopy (TE2000, Nikon, Tokyo, Japan) with a digital camera (DS-Ri2, Nikon, Japan). The variables were measured such as villus height (VH) and villus width (VW), crypt depth (CD), VH, and CD ratio (VH/CD). The fluorescent images were processed with NIS-Elements BR software (Nikon, Japan).

Determination of rectal temperature

Six broilers from each replicate were selected for rectal temperature measurements using a digital thermometer at 21, 22, 28, and 35 d of age. The probe was inserted ~3 cm into the rectum for about 30 s until a fixed reading was obtained.

Data analysis

The analyses were performed using the statistical analysis system (SAS) software (version 9.4; Statistical Analysis System Institute Inc., USA) with each pen as the experimental unit for production, and each bird as the experimental unit for the blood parameters, intestinal morphology, meat quality, and antioxidant capacity. All data among groups were analyzed by one-way analysis of variance (ANOVA) using Tukey’ multiple comparison test. Means were considered statistically different when P-values were less than 0.05. The data are expressed as least square means and standard error of the mean (SEM).

Results

Growth performance

Table 3 shows the effect of feed additives and intake period on the production of broilers in the HS environment. The VC and GTE did not significantly affect broiler production in the HS environment, regardless of when they were added.

Table 3.

Broiler production in heat stress condition according to additives and feed timing¹

Item	CON	VC1	GTE1	VC22	GTE22	SEM	P-value
Initial body weight, g	43.5	43.5	43.4	43.5	43.5	0.024	0.928
0 to 21 d
Body weight gain, g	747.6	769.6	729.7	746.8	746.2	5.981	0.366
Feed intake, g	1,345.5	1,394.6	1,401.8	1,419.5	1,422.2	15.193	0.548
FCR	1.79	1.81	1.95	1.90	1.91	0.028	0.289
22 to 35 d
Body weight gain, g	614.8	540.9	620.4	586.3	632.8	18.183	0.499
Feed intake, g	1,551.1	1, 551.8	1,543.6	1,510.9	1,602.8	21.704	0.803
FCR	2.56	2.91	2.50	2.59	2.54	0.066	0.187
Overall
Body weight, g	1,405.9	1,354.0	1,393.6	1,376.6	1,422.5	16.795	0.780
Body weight gain, g	1,362.4	1,310.5	1,350.1	1,333.1	1,379.0	16.792	0.780
Feed intake, g	2,896.6	2,946.5	2,945.4	2,930.4	3,025.0	22.695	0.525
FCR	2.13	2.25	2.18	2.20	2.19	0.019	0.446

¹Values are expressed as mean ± SEM of four replicates (44 chickens per replicate).

Meat quality and antioxidant activity

Table 4 shows the difference in quality, antioxidant activity, and storage of chicken breast meat according to the feeding period of each additive in the HS condition. In the case of pH, it was the lowest in the VC1 group, and the highest in the group treated with GTE22 (P < 0.05). In terms of meat color, VC1 treatment showed the highest level of a*, and GTE22 showed the lowest (P < 0.05). There was no difference in cooking loss and shear force. As a result of comparison of antioxidant activity, DPPH radical scavenging ability was significantly higher in GTE1 and FRAP was higher in GTE22 group (P < 0.05). Also, when the breast meat was stored for 10 days, the TBARS level was significantly lower in the GTE22 group (P < 0.05).

Table 4.

Comparison of chicken breast meat quality according to additives and feeding period for broilers in heat stress condition¹

Item		CON	VC1	GTE1	VC22	GTE22	SEM	P-value
pH		5.66 a,b	5.57 b	5.74 a,b	5.62 a,b	5.79 a	0.025	0.032
Cooking loss, %		23.8	24.2	21.5	26.6	23.6	0.584	0.094
Shear force, kgf		31.9	30.8	26.1	28.6	29.1	0.684	0.072
Meat color
L*		58.1	56.7	57.1	58.8	57.4	0.454	0.619
a*		5.79 a,b	6.33 a	5.36 a,b	5.65 a,b	4.97 b	0.129	0.011
b*		17.0	17.3	15.8	17.6	16.3	0.232	0.073
Antioxidant activity
DPPH, %		49.3 b	50.1 b	56.9 a	51.8 a,b	52.7 a,b	0.787	0.016
FRAP, uM TE		107.1 c	124.3 b	136.2 a,b	127.0 a,b	137.2 a	2.045	<0.001
Storage quality
TBARS, mg MDA/kg	0 d	0.118 a	0.110 a,b	0.092 b	0.093 b	0.094 b	0.003	0.008
	10 d	0.131 a	0.125 a,b	0.117 a,b	0.103 a,b	0.095 b	0.004	0.018

¹Values are expressed as mean ± SEM of four replicates (3 chickens per replicate).

^{a -c}Means in each row followed by different superscript letters differ significantly.

Blood metabolites

The blood biochemical parameters, immune, and stress indicator results of broilers in HS environment according to the feeding time of each additive are summarized in Table 5. Total cholesterol content was the lowest in the GTE1 group, and glucose was high in the GTE22 group (P < 0.05). As an indicator of liver function, AST was the lowest in the VC1 group, and LDH was the lowest in the GTE treatment groups (GTE1 and GTE22) (P < 0.05). IgM level was the highest in the VC1 group (P < 0.05). Corticosterone and SOD levels were similar in all treatments.

Table 5.

Comparison of blood characteristics according to additives and timing of addition to broilers in heat stress condition¹

Item	CON	VC1	GTE1	VC22	GTE22	SEM	P-value
Total cholesterol, mg/dL	149.0 a,b	149.0 a,b	136.5 b	163.7 a,b	167.4 a	3.511	0.036
Triglyceride, mg/dL	77.2	68.3	66.4	70.6	76.3	2.191	0.439
Glucose, mg/dL	87.6 a	43.3 b	41.1 b	51.3 a,b	92.5 a	5.835	0.002
Total protein, g/dL	4.15	4.48	4.08	4.18	4.20	0.077	0.522
Albumin, g/dL	1.68	1.67	1.59	1.63	1.70	0.022	0.499
AST, U/L	326.5 a	271.4 b	284.1 a,b	306.5 a,b	325.2 a	5.806	0.004
ALT, U/L	3.07	2.27	2.62	2.63	2.52	0.096	0.150
LDH, mg/dL	3,179.4 a	2,847.8 a,b	2,599.6 b	2,855.1 a,b	2,566.5 b	67.331	0.025
Creatinine, mg/dL	0.23	0.23	0.21	0.23	0.23	0.003	0.475
IgM, ng/mL	16.96 a,b	21.76 a	15.98 a,b	14.68 b	13.60 b	0.848	0.021
Corticosterone, ng/mL	12.43	8.82	6.54	7.43	6.14	0.787	0.073
SOD, U/mL	1,099.0	1,406.6	1,474.3	1,573.7	1,557.3	90.205	0.472

¹Values are expressed as mean ± SEM of four replicates (3 chickens per replicate).

^a-bMeans in each row followed by different superscript letters differ significantly.

HSP70 expression in liver

The expression of HSP70 in the liver of broilers according to the feeding period of the feed additives is shown in Figure 1. The expression levels of HSP70 according to the feed additives and feeding period treatments are similar to that in the control.

Figure 1.

Comparison of HSP70 expression by real-time quantitative PCR in the liver tissue of broilers in a high-temperature environment according to the addition period of additives. All means are expressed as mean ± SEM (n = 12 chickens/treatment).

Histological analysis

The results of the histological analysis of the small intestines (jejunum) for each treatment group are shown in Table 6. VH was highest in the VC treatment groups (VC1, VC22) and GTE22 group, and CD was highest in the GTE22 group (P < 0.05). In particular, VW and VH/CD levels were the highest in VC1 group (P < 0.05).

Table 6.

Histological analysis results of broiler jejunum according to the addition period of each additive¹

Item	CON	VC1	GTE1	VC22	GTE22	SEM	P-value
VH, μm	1,058.5 b	1,222.1 a	1,068.9 b	1,256.1 a	1,241.7 a	15.310	<0.001
VW, μm	135.6 b	156.4 a	144.7 a,b	139.6 b	135.5 b	1.910	0.002
CD, μm	155.2 c	159.3 b,c	157.2 c	175.8 a,b	188.7 a	2.197	<0.001
VH/CD	6.82 b	7.67 a	6.80 b	7.15 a,b	6.58 b	0.089	<0.001

¹Values are expressed as mean ± SEM of four replicates (3 chickens per replicate).

^a-cMeans in each row followed by different superscript letters differ significantly.

Comparison of rectal temperature

Figure 2 shows the change in broiler rectal temperature in the high-temperature environment for each treatment group. Broilers from all treatments before the hot environment showed similar rectal temperatures. However, after providing a high-temperature environment, the rectal temperature of all treatment groups increased, and among them, the VC1 treatment group showed a significantly lower temperature on the 28th day (P < 0.05).

Figure 2.

Comparison of rectal temperature of broilers in a high-temperature environment according to the addition period of additives. All means are expressed as mean ± SEM (n = 12 chickens/ treatment).

Discussion

This study investigated the differences that appeared when VC or GTE was fed as an antioxidant to broilers in HS conditions at different periods. Numerous studies have shown that high temperatures adversely affect broiler productivity, such as feed intake and body weight gain. Reportedly, High-temperature environments affect peripheral thermos receptors that regulate the activity of the appetite center in the hypothalamus of broilers, and feed intake is decreased to reduce heat dissipation associated with nutrient metabolism, causing metabolic disorders, inefficient digestion, and production (Abidin and Khatoon, 2013; Attia et al., 2017). Moreover, chronic exposure to heat stress leads to oxidative stress as excessively induced reactive oxygen species damage and imbalance the body’s antioxidant system. The antioxidants such as VC, green tea’ ECGC maintain the equilibrium of oxidation–reduction and modulate antioxidant enzymes to alleviate damage caused by HS, such as improving poultry growth performance (Hu et al., 2019). Therefore, many researchers have investigated the alleviating effect of adding GTE or VC to broilers in HS condition, but the effect on production has been varied (Seven et al., 2008; Imik et al., 2012; Rafiee et al., 2016; Kim et al., 2021). On the one hand, an in ovo or post-hatch early feeding strategy has been reported to improve poultry growth rates and achieve high broiler yields at market age, in particular by mitigating the adverse effects of heat stress (Taha-Abdelaziz et al., 2018). Access to nutrient intake immediately post-hatching in poultry is important for the development of all major organs and has been shown to improve chick body growth, uniformity, and health (Ao et al., 2012). In one study, when Zn-bacitracin, acidifier, and mannan-oligosaccharides were given to broilers at different times, broilers fed earlier had higher body weight and lower mortality (Ao et al., 2012). However, in this study, addition of VC and GTE and feeding period did not significantly affect broiler production in a high-temperature environment.

Chicken meat quality, such as taste, smell, color, and shape, is characteristics that affect consumers’ purchasing decisions and preferences, and HS is known as one of the main factors affecting meat quality (Hu et al., 2019; Zhang et al., 2020; Lee et al., 2022). HS affects pH and meat color changes and drip loss, degrading meat quality attributes such as low sensory scores, and negatively affecting chicken meat production (Zhang et al., 2020). However, it has recently been reported that improving the antioxidant capacity of poultry can mitigate the side effects of chicken meat quality caused by HS, and the efficacy of natural antioxidants such as GTE and VC is being investigated (Hu et al., 2019; Shakeri et al., 2020).

The decision on the timing of feeding of feed and useful feed additives also affects on chicken quality and yield (Bhanja et al., 2010; Jha et al., 2019; Atan et al., 2021). Atan et al. (2021) reported that period immediately before and after hatching is an important period that determines the efficiency and production of good quality chicken meat in broilers. Tavaniello et al. (2020) found that in ovo injection of prebiotics (galactooligosaccharides) effective for alleviating HS mitigated the detrimental effects on meat quality in broilers in a high-temperature environment. In our study, the VC1 group significantly lowered the pH of chicken meat, and the redness was the lowest in the GTE22 group. It is known that high-temperature stress increases the pH of chicken meat, but there is a study result that the addition of VC prevents the increase in pH (Imik et al., 2012; Zeferino et al., 2016). On the other hand, catechins and polyphenols of green tea are known to affect antioxidant activity and meat color, but different results have been reported for redness, so further research is needed on the mechanism affecting flesh color (Rababah et al., 2011; Saeed et al., 2018).

High antioxidant activities (DPPH and FRAP) in breast meat were shown in chickens fed with GTE. In addition, GTE inhibited lipid peroxidation of breast meat caused during storage. Tea catechins, including green tea, are known to be non-toxic and the polyphenol catechins found in green tea in particular provide health benefits with antioxidant mechanisms (Tang et al., 2002; Farahat et al., 2016). Green tea catechins including EGC, epigallocatechin gallate, and epicatechin gallate have been reported to have higher antioxidant capacity than α-tocopherol, butylated hydroxytoluene (BHT), and VC (Tang et al., 2002; Farahat et al., 2016). On the other hand, the quality of meat changes rapidly due to the lack of sufficient inherent antioxidants, but direct application of antioxidants or bioaccumulation through feed can improve meat quality and shelf life (Farahat et al., 2016). As a result of examining lipid oxidation and antioxidant activity by adding tea catechin to chicken breast and leg meat, it showed lipid oxidation inhibitory effect equivalent to α-tocopheryl acetate and showed strong free radical scavenging ability (Tang et al., 2002). It has also been reported that dietary supplementation of green tea catechins reduces lipoperoxidation in muscle, liver, and heart, as well as chicken meat (Fellenberg and Speisky, 2006). In this study, it is also shown that the polyphenol catechin component contained in GTE showed high antioxidant capacity in chicken meat due to the accumulation and antioxidant action in the body of broilers.

In poultry, early supplementation (in ovo or post-hatch) of exogenous feed additives, including amino acids, minerals, vitamins, prebiotics, and probiotics, has been reported to improve antioxidant defenses (Arain et al., 2022; Al-Shammari, 2023). Arain et al. (2022) reviewed that early feeding of functional antioxidants in the form of in ovo injection or immediate post-hatch feeding not only improves hatching performance, but also reduces infections and oxidative stress problems, and improves poultry health by boosting antioxidants and immunity. In ovo injection of Astragalus membranaceus polysaccharides in Cobb 500 chickens increased antioxidant enzymes and lowered MDA levels (Alagawany et al., 2022). Al-Shammari (2023) showed lower MDA and higher FRAP levels in Japanese quail-fed VC immediately after hatching than in the group fed 24 h later. Conversely, in the study of Khaligh et al. (2018), when VC, quercetin, and chrysin were provided in the form of in ovo feeding, there was no effect on MDA concentration and antioxidant enzyme activity. In view of this, a number of studies have been conducted to verify the improvement of antioxidant efficacy in broiler chickens through in ovo injection of functional substances, but the antioxidant improvement effect provided immediately after hatching is very rare, so additional research is needed.

HS affects levels of cholesterol, total protein, and uric acid in poultry blood, as well as liver oxidases such as AST and ALT and stress hormones (Mirsaiidi Farahani and Hosseinian, 2022; Son et al., 2022). However, antioxidant intake has been reported to lower blood AST and ALT concentrations, increase immunoglobulin content, and decrease stress hormone levels (Sahin et al., 2003; Hosseini-Vashan et al., 2012; Ismail et al., 2021). In particular, there are many reports that early access to functional substances, including feed and water, affects blood biochemical components, or immunoglobulin levels in poultry (Dibner et al., 1998; Hassan et al., 2022; Wijnen et al., 2022). The level of nutrient composition or density of the diet accessible immediately after chick hatching affects the chick’s performance potential and determines its serum protein, total lipid, cholesterol, white blood cell count, and immunoglobulin levels. Dibner et al. (1998) confirmed that hydrated nutritional supplements provided immediately after hatching improved the level of immunoglobulin in the body, resulting in high disease resistance. Ingestion of the dietary supplement mannan-oligosaccharides immediately post-hatching enhanced T cell proliferation, increased interleukin-6 levels, and effectively protected against Clostridium perfringens infection (Ao et al., 2012). In this study, when VC and GTE were provided, low AST and LDH levels were shown, VC1 showed high immunoglobulin levels, and GTE1 showed low total cholesterol levels. Luo et al. (2018) also observed that blood AST and LDH decreased when EGCG was provided to broilers in a high-temperature environment, as in this study, and Inoue et al. (2013) reported that EGCG relieves oxidative stress by removing free radicals through the antioxidant system. In particular, the report that catechin supplementation in green tea prevents excessive lipid ­accumulation in the body such as poultry liver and inhibits intestinal absorption of lipids supported our findings (Abd El-Hack et al., 2020). VC is also known to have hepatoprotective effects related to its antioxidant properties and has been found to restore markers such as AST and ALT to normal levels (Cinar et al., 2014). In particular, VC plays a role in the immunomodulatory function of lymphocytes, increasing the levels of immunoglobulin (IgG, IgM) in serum (Van Hieu et al., 2022). In view of these studies, the effect of the addition time of functional substances in poultry is not yet clear, and there are few studies, so additional research is needed on determining the addition time of each functional substance to improve antioxidant activity.

The VH/CD ratio and VW of broilers under high-temperature conditions were the highest in VC1 group. Intestinal environment, especially VH and VH/CD ratio, affects digestion and absorption of nutrients in the small intestine (Lee et al., 2022). However, it has been reported that HS negatively affects intestinal morphology and villi parameters, such as decreased VH and increased CD, and induces intestinal ischemia to reduce intestinal integrity and results in lower digestibility (Hosseini-Vashan et al., 2020; Bahrampour et al., 2021). Several studies have demonstrated that the addition of antioxidants including vitamin E and C, and minerals to feeds mitigates the negative effects of HS on nutrient digestibility (Bahrampour et al., 2021). It has been shown that VC supplementation has a positive effect on intestinal health by improving intestinal histology, forming epithelium, and preventing oxidative protein degeneration (Amer et al., 2021). Bahrampour et al. (2021) revealed that when antioxidants and minerals, including VC, were added to feed, the negative effects on nutrient digestibility were mitigated and damage caused by HS was prevented. In addition, VC has an interaction with the feeding time, so the earlier it is fed, the more it has a positive effect on nutrient digestion, such as metabolism, heat regulation, and multiple enlargements of the absorptive surface of the intestinal villi (Al-Shammari, 2023). In view of this, in our study, it is shown that early feeding of VC improved the intestinal environment of broilers, such as VW and H/L ratio, and alleviated the adverse effects from the HS.

HS increases body temperature and panting rate due to respiratory alkalosis, impairing growth performance, resulting in reduced growth in chickens, and can be a major contributor to increased mortality (Shakeri et al., 2018). Therefore, rectal temperature is a common indicator of thermal homeostasis and is widely analyzed to measure poultry’s response to environmental stress (Yang et al., 2022). Methods such as environmental controls, genetic modification, and dietary modification have been studied to counteract the detrimental effects caused by HS, such as elevated rectal temperature (Abidin and Khatoon, 2013; Zhang et al., 2018). Among them, as a dietary control method, supplementation with VC lowers rectal temperature and prevents production loss (Abidin and Khatoon, 2013). Kadim et al. (2008) reported that VC supplementation at 200 to 300 ppm lowered rectal temperature in broilers and improved feed intake, weight gain, and feed conversion ratio by 8%, 11%, and 5%, respectively. This effect was also reported in a study using laying hens, and it is believed that VC improved tolerance to high environmental temperatures by reducing heat load or increasing heat loss in poultry (Egbuniwe et al., 2015). In particular, it was found that VC lacks synthesis ability in newly hatched chicks and requires additional supply through feed and drinking water (Whitehead and Keller, 2003). In one study, it was reported that early feeding of VC by in ovo injection significantly increased the content of VC in plasma, and this effect reduced embryo mortality and improved hatchability in a high-temperature environment (Wijnen et al., 2022). Therefore, in our study, the lowest rectal temperature of the VC1-treated group was determined to be due to maintaining high VC content in the body and improving resistance to HS conditions by ingesting it before a high-temperature environment.

Conclusion

In this study, when VC or GTE was added to broilers in a high-temperature environment at different feeding times, productivity, chicken quality, antioxidant power, and stress hormone, etc., were investigated for the effect of reducing HS. Addition of VC and GTE and duration of feeding did not affect broiler production in HS condition. The addition of VC and GTE had an effect on the pH of chicken meat, and in particular, the addition of GTE had a positive effect on FRAP and TBARS in breast meat. Regarding blood characteristics, GTE lowered total cholesterol and LDH levels, and VC1 group provided an effect on improving immunity, such as lowering AST and increasing IgM content. In addition, the VC1 group was effective in improving villus development and the environment in the small intestine. The rectal temperature in the high-temperature environment also showed the lowest temperature in the VC1 treatment group, showing a stress-relieving effect. The addition of VC and GTE improved broiler meat quality, in vivo antioxidant capacity, immunity, or intestinal environment under high-temperature conditions. In particular, in the case of VC, feeding from birth was effective in reducing the effects of HS. Therefore, this study suggests that determining the proper timing of adding natural antioxidants is important for poultry breeding in a high-temperature environment, and further research is needed on the appropriate timing of feeding other natural substances.

Glossary

Abbreviations:

ALT

alanine aminotransferase

AST

aspartate aminotransaminase

BHT

butylated hydroxytoluene

CD

crypt depth

cDNA

complementary DNA

DPPH

2,2-diphenyl-1-picrylhydrazyl

EC

epicatechin

ECG

epicatechin-3-gallate

EGC

epigallocatechin

EGCG

epigallocatechin-3-gallate

ELISA

enzyme-linked immunosorbent assay

FRAP

ferric reducing antioxidant power

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

GTE

green tea extract

HS

heat stress

LDH

lactate dehydrogenase

MDA

malondialdehyde

qPCR

quantitative real-time polymerase chain reaction

RNA

ribonucleic acid

SOD

superoxide dismutase

TBARS

thiobarbituric acid reactive substance

VC

vitamin C

VH

villus height

VW

villus width

Conflict of Interest Statement

The authors have no conflicts of interest.