Skip to main content
NCBI home page
Pathogens and Disease logoLink to Pathogens and Disease
. 2023 Jul 13;81:ftad017. doi: 10.1093/femspd/ftad017

First molecular detection of Entamoeba gingivalis subtypes in individuals from Turkey

Serra Örsten 1,✉, Cem Şahin 2,3,2, Engin Yılmaz 4, Yakut Akyön 5
PMCID: PMC10553396  PMID: 37442621

Abstract

Entamoeba gingivalis is a parasitic protozoan that colonizes the human oral cavity and there are two subtypes (ST1 and ST2) that have been identified to date. However, there are no reports on the molecular detection or characterization of E. gingivalis in Turkey. The objective of this study was to detect the presence of E. gingivalis in Turkish healthy individuals and those with periodontal disease and to subtype the isolates using molecular techniques. Samples from the oral cavity of 94 individuals were taken and the presence of E. gingivalis was determined by PCR using primers for SsrRNA and the amplicons were then confirmed by DNA sequencing. Each participant completed a questionnaire that included demographic data, habits and lifestyle, as well as health status. The presence of E. gingivalis was detected in a total of 19 samples (11 patients and eight healthy individuals). Molecular characterization determined that 12 samples belonged to ST1 and seven samples belonged to ST2. The presence of E. gingivalis was higher in patients with periodontal disease than in healthy individuals, and this association was statistically significant (P < .05). This study constitutes the first report of molecular detection and subtyping of E. gingivalis in Turkey.

Keywords: Entamoeba gingivalis, subtypes, ST1, ST2-kamaktli, Turkey

Genetic characterization of Entamoeba gingivalis.

Introduction

The oral cavity has the second largest number and variety of microorganisms in the body, housing millions of microorganisms that form the oral microbiota (Zhang et al. 2018). These microorganisms form biofilms (dental plaque) and coexist in symbiotic harmony with the host, but when the microbial equilibrium is broken (dysbiosis) different oral diseases such as dental caries and periodontal disease can occur (Dewhirst et al. 2010, Lourenço et al. 2014, Lamont et al. 2018, Yaseen et al. 2021, Martin-Garcia et al. 2022, Santos and Roldán 2023). Bacteria are the most abundant microorganisms (For example: Streptococcus spp., Gemella spp., Rothia spp., Neisseria spp., Haemophilus spp., Prevotella spp., and Veillonela spp.) in oral microbiota in healthy individuals (Takeshita et al. 2016, Peters et al. 2017, Negrini et al. 2021). In addition to bacteria, the oral cavity can also harbour protozoa such as Entamoeba gingivalis and Trichomonas tenax, which received less attention in periodontal studies (Deo and Deshmukh 2019). However, there have been a some studies investigating the colonization of these parasites in the oral cavity of both healthy individuals and those with periodontal disease, yielding variable results (Bonner et al. 2014, Hassan et al. 2019, Trim et al. 2011, Yazar et al. 2016, Yaseen et al. 2021).

Entamoeba gingivalis is a protozoan microorganism that is mostly found in the human oral cavity and it has also been detected in the genitourinary tract (Bonner et al. 2014). Transmission occurs through contaminated food or oral equipment, mouth droplets, and kissing (Stensvold et al. 2021). Entamoeba gingivalis has a cosmopolitan distribution with a worldwide prevalence of 37% (Badri et al. 2021). Some studies proposed an association between E. gingivalis and periodontal diseases (Garcia et al. 2018b, Badri et al. 2021), and in a metagenomic study it was shown that RNA levels of E. gingivalis was elevated and the microbial diversity was reduced in the inflamed areas of the mouth (Deng et al. 2017, Bao et al. 2020, Badri et al. 2021).

To date, there are phylogenetically close two subtypes of E. gingivalis that have been identified as ST1 and ST2 (García et al. 2018a). These subtypes are suggested to display different patterns of infectious behavior (Garcia et al. 2018b). These subtypes share the same ecological niche in the oral cavity, therefore, it is hard to separate their particular demographic, geographic, or clinical features with few studies done so far.

During the last few decades, many studies have been published on the investigation of the presence of E. gingivalis among healthy individuals and patients with several dental diseases with variable results (Abualqomsaan et al. 2010, Ghabanchi et al. 2010, Özçelık et al. 2010, Trim et al. 2011, Bonner et al. 2014). Different or discrepant results may be related to the use of different approaches for the detection of E. gingivalis, the selection of different groups of patients, and the genetic diversity that, until now, is still somewhat unknown (García et al. 2018a, b). In Turkey there are not many studies on E. gingivalis and the genetic variation has to be explored (Abualqomsaan et al. 2010, Özçelık et al. 2010, Yazar et al. 2016). The objective of this study was to detect the presence of E. gingivalis in both healthy individuals and patients with dental diseases by using molecular techniques. Additionally, the study aimed to perform molecular characterization of the identified E. gingivalis isolates, which had not previously been done in Turkey.

Materials and methods

Study subjects and sample collection

Consecutive patients without any systemic disease (n = 94), aged between 18 and 90 years, consulting in the dental clinic at Hacettepe University Beytepe Hospital (Turkey) were selected for this study. Ethical approval for the study was granted by the ethics committee of Hacettepe University, Ankara, Turkey (GO 21/241). Sample collection was carried out between February 2021 and January 2022. From those who have not received antimicrobial therapy in the past 6 months were included in the study. The samples were taken from these patients’ mouths with a sterile disposable cotton swab. The swab was circulated within the gingival pockets, mucosal surfaces, and tooth surface to increase the possibility of E. gingivalis detection.

Each participant was asked to fill out a questionnaire that included demographic, education, and income-related questions, as well as questions concerning knowledge about some lifestyle habits such as tap water usage, shared toothbrush usage, mouthwash usage, and smoking. In addition, in order to determine the general health status of the participants, the presence of chronic disease and regular drug usage history was also included in the questionnaire.

DNA extraction and amplification

Initially, clinical samples in sterile saline were centrifuged at 1200 × g for 15 min in order to precipitate all the biological material. Genomic DNA was extracted from clinical samples using the DNA extraction Kit (GeneAll Biotechnology, Korea) according to the manufacturer’s instructions. The concentration and purity of all the obtained DNA was measured by FLUOstar Omega Microplate Reader (BMG LABTECH) using LVis plate. In this study, to identify the subtypes as ST1 and ST2, a nested PCR was performed using the following primer sets Entam1/Entam2 and GEgFST1/GEgFST2- EgST1/2-R. The primer sequences used are given in Table 1. For all PCR reactions, previously reported conditions were applied for the time and temperature (Verweij et al. 2001, Garcia et al. 2018b). Amplicons were visualized under ultraviolet light following electrophoresis on 1.5% (w/v) agarose gel and products seen in the approximately 350 base-pair (bp) band size were considered positive.

Table 1.

Primers used in study.

Primer Sequence
Entam1 5′-GTTGATCCTGCCAGTATTATATG-3′
Entam2 5′-CACTATTGGAGCTGGAATTAC-3′
GEgFST1 5′-GAGACGATCCTGTTCTATTAC-3′
GEgFST2 5′GAGACAATCCCAGTTGTTTGTAC3′
EgST1/2-R 5′-ACTATGTACGTTCGTTCATTCC-3′
Open in a new tab

Sequence data analyses

Obtained sequence chromatograms were examined using FinchTV viewer (Geospiza, Seattle, WA, USA) and determined the quality of generated nucleotide sequences. Obtained sequences in this study that are present in the NCBI database were compared using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST/). Sequence data analysis was interpreted as previously described (Boufana et al. 2014). In a few words, data alignment was performed in Mega version 7 and the phylogenetic tree was constructed using ClustalX (Larkin et al. 2007, Tamura et al. 2011). Additionally, Hapview programme was used for generating haplotype networks (Salzburger et al. 2011).

Statistical analysis

Statistical analysis was performed using IBM SPSS Statistics Version 20 (SPSS Inc., Chicago, IL, USA). The chi-square test was used for group comparisons of categorical data.

Results

Demographic and clinical characteristics of study groups

Of the 94 participants, 36 were classified as patients and the rest were considered healthy controls. Most of the participants were female (69.1%, 65/94). The age range of the participants was between 18 and 66 years, and the mean age was 30. Considering the educational status of the participants, most of them (73%, 69/94) were found to have a university and/or higher education degree. Most of the participants (72%, 68/94) were found to have middle/high income; some of them (13.8%, 13/94) had chronic diseases. The majority of the participants (69%, 65/94) indicated not using tobacco, while 87.2% (82/94) reported using spring water. Additionally, most of the participants (85.1%, 80/94) stated that they did not use mouthwash.

Detection and molecular characterization of E. gingivalis

A toal of 19 of the 94 samples (20.2%) were positive for E. gingivalis by nested PCR (with Entam1/Entam2 and GEgFST1- GEgFST2/EgST1/2); 11 of these 19 positive samples came from the oral cavity of patients with dental disease and the other eight came from healthy individuals. The positivity rates were found to be (11/36) in patients with dental disease and 13.8% (8/58) in healthy individuals. All sequences were confirmed as E. gingivalis by the BLAST algorithm. Regarding the subtypes, 12 samples were identified as ST1 and 7 were ST2. The phylogenetic tree was constructed using 22 different sequences (19 of the sequences are detected in this study) (Fig. 1). In addition, all the obtained sequences were submitted to GenBank (Some accession numbers of sequences: OP456213, OP456215, OP456304, OP422447, OQ932783O, and Q932784). Additionally, the analysis of haplotypes was conducted to visualize of genetic diversity among the obtained sequences more clearly. The generated haplotype network presents in Fig. 2.

Figure 1.

Figure 1.

Open in a new tab

Maximum-likelihood phylogenetic analysis of small subunit ribosomal RNA partial sequences. The obtained sequences in this study and some selected reference sequences (AB282658 Entamoeba histolytica, D28490 E. gingivalis, KX027294 E. gingivalis ST2 kamaktli) were used to conduct a phylogenetic tree.

Figure 2.

Figure 2.

Open in a new tab

Haplotype network generated using ssrRNA nucleotide sequences of the E. gingivalis obtained in this study.

The relationship between the presence of E. gingivalis and several characteristics of study groups

In this study, as an indicator of oral hygiene, tartar, periodontitis, smoking, tooth brushing habits, common tooth brush usage, mouthwash usage, drinking water preference, and presence of chronic diseases are the parameters analyzed. Clinical information and some lifestyle habits of E. gingivalis positive patients were given in Table 2. As a result, no significant relationships were found between the presence of E. gingivalis and patients’ demographics including age, gender, education, and income status (P > .05), and no significant correlations were observed between the presence of the parasite and the use of tap water, mouthwash, common toothbrushes, or tobacco (P > .05). However, among the E. gingivalis-positive individuals a significant association was observed between tobacco usage and dental diseases (P = .012). In addition, the presence of E. gingivalis was significantly higher in patients with dental diseases compared to healthy individuals (P = .02).

Table 2.

Clinical information and some lifestyle habits of E. gingivalis positive patients.

Subject codes Subtypes Age Gender Educational status Generalized periodontitis Generalized gingivitis Mild/localized gingivitis Subgingival tartar Supragingival tartar Chronic diseases Smoking Mount wash usage Common tooth brush Tap water
P1 ST1 49 F U + + + + N N Y N Y
P2 ST1 35 M FS + N Y N N N
P3 ST1 20 F U + + + + N N N N N
P4 ST1 55 M FS + + + + N Y N N N
P5 ST1 40 M U + + + + N Y N N N
P6 ST1 42 F FS + N N N N N
P7 ST1 38 F U + + + N N N N N
P8 ST2 22 F FS + + + + CD HS Y N N N
P9 ST2 33 M FS + + + N Y N N Y
P10 ST2 44 M FS + + N Y N N N
P11 ST2 23 M U + + N N N N N
Open in a new tab

F: female, M: male, Y: yes, N: no, FS: first school, HS: high school, U: university, CD: cardiac disease, and HS: hypersensitivity.

Clinical information and some lifestyle habits of E. gingivalis positive healthy individuals were given in Table 3. Any relationship was found between the presence of E. gingivalis and healthy individuals’ demographics such as age, gender, education, and income status (P > .05). Additionally, parasite presence and using tap water, mouthwash, common tooth brush usage, and tobacco were not found associated (P > .05).

Table 3.

Clinical information and some lifestyle habits of E. gingivalis positive healthy individuals.

Subject codes Subtypes Age Gender Educational status Generalized periodontitis Generalized gingivitis Mild/localized gingivitis Subgingival tartar Supragingival tartar Chronic diseases Smoking Mount wash usage Common tooth brush Tap water
H1 ST1 21 F U – – – – – CD N N N N
H2 ST1 33 F U – – – – – RA N N N Y
H3 ST1 20 F U – – – – – N N N N N
H4 ST1 21 F U – – – – – N N N N Y
H5 ST1 21 F U – – – – – N N N N N
H6 ST2 21 F U – – – – – N N N N N
H7 ST2 22 F U – – – – – N N N N Y
H8 ST2 21 F U – – – – – N N N N Y
Open in a new tab

F: female, M: male, Y: yes, N: no, U: university, CD: cardiac disease, and RA: rheumatoid arthritis.

Discussion

A total of 19 participants (19/94, 20.2%) were found positive for E. gingivalis by using molecular techniques. In detail, the positivity rates of E. gingivalis were found to be 30.5% (11/36) in patients with dental disease and 13.8% (8/58) in healthy individuals. There is no significant association between demographics such as age, gender, educational status, income levels, and some lifestyle habits such as using tap water, mouthwash, and tobacco (P > .05). However, Arpağ and Kaya (2020) found a significant association between the presence of E. gingivalis and demographic data including gender, education status, frequency of dental visits, and brushing frequency (Arpağ and Kaya 2020). Additionally, another study reported a higher prevalence of E. gingivalis among individuals aged 45 years and above (Badri et al. 2021). Considering the age, the discrepancy in the results from different reports may be due to the difference in the average age of the participants. On the other hand, a significant correlation was found between the presence of E. gingivalis (30.5%, 11/36) and dental diseases (P = .02) in this study. Our findings align with previous studies that reported the detection of E. gingivalis in 29% and T. tenax in 2% of patients with gingivitis or periodontitis (Bardak et al. 1998). Similarly, another study investigating the density of E. gingivalis and T. tenax in microbial dental plaque found that 34.7% of the samples harbored E. gingivalis, while only 1.2% had T. tenax (Çeliksöz et al. 2001).

In the initial investigations conducted in the Eastern Anatolia area, the prevalence of E. gingivalis was determined to be 23.3% (Hakgüdener et al. 1998). Additionally, in another report involving 220 patients, the detection of E. gingivalis and/or T. tenax was found in 26.4% of the patients, with E. gingivalis identified in 21.8% of the cases and both E. gingivalis and T. tenax detected in 3.6% of the cases (Özçelık et al. 2010). In a study from the Aegean region, in 46 samples (33 with periodontal disease, 13 healthy subjects) in seven (19.44%) samples E. gingivalis was detected (Abualqomsaan et al. 2010). A previous study from Central Anatolia has reported that 60 (34.2%) out of 175 patients were found to be positive solely for E. gingivalis (Yazar et al. 2016). There was no presence of parasite around the healthy implants though out of 101 peri-implantitis lesions, 31 (30.7%) of them was found E. gingivalis positive. These results support the consistency of our findings concerning the presence and prevalence of E. gingivalis in patients with dental diseases and healthy participants.

At least two molecular subtypes of E. gingivalis have been described as ST1 and ST2 and both subtypes can be found in healthy people as commensal microorganisms (Garcia et al. 2018b, Rahdar et al. 2019, Bao et al. 2020). Although E. gingivalis is considered associated with periodontal diseases, subtypes are not shown to have any particular differences in demographics, geographic, or clinical properties (Stensvold et al. 2021).

In our study, the majority of the samples (12 out of 19) were categorized as ST1, while seven were identified as ST2. As in previous studies, no correlation was observed between the molecular subtypes and specific characteristics. According to a recent study, the frequency of detection of E. gingivalis (ST1 or ST2) in subgingival biofilm samples taken from periodontal pockets of patients was 88.3%, higher than previous studies using molecular methods. In addition, E. gingivalis was found to be significantly higher in pathological regions compared to healthy regions of control or periodontitis patients (Dubar et al. 2020). While one of the previous reports claimed that the prevalence of the ST2 subtype was significantly increased in the case of the patients undergoing orthodontic treatment (Garcia et al. 2018b), the ST2 variant was observed less frequently than ST1 in pathological regions (Dubar et al. 2020).

In conclusion, this study utilized molecular techniques to detect the presence of E. gingivalis in healthy individuals and patients with dental diseases, identifying two distinct subtypes (ST1 and ST2), marking the first study in Turkey to perform such molecular characterization. Further research is necessary with a larger sample size to determine the biological significance of these E. gingivalis subtypes.

Consent to participate

An informed consent that explained the purposes, benefits, and risks of the study was signed by all participants.

Contributor Information

Serra Örsten, Hacettepe University, Vocational School of Health Services, Adnan Saygun Street, Ankara, Turkey.

Cem Şahin, Hacettepe University, Vocational School of Health Services, Adnan Saygun Street, Ankara, Turkey; Hacettepe University, Hacettepe Beytepe Hospital, Ankara, Turkey.

Engin Yılmaz, Hacettepe University, Faculty of Medicine, Department of Medical Biology, Ankara, Turkey.

Yakut Akyön, Hacettepe University, Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey.

Authors’ contributions

All authors read and approved the final manuscript. Serra Örsten (Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Writing – original draft), Cem Şahin (Data curation, Formal analysis, Investigation, Methodology, Writing – review & editing), Engin Yılmaz (Formal analysis, Methodology, Supervision, Writing – review & editing), and Yakut Akyön (Conceptualization, Supervision, Writing – review & editing)

Ethics approval

Ethical approval for the study was granted by the ethics committee of Hacettepe University, Ankara, Turkey (GO 21/241). Informed consent from all participants were obtained.

Consent for publication

None applicable.

Conflict of interest statement

The authors report no conflicts of interest in this work.

Funding

This work was supported by the Hacettepe University Scientific Research Projects Coordination Unit (grant number: THD-2021–19 344).

Availability of data and material

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

  1. Abualqomsaan M, Ozensoy Töz S, Yolasiğmaz Aet al. [The investigation of Entamoeba gingivalis and Trichomonas tenax in a group of patients with periodontal disease]. Turkiye Parazitol Derg. 2010;34:91–4. [PubMed] [Google Scholar]
  2. Arpağ OF, Kaya ÖM. Presence of Trichomonas tenax and Entamoeba gingivalis in peri-implantitis lesions. Quintessence Int. 2020;51:212–18. [DOI] [PubMed] [Google Scholar]
  3. Badri M, Olfatifar M, Abdoli Aet al. Current global status and the epidemiology of Entamoeba gingivalis in humans: a systematic review and meta-analysis. Acta Parasitol. 2021;66:1102–13. [DOI] [PubMed] [Google Scholar]
  4. Bao X, Wiehe R, Dommisch Het al. Entamoeba gingivalis causes oral inflammation and tissue destruction. J Dent Res. 2020;99:561–67. [DOI] [PubMed] [Google Scholar]
  5. Bardak T, Üner A, Tappeh KHet al. Gingivitis ve periodontitisli hastalarda Entamoeba gingivalis ve Trichomonas tenax yaygınlığının araştırılması. Türkiye Parazitol Dergisi. 1998;22:251–54. [Google Scholar]
  6. Bonner M, Amard V, Bar-Pinatel Cet al. Detection of the amoeba Entamoeba gingivalis in periodontal pockets. Parasite. 2014;21:30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boufana B, Lahmar S, Rebaï Wet al. Genetic variability and haplotypes of Echinococcus isolates from Tunisia. Trans R Soc Trop Med Hyg. 2014;108:706–14. [DOI] [PubMed] [Google Scholar]
  8. Çeliksöz A, Marakoğlu İ, Gürsoy Ket al. Mikrobiyal dental plakta Entamoeba gingivalis ve Trichomonas tenax araştırılması. İnfeksiyon Dergisi. 2001;15:51–56. [Google Scholar]
  9. Deng Z-L, Szafrański SP, Jarek Met al. Dysbiosis in chronic periodontitis: key microbial players and interactions with the human host. Sci Rep. 2017;7:3703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Deo P, Deshmukh R. Oral microbiome: unveiling the fundamentals. J Oral Maxillofac Pathol. 2019;23:122–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dewhirst FE, Chen T, Izard Jet al. The human oral microbiome. J Bacteriol. 2010;192:5002–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dubar M, Zaffino M-L, Remen Tet al. Protozoans in subgingival biofilm: clinical and bacterial associated factors and impact of scaling and root planing treatment. J Oral Microbiol. 2020;12:1693222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Garcia G, Ramos F, Maldonado Jet al. Prevalence of two Entamoeba gingivalis ST1 and ST2-kamaktli subtypes in the human oral cavity under various conditions. Parasitol Res. 2018b;117:2941–48. [DOI] [PubMed] [Google Scholar]
  14. García G, Ramos F, Martínez-Hernández Fet al. A new subtype of Entamoeba gingivalis: “E. gingivalis ST2, kamaktli variant. Parasitol Res. 2018a;117:1277–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ghabanchi J, Zibaei M, Afkar Met al. Prevalence of oral Entamoeba gingivalis and Trichomonas tenax in patients with periodontal disease and healthy population in Shiraz, southern Iran. Indian J Dent Res. 2010;21:89–91. [DOI] [PubMed] [Google Scholar]
  16. Hakgüdener Y, Özçelik S, Saygı Get al. The prevalence of Entamoeba gingivalis in the human saliva. CÜ Tıp Fak Derg. 1998;18:7–8. [Google Scholar]
  17. Hassan SS, Madkour GG, Henin RWet al. Is Entamoeba gingivalis a risk factor for periodontal diseases? A case-control study. Perio J. 2019;3:18–28. [Google Scholar]
  18. Lamont RJ, Koo H, Hajishengallis G. The oral microbiota: dynamic communities and host interactions. Nat Rev Microbiol. 2018;16:745–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Larkin MA, Blackshields G, Brown NPet al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–8. [DOI] [PubMed] [Google Scholar]
  20. Lourenço TGB, Heller D, Silva-Boghossian CMet al. Microbial signature profiles of periodontally healthy and diseased patients. J Clin Periodontol. 2014;41:1027–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Martin-Garcia DF, et al. Parasites in periodontal health and disease: a systematic review and meta-analysis. Adv Exp Med Biol. 2022;1373:95–111. [DOI] [PubMed] [Google Scholar]
  22. Negrini TDC, Carlos IZ, Duque Cet al. Interplay among the oral microbiome, oral cavity conditions, the host immune response, diabetes mellitus, and its associated-risk factors-an overview. Front Oral Health. 2021;2:697428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ozcelik S, Gedik T, Gedik Ret al. [Investigation of the relationship between oral and dental health and presence of Entamoeba gingivalis and Trichomonas tenax]. Turkiye Parazitol Derg. 2010;34:155–9. [DOI] [PubMed] [Google Scholar]
  24. Peters BA, Wu J, Hayes RBet al. The oral fungal mycobiome: characteristics and relation to periodontitis in a pilot study. BMC Microbiol. 2017;17:157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rahdar M, Abolfazli-Karizi S, Pedram H. The comparison of Entamoeba gingivalis presence in healthy and periodontitis patients by using direct examination and PCR methods. Jundishapur J Health Sci. 2019;11:e86066. [Google Scholar]
  26. Salzburger W, Ewing GB, Von Haeseler A. The performance of phylogenetic algorithms in estimating haplotype genealogies with migration. Mol Ecol. 2011;20:1952–63. [DOI] [PubMed] [Google Scholar]
  27. Santos JO, Roldán WH. Entamoeba gingivalis and Trichomonas tenax: protozoa parasites living in the mouth. Arch Oral Biol. 2023;147:105631. [DOI] [PubMed] [Google Scholar]
  28. Stensvold CR, Nielsen M, Baraka Vet al. Entamoeba gingivalis: epidemiology, genetic diversity and association with oral microbiota signatures in North Eastern Tanzania. J Oral Microbiol. 2021;13:1924598. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Takeshita T, Kageyama S, Furuta Met al. Bacterial diversity in saliva and oral health-related conditions: the Hisayama Study. Sci Rep. 2016;6:22164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tamura K, Peterson D, Peterson Net al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Trim RD, Skinner MA, Farone MBet al. Use of PCR to detect Entamoeba gingivalis in diseased gingival pockets and demonstrate its absence in healthy gingival sites. Parasitol Res. 2011;109:857–64. [DOI] [PubMed] [Google Scholar]
  32. Verweij JJ, Polderman AM, Clark CG. Genetic variation among Human isolates of uninucleated cyst-producing entamoeba species. J Clin Microbiol. 2001;39:1644–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Yaseen A, Mahafzah A, Dababseh Det al. Oral colonization by Entamoeba gingivalis and Trichomonas tenax: a PCR-based study in health, gingivitis, and periodontitis. Front Cell Infect Microbiol. 2021;11:782805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yazar S, Cetinkaya U, Hamamci Bet al. Investigation of Entamoeba gingivalis and Trichomonas tenax in periodontitis or gingivitis patients in Kayseri. Turkiye Parazitol Derg. 2016;40:17–21. [DOI] [PubMed] [Google Scholar]
  35. Zhang Y, Wang X, Li Het al. Human oral microbiota and its modulation for oral health. Biomed Pharmacother. 2018;99:883–93. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Articles from Pathogens and Disease are provided here courtesy of Oxford University Press

RESOURCES