Abstract
What is already known about this topic?
Although ticks and tick-borne diseases are prevalent throughout China, there remains a knowledge gap regarding their biology and potential risk of distribution to human and animal populations on Chongming Island. The island, being China’s third largest and a crucial component in the ecological preservation of the Yangtze Delta region, has yet to be comprehensively studied in this context.
What is added by this report?
In this study, employing molecular methodologies, a significant prevalence of Haemaphysalis (H.) longicornis and H. flava ticks — widely recognized for their high pathogenicity — is reported from Chongming Island. Additionally, the identification of two previously unreported species on the island, namely, H. doenitzi and H. japonica, expands our understanding of both the range and evolution of tick species.
What are the implications for public health practice?
The populations of humans and animals in nearly all 18 towns on Chongming Island are potentially at risk for transmission of tick-borne infectious agents. As a result, there is a pressing necessity for public health alerts, proactive tick surveillance, and effective screening of suspected clinical cases of tick-borne diseases within the Chongming population.
Keywords: Molecular characterization, Haemaphysalis ticks, Transmission risk, Chongming Island
Ticks pose significant risks to human and animal health due to their capability of transmitting various pathogens, such as viruses, bacteria, and protozoans (1-2). To address this global health issue, the Chongming-based Center for One Health research was established on Chongming Island, China’s third largest island and a crucial component in the ecological preservation of the Yangtze Delta region (3). The presence of ticks, including Haemaphysalis (H.) longicornis and H. flava, was previously confirmed in Dongping Forest Park and Dongtan Park on Chongming Island (4). Nonetheless, the potential risk ticks pose to human and animal populations on the island, along with their evolutionary impacts, remains unexplored.
In the course of 2021 to 2022, we conducted and identified ticks from Chongming Island utilizing 12S rRNA and co1 genes. We not only discovered an elevated prevalence of H. longicornis and H. flava on the island but also identified for the first time two additional tick species — H. doenitzi and H. japonica, both of which have been recognized for pathogenic properties and pose a threat to public health. Genetic diversity and neutrality tests suggested that the tick population was expanding or experiencing genetic hitchhiking. Consequently, there is an urgent need for sustained tick surveillance and targeted research on screening tick-borne pathogens and potential clinical cases to inform public health policies and actions.
In this study, ticks were collected from 18 towns and four protected regions on Chongming Island. Within each town, two to three sites were chosen for sample gathering, which was conducted bimonthly over two consecutive days between the hours of 10:00 AM and 4:00 PM from April 2021 to October 2022 (Figure 1). Each sample collection was performed by three collectors and lasted approximately 60±5 minutes.
Figure 1.

Locations on Chongming Island where ticks were collected, 2021–2022.
Ticks were selected from two sources: those parasitizing domestic dogs and wild rabbits and free-living ticks collected from vegetation in parks and grasslands. The latter were sourced from areas in proximity to those parasitizing animals or from other external environments using a flag-dragging method.
After collection, ticks were classified as Haemaphysalis species based on their morphological characteristics as determined by microscopic examination. These characteristics include the shape of their prosthetic base, color, capitulum, conscutum, alloscutum, genital aperture, anal groove, anus, and arrangement on the posterior plate (5-6).
However, this study only distinguished between H. flava and H. longicornis, which were the most significantly represented species. Haemaphysalis species generally have eyeless, ciliated palisade, and rectangular basis capitula. H. longicornis is characterized by an abdomen of palpal segment 3 with a long conical spine and coxa II to IV internal spur, slightly larger and extending beyond the posterior (5). H. flava species possess thick and short abdominal spines on the palpal segment 3. Their coxa II to IV are short and triangular, and the scutum is marked with fine, shallow, evenly distributed engraved points (6). In females, the scutum is suborbicular, while in males, it is ovoid.
Microscopic examinations of ticks are depicted in Supplementary Figure S1 (available in https://weekly.chinacdc.cn/). Following identification, ticks were each individually preserved at −20 °C in 1.5 mL microcentrifuge tubes until further molecular analysis could be conducted.
Molecular identification and characterization were completed using polymerase chain reaction (PCR) amplification and sequencing of the produced amplicons. Genomic DNAs from a collection of 1,417 ticks were subjected to PCR amplification targeting 12S rRNA and col genes and were subsequently sequenced (7) with primer pairs T1B and T2A and CO1-F and CO1-R (Supplementary Table S1, Supplementary Figure S2, available in https://weekly.chinacdc.cn/). Amplification targeting the 12S rRNA locus proved more successful than that targeting the col locus, with success rates of 1,320/1,417 (93.15%) and 1,085/1,417 (76.57%), respectively. This disparity might be attributed to the limitations encountered in obtaining good-quality sequence reads from the col amplicons.
Analysis of 12S rRNA and co1 amplicons sequenced and verified in GenBank revealed that they predominantly belonged to the Haemaphysalis species, with H. flava constituting the majority at 97.11% (1,376/1,417), followed by H. longicornis at 2.61% (37/1,417), H. doenitzi at 0.21% (3/1,417), and H. japonica at 0.07% (1/1,417) (Figure 2A). When an intraspecific identity comparison based on the 12S rRNA gene was conducted, it was found that the ticks exhibited a high degree of identity with homologs from China and globally, with the exception of H. japonica, which presented an 83.48% degree of homology (Figure 2B).
Figure 2.

Molecular identification of ticks from Chongming Island (2021–2022) based on the 12S rRNA gene. (A) Distribution of species derived from Chongming Island. (B) Species confirmed through comprehensive sequence analysis, coupled with intraspecies validation, utilizing multiple alignments of the 12S rRNA gene amplicons.
Abbreviation: H.=Haemaphysalis.
Phylogenetic relationships were ascertained using both the neighbor-joining (NJ) and maximum likelihood (ML) methods. These relationships were established based on the correlation with publicly accessible homologous and orthologous sequences of the 12S rRNA and col genetic loci (Supplementary Table S2, available in https://weekly.chinacdc.cn/). From this examination, a dendrogram for 12S rRNA suggested the existence of four main groups. These included H. japonica and H. concinna in the second cluster, H. doenitzi and H. cornigera in the third, and H. longicornis and H. hystricis in the fourth. Conversely, the first cluster distinctly comprised H. flava (Figure 3A). A comparison of the topological structure between the col and 12S rRNA phylogenetic trees yielded similar results (Figure 3B). Phylogenetic relationships derived from the ML method are available in Supplementary Figure S3 (available in https://weekly.chinacdc.cn/).
Figure 3.

Comparison of genetic and geographical relationships between Haemaphysalis species from Chongming Island, 2021–2022, and those on record in GenBank. (A) Neighbor-joining tree based on 12S rRNA sequences. (B) Neighbor-joining tree based on col sequences.
Note: Percentage values on the tree branches denote bootstrapping values from 1,000 replicates. The identification process for each Haemaphysalis species sequence involved its accession number and geographical location (country). The gene sequences relevant to the species identified in this study are highlighted in blue. For the 12S rRNA and col phylogenetic trees, Argas reflexus and Argas persicus were used as outgroups, respectively. The scale bar signifies nucleotide substitutions per site.
Abbreviation: H.=Haemaphysalis.
Genetic divergences were assessed at various taxonomic levels among tick species, utilizing Kimura’s 2-parameter (K2P) distances based on the 12S rRNA locus (Supplementary Table S2). The highest within-species K2P distance was exhibited by H. japonica (0.0946), while the intraspecific distances for both H. cornigera and H. hystricis were zero. The zero intraspecific distance in these cases infers identical genetic sequences among populations within each species, offering potential insights into population history and overall biodiversity origins. The maximum interspecific K2P distance was identified between H. hystricis and H. japonica (0.1960). Conversely, the smallest interspecific distance of 0.0723 was observed between H. cornigera and H. doenitzi, indicating a potential genetic similarity between these species, as also depicted in the phylogenetic tree. An intermediate genetic distance was found between H. hystricis and H. longicornis (0.0900), comparable to the distance observed between H. flava and H. japonica (0.0903), both of which are in alignment with the phylogenetic topology.
The mapping of K2P genetic distances revealed that H. japonica and H. longicornis maintained notable genetic differentiation compared to other tick species on Chongming Island. In particular, H. japonica presented the highest intraspecific and interspecific K2P distances. Its intraspecific distance, notably, exceeded the lowest interspecific distance (between H. doenitzi and H. cornigera) by 0.0946 (Figure 4A). Collectively, distinct interspecific boundaries were evident in more than 96% of the 12S rRNA fragments examined. We conducted genetic diversity indices and neutrality tests for these tick species using the 12S rRNA locus as a reference (Figure 4B). Among the species examined, the greatest number of polymorphic loci was found in H. japonica (n=56), while H. flava reported the lowest number (n=1). In terms of nucleic acid diversity (Pi), H. japonica was the most diverse (0.08333), while H. doenitzi exhibited the highest haplotype diversity (0.714). Neutral tests signified consistent negative values for Fu and Li’s D and Tajima’s D for the four species, yet they reported positive values for H. concinna. These findings suggest that there has been a recent expansion in global populations of H. longicornis, H. doenitzi, H. flava, and H. japonica ticks, including those based in Chongming.
Figure 4.
Analysis of Kimura’s two-parameter distance, genetic diversity, and neutrality tests for Haemaphysalis ticks collected from Chongming Island, 2021–2022. (A) Plot of the K2P distance of the Haemaphysalis species using NJ-K2P distances. (B) Genetic diversity indices and neutrality tests based on the 12S rRNA gene in the Haemaphysalis species.
Note: The red solid line in panel A represents the minimum interspecific distance between H. cornigera and H. doenitzi.
Abbreviation: n=the number of species; S=the number of polymorphism loci; Pi=nucleic acid diversity; h=haplotype number; Hd=haplotype diversity; H.=Haemaphysalis.
DISCUSSION
The current study identified four tick species on Chongming Island, notably H. flava (97.11%), H. longicornis (2.61%), H. doenitzi (0.21%), and H. japonica (0.07%). This contrasts with a previous study that indicated Rhipicephalus sanguineus and H. longicornis as the main tick species in Shanghai (8). However, our findings indicate that H. flava and H. longicornis represent the majority of ticks on Chongming Island, corroborating recent research conducted in Dongping Forest Park and Dongtan Park on the island (4). Notably, our research newly reports the presence of H. doenitzi and H. japonica from Dongtan Wetland Park and Dongping Forest Park, respectively, a fact not previously documented on the island. H. doenitzi, known as an avian tick, infests birds; thus, its presence on Chongming Island suggests potential for pathogen spillover. The low prevalence rates of H. doenitzi (3/1,417) and H. japonica (1/1,417) could imply their random occurrence and indicate that the likelihood of their detection in previous studies was relatively low. Furthermore, we posit that H. japonica, often referred to as “the northern tick”, may have been introduced to the island via migratory birds breeding annually or increasingly common northern-to-southern trading transportation (3).
H. flava, a tick species, holds significant importance in public health, medical, and veterinary arenas due to its potential to cause lesions, blood loss, weight loss, and, in some cases, death. This species acts as a vector for various pathogens, including Borrelia burgdorferi (9-10), severe fever with thrombocytopenia syndrome virus (11), and tick-borne encephalitis virus (12). An epidemiological investigation on ticks and associated pathogens in pet dogs revealed that H. longicornis (9) was the predominant tick species across 1,140 counties in eastern and northeastern China, exposing over 40% of the population. Notably, a high incidence of H. flava and H. longicornis in 18 towns across Chongming, China, suggests a significant public health threat due to potential transmission risks of tick-borne infectious agents. H. japonica and H. doenitzi are prevalent across several regions in China, including Fujian Province, Yunnan Province, Gansu Province, Hebei Province, and the Inner Mongolia Autonomous Region and Taiwan, China (9), and are known to transmit a range of pathogens. These cause infections such as Lyme borreliosis (10) and babesiosis in humans (13). Despite their low prevalence on Chongming Island, these species also pose a public health threat.
Our study revealed a significant overlap between the intraspecific and interspecific K2P distances in H. japonica. However, clear boundaries for the barcoding gap (ranging from 0.0040 to 0.0723) were observed in other species under observation. The overlap in H. japonica might be attributable to a high count of polymorphic loci (n=56) and considerable diversity (Pi=0.0833) in its 12S rRNA. Furthermore, the 12S rRNA topology indicates that the H. japonica species clusters separately from the other three species, implying that 12S rRNA may not serve as an effective biomarker for its identification. All observed tick species exhibited negative neutrality tests, as evidenced by Fu and Li’s D and Tajima’s D values, which might suggest that the four identified tick species in Chongming may have undergone population expansion or global genetic hitchhiking (14). This could enhance the adaptability of the ticks to environmental variations, extend their distribution, and potentially harbor a greater number of pathogens, escalating their capacity to cross-transfer diseases and intensifying their public health risks.
This study revealed a high prevalence of Haemaphysalis tick distribution on Chongming Island. These findings suggest potential transmission risks of tick-borne infectious agents to both the human and animal populations on the island. Consequently, it is crucial to urgently issue public health warnings, implement active tick surveillance, and efficiently screen suspected tick-borne disease cases within the Chongming population. To address intricate ecological and health challenges, we recommend future research into the epidemiological distribution of tick-borne pathogens on Chongming Island. Such research could expedite the successful application of the One Health approach to public health threats in China.
Conflicts of interest
Xiao-nong Zhou is an editorial board member of the journal China CDC Weekly. He was not involved in the peer-review or handling of the manuscript. The authors have no other competing interests to disclose.
Supporting information
The manuscript and accompanying supplementary file contain all pertinent data. The sequences of both the 12S rRNA and col genes, central to the phylogenetic analysis, have been lodged with the National Center for Biotechnology Information (NCBI). The GenBank accession numbers for these sequences are as follows: for 12S RNA genes — H. flava [OQ674277, OQ674376, OQ674460, OQ676458, OQ676459, OQ674471]; H. longicornis [ON927177, ON938194, ON951654, ON951655, and ON951659]; H. doenitzi [ON954640, ON954644, and ON954853]; H. japonica [ON954855]. For col genes — H. flava [ON954774, ON954780, ON959178, and ON959193-ON959195]; H. longicornis [ON954776].
SUPPLEMENTARY MATERIAL
Figure S1.
Identification of primary ticks (A) H. flava and (B) H. longicornis on Chongming Island, 2021–2022.
Abbreviation: H.=Haemaphysalis.
Table S1. Primer sequences employed for the PCR amplification of mitochondrial genes in ticks.
| Amplification fragment | Primers | Primer sequences | Annealing temperature (°C) | Amplicon size (bp) |
| Abbreviation: bp=base pairs. | ||||
| 12S rRNA | T1B T2A |
AAACTAGGATTAGATACCCT AATGAGAGCGACGGGCGATGT |
51/ 53 | 380 |
| co1 | CO1-F CO1-R |
GGAACAATATATTTAATTTTTGG ATCTATCCCTACTGTAAATATATG |
55 | 650–820 |
Figure S2.
Specific bands of amplified mitochondrial genes were identified through agarose gel electrophoresis. (A) Amplicons of the 12S rRNA gene at approximately 380 base pairs. (B) Amplicons of the co1 gene at approximately 650 base pairs.
Note: In panel A, “M” denotes DNA Marker (DL2000, Takara); “numbered” amplicons of the 12S rRNA gene; “C” denotes negative template control. In panel B, “M” denotes DNA Marker (DL2000, Takara); “numbered” denotes amplicons of co1 gene; “C” denotes negative template control.
Table S2-1. Data on the mitochondrial gene sequences (12S rRNA) utilized for phylogenetic and genetic diversity analysis.
| Species | Geographic localities | GenBank accession No. |
| Abbreviation: H.=Haemaphysalis. | ||
| H. hystricis | Brisbane, Australia | JX573137 |
| Hubei, China | MH510034 | |
| Sichuan, China | MT013253 | |
| Hubei, China | NC_039765 | |
| Taiwan, China | OK054523 | |
| H. cornigera | Wakayama, Japan | MT371802 |
| Guangzhou, China | NC062162 | |
| Guangzhou, China | OM368282 | |
| Guangzhou, China | OM368283 | |
| H. concinna | Heilongjiang, China | KY364906 |
| Heilongjiang, China | NC_034785 | |
| Heilongjiang, China | OM368287 | |
| H. doenitzi | Sichuan, China | JQ346679 |
| Hubei, China | NC_062158 | |
| Sichuan, China | OK054520 | |
| Hubei, China | OM368278 | |
| Shanghai, China | ON954640 | |
| Shanghai, China | ON954644 | |
| Shanghai, China | ON954853 | |
| H. flava | Saitama, Japan | AB075954 |
| Hubei, China | JF758621 | |
| Hubei, China | JQ625665 | |
| Hunan, China | KJ747360 | |
| Hunan, China | MG604958 | |
| Sichuan, China | MT013252 | |
| Taiwan, China | OK054521 | |
| Hubei, China | OM368276 | |
| Shanghai, China | OQ676427 | |
| Shanghai, China | OQ676437 | |
| Shanghai, China | OQ674460 | |
| Shanghai, China | OQ674471 | |
| Shanghai, China | OQ676458 | |
| Shanghai, China | OQ676459 | |
| H. japonica | Heilongjiang, China | MG253031 |
| Heilongjiang, China | NC_037246 | |
| Heilongjiang, China | OM368288 | |
| Shanghai, China | ON954855 | |
| H. longicornis | Hebei, China | MK439888 |
| Sichuan, China | MW642342 | |
| Hunan, China | MW642347 | |
| Anhui, China | MW642348 | |
| Chongqing, China | MW642350 | |
| Okayama, Japan | MW642360 | |
| Shanghai, China | MW642363 | |
| Queensland, Australia | MW642366 | |
| Jiangsu, China | MW642368 | |
| Gansu, China | MW642369 | |
| Shandong, China | MW642384 | |
| Jiangxi, China | MW642385 | |
| H. longicornis | Guangdong, China | MW642389 |
| Yunnan, China | MW642390 | |
| Hubei, China | MW642403 | |
| Jeju, Republic of Korea | MW642405 | |
| South Island, New Zealand | MW642406 | |
| Henan, China | MW642407 | |
| Zhejiang, China | OM368281 | |
| Liaoning, China | OM368286 | |
| Beijing, China | OM368291 | |
| Argas reflexus | U95865.1 | |
Table S2-2. Data on the mitochondrial gene sequences (co1) utilized for phylogenetic and genetic diversity analysis.
| Species | Geographic localities | GenBank accession No. |
| H. hystricis | Wilayah Persekutuan, Malaysia | MK573783 |
| Wilayah Persekutuan, Malaysia | MK573784 | |
| Phangnga, Thailand | MW492261 | |
| Hunan, China | MZ853181 | |
| H. cornigera | Jiangxi, China | MT371802 |
| Jiangxi, China | NC_062162 | |
| Jiangxi, China | OM368282 | |
| Jiangxi, China | OM368283 | |
| H. concinna | Budapest, Hungary | KU170516 |
| Milivojevci-Pozega, Croatia | MZ305517 | |
| Milivojevci-Pozega, Croatia | MZ305518 | |
| Milivojevci-Pozega, Croatia |
MZ305519 |
|
| H. doenitzi | Hubei, China | JF758632 |
| Hubei, China | JQ625688 | |
| Hubei, China | JQ625689 | |
| Henan, China | JQ737097 | |
| Hunan, China | KJ195464 | |
| Hunan, China | KY021804 | |
| Hunan, China | KY021813 | |
| Hunan, China | KY021818 | |
| Hunan, China | MG604958 | |
| Jiangxi, China | MG721052 | |
| Zhejiang, China | MN650208 | |
| Gyeongbuk, Republic of Korea | MN784164 | |
| Sichuan, China | MT013252 | |
| Gyeongbuk, Republic of Korea | MT221453 | |
| Niigata, Japan | MW066344 | |
| Hubei, China | OM368276 | |
| Shanghai, China | KF284075 | |
| Shanghai, China | ON954774 | |
| Shanghai, China | ON954780 | |
| Shanghai, China | ON959178 | |
| Shanghai, China | ON959193 | |
| Shanghai, China | ON959194 | |
| Shanghai, China | ON959195 | |
| H. longicornis | Sichuan, China | JQ346687 |
| Hunan, China | MF666880 | |
| Hunan, China | MF666910 | |
| Hebei, China | MK439888 | |
| Hubei, China | MW642359 | |
| Okayama, Japan | MW642360 | |
| Shanghai, China | MW642363 | |
| New South Wales, Australia | MW642364 | |
| H. longicornis | Queensland, Australia | MW642366 |
| Jiangsu, China | MW642368 | |
| Beijing, China | MW642375 | |
| Shandong, China | MW642384 | |
| Jiangxi, China | MW642385 | |
| Sichuan, China | MW642389 | |
| Yunnan, China | MW642390 | |
| Dalian, China | MW642402 | |
| Hubei, China | MW642403 | |
| New Jersey, the United States | MW642404 | |
| Jeju, Republic of Korea | MW642405 | |
| South Island, New Zealand | MW642406 | |
| Henan, China | MW642407 | |
| Beijing, China | OL335942 | |
| Zhejiang, China | OM368281 | |
| Shanghai, China | ON927177 | |
| Shanghai, China | ON938194 | |
| H. longicornis | Shanghai, China | ON951654 |
| (continued) | Shanghai, China | ON951655 |
| Shanghai, China | ON951659 | |
| Shanghai, China | ON954776 | |
| H. verticalis | Heilongjiang, China | KR108849 |
| Heilongjiang, China | KR108850 | |
| Shandong, China | KY488642 | |
| Shandong, China | KY488644 | |
| Argas persicus | Southwestern Romania | FN394341 |
Figure S3.
Comparison of the genetic and geographical relationships between Haemaphysalis species from Chongming Island, 2021–2022, and those deposited in GenBank. (A) Maximum likelihood tree based on 12S rRNA sequences. (B) Maximum likelihood tree based on co1 sequences.
Note: The relationships among Haemaphysalis species were discerned via analysis of partial 12S rRNA and col gene sequences. The percentages on the branches represent the bootstrap values from 1,000 replications. Each Haemaphysalis species sequence was identified based on its accession number and geographical location (country). Sequences representing the species identified herein are highlighted in blue. Argas reflexus and Argas persicus were utilized as outgroups for 12S rRNA and col phylogenetic trees, respectively. The scale bar symbolizes the rate of nucleotide substitutions per site.
Abbreviation: H.=Haemaphysalis.
Table S3. Average intraspecific and interspecific K2P distances predicated on the 12S rRNA gene in Haemaphysalis species.
| Species | N | H. hystricis | H. cornigera | H. concinna | H. doenitzi | H. flava | H. japonica | H. longicornis |
| Note: Intraspecific distance data are shown in boldface for clarity. The underlined data indicate the highest intraspecific and lowest interspecific distances. Abbreviation: N=number of sequences. H.=Haemaphysalis. * the highest interspecific distance. | ||||||||
| H. hystricis | 5 | 0 | ||||||
| H. cornigera | 4 | 0.1371328831 | 0 | |||||
| H. concinna | 3 | 0.1817426049 | 0.1532318083 | 0.0019841330 | ||||
| H. doenitzi | 4 | 0.1491843529 | 0.0723418465 | 0.1542762170 | 0.0039905820 | |||
| H. flava | 14 | 0.1507102241 | 0.1230000555 | 0.0903495504 | 0.1309744074 | 0.0004275540 | ||
| H. japonica | 4 | 0.196004581* | 0.1529088927 | 0.1368672590 | 0.1728339139 | 0.1235672509 | 0.0945783130 | |
| H. longicornis | 26 | 0.0899835374 | 0.0913522722 | 0.1493494257 | 0.1054751596 | 0.1089099103 | 0.1665811766 | 0.0006666250 |
Funding Statement
Supported by the financial backing of the Science and Technology Innovation Project Fund from the School of Global Health, Shanghai Jiao Tong University School of Medicine (SGHKJCX2021-05, SGHKJCX2021-04) and the International Joint Laboratory on Tropical Diseases Control in Greater Mekong Subregion (21410750200)
Contributor Information
Xiao-nong Zhou, Email: xiao-nong.zhou@sjtu.edu.cn.
Kokouvi Kassegne, Email: kassegnek@sjtu.edu.cn.
References
- 1.Zhao GP, Wang YX, Fan ZW, Ji Y, Liu MJ, Zhang WH, et al. Mapping ticks and tick-borne pathogens in China. Nat Commun 2021;12(1):1075. https://pubmed.ncbi.nlm.nih.gov/33597544/.
- 2.Dantas-Torres F, Chomel BB, Otranto D. Ticks and tick-borne diseases: a One Health perspective. Trends Parasitol 2012;28(10):437-46. https://pubmed.ncbi.nlm.nih.gov/22902521/.
- 3.Tan J, Wang M, Su JH, Ruan JJ, Wang Q Ecological risk assessment of Chongming Eco-Island based on relative risk model. Yangtze River. 2022;53(11):27–34. doi: 10.16232/j.cnki.1001-4179.2022.11.005. [DOI] [Google Scholar]
- 4.Zeng WB, Li ZQ, Wei ZX, Cheng DH, Yang LM, Fang Y, et al. An investigation of questing ticks collected from different habitats in Shanghai, China. Chin J Vector Biol Control 2022;33(6):879-87. http://www.bmsw.net.cn/CN/10.11853/j.issn.1003.8280.2022.06.022. (In Chinese).
- 5.Barker SC, Walker AR Ticks of Australia. The species that infest domestic animals and humans. Zootaxa. 2014;3816(1):1–144. doi: 10.11646/zootaxa.3816.1.1. [DOI] [PubMed] [Google Scholar]
- 6.Walker AR, Bouattour A, Camicas JL, Estrada-Peña A, Horak IG, Latif AA, et al. Ticks of domestic animals in africa: a guide to identification of species. Edinburgh: Bioscience Reports. 2003; pp. 1-227. https://lib.ugent.be/en/catalog/rug01:000802470.
- 7.Abdullah HHAM, El-Shanawany EE, Abdel-Shafy S, Abou-Zeina HAA, Abdel-Rahman EH. Molecular and immunological characterization of Hyalomma dromedarii and Hyalomma excavatum (Acari: Ixodidae) vectors of Q fever in camels. Vet World 2018;11(8):1109-19. https://pubmed.ncbi.nlm.nih.gov/30250371/.
- 8.Meignan M. VI. FDG-PET as a biomarker in lymphoma: from qualitative to quantitative analysis. Hematol Oncol 2015;33 Suppl 1:38-41. https://pubmed.ncbi.nlm.nih.gov/26062052/.
- 9.Cao J, Yang QQ, Zhang JW, Zhou YZ, Zhang HS, Gong HY, et al. Seroprevalence survey of Babesia gibsoni infection and tick species in dogs in East China. Vet Parasitol 2015;214(1-2):12-5. https://pubmed.ncbi.nlm.nih.gov/26483164/.
- 10.Zhang YZ, Xu JG. The emergence and cross species transmission of newly discovered tick-borne Bunyavirus in China. Curr Opin Virol 2016;16:126-31. https://pubmed.ncbi.nlm.nih.gov/26949898/.
- 11.Chen XJ, Yu ZJ, Guo LD, Li LX, Meng H, Wang D, et al. Life cycle of Haemaphysalis doenitzi (Acari: Ixodidae) under laboratory conditions and its phylogeny based on mitochondrial 16S rDNA. Exp Appl Acarol 2012;56(2):143-50. https://pubmed.ncbi.nlm.nih.gov/22113780/.
- 12.Allen T, Murray KA, Zambrana-Torrelio C, Morse SS, Rondinini C, Di Marco M, et al. Global hotspots and correlates of emerging zoonotic diseases. Nat Commun 2017;8(1):1124. https://pubmed.ncbi.nlm.nih.gov/29066781/.
- 13.Liu Q, He B, Huang SY, Wei F, Zhu XQ. Severe fever with thrombocytopenia syndrome, an emerging tick-borne zoonosis. Lancet Infect Dis 2014;14(8):763-72. https://pubmed.ncbi.nlm.nih.gov/24837566/.
- 14.Shen HM, Chen SB, Cui YB, Xu B, Kassegne K, Abe EM, et al. Whole-genome sequencing and analysis of Plasmodium falciparum isolates from China-Myanmar border area. Infect Dis Poverty 2018;7(1):118. https://pubmed.ncbi.nlm.nih.gov/30445995/.






