Mefloquine targets NLRP3 to reduce lipopolysaccharide‐induced systemic inflammation and neural injury

Abstract

The NLR family pyrin domain containing 3 (NLRP3) inflammasome plays an important role in the pathogenesis of a wide variety of human diseases. So far, drugs directly and specifically targeting the NLRP3 inflammasome are not available for clinical use since the safety and efficacy of new compounds are often unclear. A promising approach is thus to identify NLRP3 inhibitors from existing drugs that are already in clinical use. Here, we show that mefloquine, a well‐known antimalarial drug, is a highly selective and potent NLRP3 inhibitor by screening a FDA‐approved drug library. Mechanistically, mefloquine directly binds to the NLRP3 NACHT and LRR domains to prevent NLRP3 inflammasome activation. More importantly, mefloquine treatment attenuates the symptoms of lipopolysaccharide‐induced systemic inflammation and Parkinson's disease‐like neural damage in mice. Our findings identify mefloquine as a potential therapeutic agent for NLRP3‐driven diseases and migth expand its clinical use considerably.

Mefloquine is a highly selective and potent NLRP3 inhibitor. Mefloquine directly binds to the NACHT and LRR domains of NLRP3, impairs inflammasome assembly and reduces NLRP3‐dependent systemic inflammation and neural injury in mice.

Introduction

The NLR family pyrin domain containing 3 (NLRP3) inflammasome is an intracellular protein complex composed of the NOD‐like receptor (NLR) family protein NLRP3, adapter protein ASC, and cysteine protease caspase‐1 (Sharma & Kanneganti, 2021). As an innate immune sensor, NLRP3 inflammasome can be activated by a wide range of danger signals derived from pathogen and the host (Sharif et al, 2019). Upon activation, NLRP3 recruits ASC and pro‐caspase‐1 to assemble the NLRP3 inflammasome, which results in caspase‐1 activation (Paik et al, 2021). Active caspase‐1 cleaves pro‐IL‐1β and pro‐IL‐18 to their mature forms and drives pyroptosis to host defense (Huang et al, 2021). It has been reported that aberrant activation of the NLRP3 inflammasome leads to a spectrum of human inflammatory disorders (Mangan et al, 2018), such as gout (Martinon et al, 2006), chronic liver disease (Frissen et al, 2021), type 2 diabetes (Kim et al, 2020), neurodegenerative diseases (Ising et al, 2019), atherosclerosis (Orecchioni et al, 2022), and inflammatory bowel disease (Zhen & Zhang, 2019). Therefore, NLRP3 has been suggested to be a potential therapeutic target for these diseases.

To develop strategies for treating NLRP3‐driven diseases, several NLRP3 inhibitors have been identified, including 3,4‐methylenedioxy‐β‐nitrostyrene (He et al, 2014), MCC950 (Coll et al, 2019), CY‐09 (Jiang et al, 2017), tranilast (Huang et al, 2018), oridonin (He et al, 2018), and OLT1177 (Lonnemann et al, 2020). However, most of these inhibitors are not available for clinical use due to efficacy and toxicity. Although research on NLRP3 inhibitors is developing rapidly, whether these agents can be used to treat NLRP3‐related diseases in humans remains to be determined (Zahid et al, 2019). Therefore, there is still a need for identifying NLRP3 inhibitors from a FDA‐approved library that have been used in clinical.

Mefloquine is a widely prescribed antimalarial drug and is effective against drug‐resistant plasmodium falciparum in clinical (Drug Ther Bull, 1998). Mechanistically, mefloquine interacts with heme, which inhibits β‐hematin formation, leading to a toxic accumulation of heme by‐product (ferriprotoporphyrin IX) in the parasite's food vacuole (Handschin et al, 1995). Mefloquine is also known as a broad‐spectrum pannexin1 inhibitor. Pharmacological inhibition of pannexin1 channels with mefloquine blocks ictal discharges in human cortical brain tissue slices and might represent an alternative therapeutic strategy for treating lesional and drug‐resistant epilepsies (Dossi et al, 2018). Recently, mefloquine has also been shown promising anticancer (Rodrigues et al, 2014) and anti‐inflammation such as anti‐SARS‐CoV‐2 activities (Sacramento et al, 2022). However, its effects and targets in inflammatory diseases have not been described.

In this study, we identify mefloquine as a potent NLRP3 inhibitor by screening a set of small molecules from an FDA‐approved drug library using molecular docking and surface plasmon resonance (SPR) assays. We show that mefloquine directly binds to the NACHT and LRR domains of NLRP3 to inhibit NLRP3 inflammasome assembly and activation. Mefloquine is effective in mouse models of NLRP3‐associated diseases, such as LPS‐induced systemic inflammation and Parkinson's disease. These findings demonstrate that mefloquine is a potential therapeutic agent for NLRP3‐related diseases.

Results

Screening and identification of potent NLRP3 inhibitors

As an innate immune sensor, the NLPR3 inflammasome is involved in a variety of human inflammatory disorders (Strowig et al, 2012). To provide a potential effective treatment for the NLRP3‐driven diseases, we screened NLRP3 inhibitors in FDA‐approved drug library (Fig 1A). Starting from a virtual library of 2,513 compounds, we identified 10 potential inhibitors (Fig 1B). Then, we performed the SPR assay with recombinant human NLRP3 protein and found five potential compounds that could directly bind to NLRP3 in a dose‐dependent manner (Fig 1C). The NLRP3 inhibitor MCC950 was used as a positive control for NLRP3 inflammasome inhibition. We next studied the inhibitory effect of the selected compounds to identify the most potent NLRP3 inhibitors in a cell‐based system stimulated with representative NLRP3 activator. We found that three compounds significantly reduced NLRP3‐mediated IL‐1β and IL‐18 production and caspase‐1 activation in BMDMs (Fig 1D–F). Among these compounds, DB00358 (mefloquine) showed the best inhibitory activity for NLRP3 inflammasome, which had comparable activity with MCC950 (Fig 1G).

Figure 1. Screening and identification of potent NLRP3 inhibitors.

• A
  Diagram of the experimental design.
• B
  Docking complex of human NLRP3 with indicated compounds.
• C
  SPR assay to evaluate the affinity between indicated compounds and purified human NLRP3 protein.
• D
  LPS‐primed BMDMs were pretreated with various indicated compounds (10 μM) for 30 min and were then stimulated with ATP. Western blot analysis of mature IL‐1β and cleaved caspase‐1 in the supernatants (SN) of BMDMs and of pro‐IL‐1β and pro‐caspase‐1 in the lysates (Input) of BMDMs.
• E, F
  ELISA of IL‐1β (E) and IL‐18 (F) in the SN of BMDMs.
• G
  Mefloquine structure.

Data information: The data are shown as the mean ± SEM. Statistical significance was analyzed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 6 biological replicates, E, F): *P < 0.05, **P < 0.01, ***P < 0.001.

Source data are available online for this figure.

Mefloquine specifically inhibits NLRP3 inflammasome activation

To determine the effects of mefloquine on NLRP3 inflammasome activation, we treated LPS‐primed BMDMs with mefloquine for 30 min and then stimulated the cells with the NLRP3 agonist nigericin. We found that mefloquine concentration‐dependently blocked caspase‐1 activation, GSDMD cleavage, IL‐1β and IL‐18 secretion, and cell death at concentrations of 2.5–10 μM (Fig 2A–D). However, inflammasome‐independent cytokine TNF‐α production was not impaired by mefloquine (Fig 2E). As NLRP3 inflammasome activation can be triggered by a wide range of stimuli, we then investigated the effects of mefloquine on NLRP3 inflammasome activation triggered by other agonist. Our results showed that mefloquine also suppressed IL‐1β and IL‐18 secretion and caspase‐1 cleavage induced by ATP (Fig 2F–H), suggesting that mefloquine is a broad‐spectrum inhibitor of NLRP3 inflammasome. In contrast, mefloquine failed to suppress caspase‐1 activation and IL‐β secretion induced by Flagellin or poly A:T (Fig 2I–P), showing that mefloquine does not inhibit the activation of AIM2 and NLRC4 inflammasome. We also tested whether mefloquine was working for human cells. As expected, NLRP3 inflammasome‐induced caspase‐1 activation, GSDMD cleavage, IL‐18 and IL‐1β secretion, and cell death in human THP‐1 cells could also be suppressed by mefloquine (Fig 2Q–T). Thus, these results indicate that mefloquine specifically blocks NLRP3 inflammasome activation in both murine and human cells.

Figure 2. Mefloquine specifically inhibits NLRP3 inflammasome activation.

• A
  LPS‐primed BMDMs were pretreated with mefloquine at indicated concentrations for 30 min and were then stimulated with nigericin (10 μM). Western blot analysis of cleaved IL‐1β, activated caspase‐1 in culture supernatants (SN) and pro‐IL‐1β, pro‐caspase‐1 and GSDMD cleavage in lysates (Input) of BMDMs.
• B, C
  ELISA of IL‐1β (B) and IL‐18 (C) in the SN of BMDMs.
• D
  LDH release in the SN of BMDMs.
• E
  BMDMs were treated with mefloquine at indicated concentrations for 30 min and then stimulated with LPS for 3 h. ELISA of TNF‐α in the SN of BMDMs.
• F
  LPS‐primed BMDMs were pretreated with mefloquine at indicated concentrations for 30 min and were then stimulated with ATP. Western blot analysis of cleaved IL‐1β, activated caspase‐1 in SN and pro‐IL‐1β, pro‐caspase‐1 in Input of BMDMs.
• G, H
  ELISA of IL‐1β (G) and IL‐18 (H) in the SN of BMDMs.
• I
  PS‐primed BMDMs treated with mefloquine (10 μM) and then stimulated with Flagellin. Western blot analysis of cleaved IL‐1β, activated caspase‐1 in SN and pro‐IL‐1β, pro‐caspase‐1 in Input of BMDMs.
• J, K
  Quantification of activated caspase‐1 (J) and cleaved IL‐1β (K) in (I).
• L
  ELISA of IL‐1β in SN of BMDMs.
• M
  LPS‐primed BMDMs were treated with mefloquine (10 μM) and then stimulated with poly(dA:dT). Western blot analysis of cleaved IL‐1β, activated caspase‐1 in SN and pro‐IL‐1β, pro‐caspase‐1 in Input of BMDMs.
• N, O
  Quantification of activated caspase‐1 (N) and cleaved IL‐1β (O) in (M).
• P
  ELISA of IL‐1β in SN of BMDMs.
• Q
  LPS‐primed THP‐1 cells were pretreated with mefloquine at indicated concentrations for 30 min and then stimulated with nigericin. Western blot analysis of cleaved IL‐1β, activated caspase‐1 in SN and pro‐IL‐1β, pro‐caspase‐1 and GSDMD cleavage in Input of THP‐1 cells.
• R, S
  ELISA of IL‐1β (R) and IL‐18 (S) in the SN of THP‐1 cells.
• T
  LDH release in the SN of THP‐1 cells.

Data information: data are expressed as mean ± SEM. ***P < 0.001, as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 6 biological replicates, B, C, G, H, R, S), and *P < 0.05, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 4 biological replicates, D, T), and the differences are not significant, as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 3 biological replicates, J–L, N–P).

Source data are available online for this figure.

We also examined whether mefloquine had an impact on LPS‐induced priming of inflammasome activation. When BMDMs were stimulated with mefloquine at the doses of 2.5–10 μM before LPS treatment, mefloquine could not suppress LPS‐induced NF‐κB activation, IL‐1β and NLRP3 mRNA expression (Fig EV1), suggesting that mefloquine does not inhibit LPS‐induced priming. These results indicate that mefloquine is a specific inhibitor for NLRP3 activation.

Figure EV1. Mefloquine does not affect LPS‐induced priming for NLRP3 inflammasome activation.

• A
  BMDMs were treated with mefloquine at indicated concentrations for 30 min and then stimulated with LPS for 3 h. Western blot analysis of p‐p65 expression in BMDMs.
• B, C
  qPCR measurement of NLRP3 (B) and IL‐1β (C) mRNA expression in BMDMs.

Data information: data are expressed as mean ± SEM. The differences are not significant, as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (B: n = 4 biological replicates, C: n = 6 biological replicates).

Because mefloquine is an inhibitor for pannexin1, we then examined whether mefloquine inhibited NLRP3 activation via blocking pannexin1. We found that the inhibitory activity of mefloquine on NLRP3 inflammasome activation were not abrogated when pannexin1 was silenced by siRNA in BMDMs (Fig EV2). These results suggest that mefloquine blocks NLRP3 activation in a pannexin1‐independent manner.

Figure EV2. Pannexin1 knockdown does not prevent the inhibitory effects of mefloquine on NLRP3 inflammasome activation.

• A
  BMDMs were transfected with pannexin1 siRNA (si‐pannexin1) for 48 h and then treated with LPS plus nigericin in the absence or the presence of mefloquine (10 μM). Western blot analysis of cleaved IL‐1β, activated caspase‐1 in culture supernatants (SN) and pro‐IL‐1β, pro‐caspase‐1 in lysates (Input) of BMDMs.
• B, C
  ELISA of IL‐1β (B) and IL‐18 (C) in the SN of BMDMs.
• D
  LDH release in the SN of BMDMs.

Data information: data are expressed as mean ± SEM. ***P < 0.001, as assessed by two‐way ANOVA, followed by the Tukey's post hoc test (B, C: n = 6 biological replicates, D: n = 4 biological replicates).

Mefloquine directly binds to NLRP3 to prevent NLRP3 inflammasome assembly

We next investigated the underlying mechanism of mefloquine regulating the NLRP3 inflammasome activation. Potassium efflux has been reported as upstream signaling event of NLRP3 inflammasome activation. To investigate whether mefloquine can impact potassium efflux, we examined intracellular potassium concentration after nigericin stimulation. Our data revealed that nigericin‐induced efflux of potassium was not prevented by mefloquine (Fig EV3A). In addition, mitochondrial reactive oxygen species (ROS) production, which is another upstream signaling event of NLRP3 inflammasome activation (Zhou et al, 2011), was investigated. No significant decrease in ROS production was observed after mefloquine treatment (Fig EV3B and C). These results suggest that mefloquine does not affect the upstream signaling events of NLRP3. We then evaluated the possibility that mefloquine prevented the NLRP3 inflammasome assembly. We first examined the formation of ASC oligomerization. Confocal microscopy showed that mefloquine significantly attenuated ASC oligomerization (Fig 3A), suggesting that mefloquine exerts an inhibitory effect on NLRP3 activation upstream of ASC oligomerization. The interaction between NLRP3 and ASC is essential for the recruitment of ASC to NLRP3 (Li et al, 2021). Consequently, we next investigated whether mefloquine blocked the association between NLRP3 and ASC using an IP assay. ATP stimulation resulted in the association of endogenous NLRP3 and ASC, while mefloquine substantially prevented the ATP–induced NLRP3‐ASC interaction (Fig 3B and C). The NLRP3‐NEK7 interaction is another critical step occurring upstream of NLRP3 oligomerization and ASC recruitment (He et al, 2016). We found that mefloquine also markedly inhibited the endogenous association between NLRP3 and NEK7 (Fig 3D). These results indicate that mefloquine prevent the assembly of the NLRP3 inflammasome by blocking the interaction between NLRP3 and NEK7.

Figure EV3. Mefloquine has no effect on potassium efflux and mitochondrial ROS production.

• A
  Qualification of potassium efflux in LPS‐primed BMDMs treated with mefloquine at indicated concentrations for 30 min and then stimulated with nigericin (10 μM).
• B, C
  Representative images and quantification of mitochondrial ROS levels by flow cytometry in LPS‐primed BMDMs treated with mefloquine (10 μM) for 30 min and then stimulated with ATP.

Data information: data are expressed as mean ± SEM. N = 3 biological replicates, as assessed by one‐way ANOVA, followed by the Tukey's post hoc test.

Figure 3. Mefloquine directly binds to NLRP3 to prevent NLRP3 inflammasome assembly.

• A
  LPS‐primed BMDMs were treated with mefloquine (10 μM) and then stimulated with ATP. BMDMs were stained for ASC (green). Nuclei were stained with DAPI (blue). White arrows show example of ASC specks formed. Scale bar: 50 μm.
• B
  LPS‐primed BMDMs were treated with mefloquine (10 μM) and then stimulated with ATP. Endogenous immunoprecipitation (IP) and western blot analysis to evaluate the NLRP3‐ASC interaction or NLRP3‐NEK7 interaction.
• C, D
  Quantification of NLRP3‐ASC interaction (C) or NLRP3‐NEK7 interaction (D) in (B).
• E
  Cell lysates of LPS‐primed BMDMs were incubated with Bio‐Mef (10 μM) for 2 h, which were then pulled down using streptavidin beads. The total proteins (input) and bound proteins (PD) were immunoblotted as indicated.
• F, G
  Flag‐tagged human NLRP3, AIM2, or NLRC4 (F), NLPR3‐NACHT, NLRP3‐PYD, NLRP3‐LRR plasmids or empty vector (EV) (G) were expressed in HEK‐293T cells. The HEK‐293T cell lysates were incubated with bio‐Mef (10 μM) and then were pulled down using streptavidin beads.
• H
  Docking complex of human NLRP3 protein with mefloquine.

Data information: data are expressed as mean ± SEM. **P < 0.01, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 3 biological replicates, C, D).

Source data are available online for this figure.

Pull‐down assay was further performed to determine whether mefloquine directly targets NLRP3 or NEK7. As shown in Fig 3E, NLRP3, but not NEK7, ASC or procaspase‐1, was pulled down by a synthesized biotinylated mefloquine (bio‐Mef), suggesting that mefloquine specifically binds to NLRP3. We also investigated the interaction between mefloquine and other inflammasome sensors and found that only NLRP3 could be pulled down by bio‐Mef, while other sensors, such as AIM2 and NLRC4 could not (Fig 3F). NLRP3 contains three functional domains: LRR, NACHT, and PYD. We then studied which domain was responsible for the binding between NLRP3 and mefloquine, and the results showed that NACHT and LRR domain of NLRP3 could be pulled down by bio‐Mef, while PYD domain of NLRP3 could not (Fig 3G). These results indicate that mefloquine directly binds to the NACHT and LRR domain of NLRP3. Molecular modeling analysis of the crystal structure of dimeric human NLRP3 showed that mefloquine was readily docked into its NACHT domain (Fig 3H). Mefloquine bound to the hydrophobic groove that was composed of hydrophobic residues, including Pro⁴¹⁰, Gly²²⁷, Ile²³², Lys²³⁰, Thr²³¹, His⁵²⁰, Ile⁵¹⁹, and Glu¹⁵⁰. Thus, these results suggest that mefloquine may bind to the ATP‐binding site of NLRP3 and then inhibit NLRP3 activation.

Mefloquine alleviates LPS‐induced peripheral inflammation injury by targeting NLRP3

We assessed the in vivo suppressive effects of mefloquine on the NLRP3 inflammasome using a LPS‐induced inflammation model, a well‐characterized model of NLRP3‐driven inflammation (Xu et al, 2021). Mefloquine treatment efficiently decreased the IL‐1β and IL‐18 level in serum in a dose‐dependent manner (Fig 4A and B). However, mefloquine failed to affect the inflammasome‐independent TNF‐α level in serum (Fig 4C). These data suggest that mefloquine can block NLRP3 inflammasome activation in vivo. The AST and ALT levels in blood, the markers of liver injury, were also decreased by mefloquine (Fig 4D and E). In addition, histologic examination showed that neutrophil infiltration in the liver tissues was also reduced by mefloquine (Fig 4F). As expected, NLRP3‐dependent ASC oligomerization in the liver was impaired by mefloquine treatment (Fig 4G). The caspase‐1 activation, GSDMD cleavage, IL‐1β and IL‐18 production observed in liver of LPS‐treated mice were also suppressed by mefloquine (Fig 4H–K). More importantly, we further validated the therapeutic effectiveness of mefloquine in mice after LPS stimulation (Fig EV4A). We found that mefloquine treatment efficiently decreased the serum levels of IL‐1β and IL‐18 levels in a dose‐dependent manner, reduced the levels of AST and ALT in serum, and inhibited the caspase‐1 cleavage and IL‐1β and IL‐18 production in liver (Fig EV4B–H). These data suggest that mefloquine alleviates LPS‐induced liver injury via inhibition of NLRP3 inflammasome activation in vivo. Subsequently, Nlrp3 knockout mice were used to further validate this hypothesis. We found that mefloquine reduced the levels of IL‐1β, AST, and ALT in serum and alleviated the LPS‐induced morphological damage of liver and spleen in wild‐type mice. However, the therapeutic effects of mefloquine on LPS‐induced liver and spleen injury were not observed in Nlrp3 knockout mice (Fig 4L‐Q). These findings indicate that mefloquine can target NLRP3 to treat LPS‐induced inflammation injury.

Figure 4. Mefloquine alleviates LPS‐induced peripheral inflammation injury by blocking NLRP3‐dependent‐inflammation.

• A–E
  Mice were pretreated with Mef (5, 20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg) for 12 h. ELISA of IL‐1β (A), IL‐18 (B), TNF‐α (C), ALT (D) or AST (E) in serum of mice.
• F
  Representative H&E staining of liver sections of mice. Black arrows show example of neutrophil infiltrations. Scale bar: 200 μm (above), Scale bar: 100 μm (below).
• G
  Representative ASC specks staining (green) of liver sections of mice. Nuclei were stained with DAPI (blue). Scale bar: 500 μm.
• H
  Western blot analysis of cleaved IL‐1β, activated caspase‐1, and GSDMD cleavage in liver of mice.
• I, J
  Quantification of caspase‐1 (I) and IL‐1β (J) in (H).
• K
  ELISA of IL‐18 in liver of mice.
• L–O
  Nlrp3^+/+ and Nlrp3^−/− mice were pretreated with Mef (20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg). ELISA of IL‐1β (L), TNF‐α (M), ALT (N) or AST (O) in serum of mice.
• P
  Sections of paraffin‐embedded liver tissues were stained with H&E. Black arrows show example of neutrophil infiltrations. Scale bar: 50 μm.
• Q
  Sections of paraffin‐embedded spleen tissues were stained with H&E. White arrows show example of congestion and swelling. Scale bar: 100 μm.

Data information: data are expressed as mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (A–E, K, n = 6 animals/group), (I, J, n = 4 animals/group), and ***P < 0.001 as assessed by two‐way ANOVA, followed by the Tukey's post hoc test (L–O, n = 6 animals/group).

Source data are available online for this figure.

Figure EV4. Mefloquine alleviates LPS‐induced liver injury by blocking NLRP3‐dependent‐inflammation.

• A
  Mice were intraperitoneally injected with LPS (20 mg/kg) and then treated with Mef (5, 20 mg/kg, i.p) for 12 h. Diagram of the experimental design.
• B–E
  ELISA of IL‐1β (B), IL‐18 (C), ALT (D) or AST (E) in the serum of mice.
• F
  Western blot analysis of caspase‐1 cleavage in liver of mice.
• G, H
  ELISA of IL‐1β (G) and IL‐18 (H) in liver of mice.

Data information: data are expressed as mean ± SEM, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (B–E, G, H, n = 6 animals/group).

Mefloquine relieves LPS‐induced brain inflammation by acting as a direct NLRP3 inhibitor

LPS activates the inflammatory response in the periphery and in the brain (Shavit Stein et al, 2018). To investigate the effects of mefloquine on LPS‐induced brain inflammation, we first evaluated whether mefloquine could cross the blood–brain barrier using UPLC–MS. Excitedly, we found that mefloquine was detectable in brain tissue at 6, 12 and 48 h after intraperitoneal injection of 20 mg/kg (Fig 5A–C), indicating that mefloquine can cross the blood–brain barrier. We next assessed the effects of mefloquine on behaviors in mice after LPS stimulation (Fig 5D). We found that mefloquine significantly improved LPS‐induced sickness behaviors in mice (Fig 5E). Furthermore, mefloquine markedly inhibited LPS‐induced caspase‐1 activation, GSDMD cleavage, IL‐18 and IL‐1β production in the midbrain (Fig 5F–I), striatum (Fig 5J–M), hippocampus (Fig EV5A–C) and prefrontal cortex (Fig EV5D–F), indicating that mefloquine suppresses NLRP3 inflammasome activation in the brain. Microglia, the brain resident macrophage cells, are the first and main form of active immune defense in the brain (Wang et al, 2020). We then investigated whether mefloquine inhibited the activation of microglia. As shown in Fig 5N–P, mefloquine significantly suppressed the activation of microglia and reduced the level of IL‐1β in midbrain and striatum in wild‐type mice, but not in Nlrp3 knockout mice. Similar results were observed in hippocampus and prefrontal cortex (Fig EV5G–I). These results demonstrate that mefloquine alleviates LPS‐induced brain inflammation in mice by acting as a direct NLRP3 inhibitor.

Figure 5. Mefloquine relieves LPS‐induced brain inflammation by inhibiting NLRP3 inflammasome activation.

• A–C
  Mice were intraperitoneally injected 20 mg/kg Mef for 6, 12 or 48 h. Representative peak diagram (A) and quantification of Mef in plasma (B) and brain (C) by UPLC‐MS analysis.
• D
  Mice were pretreated with Mef (5, 20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg). Diagram of the experimental design.
• E
  Movement distance within 5 min was recorded by open‐field test in mice.
• F
  Western blot analysis of caspase‐1 activation and GSDMD cleavage in the midbrain of mice.
• G
  Quantification of caspase‐1 in (F).
• H, I
  ELISA of IL‐1β (H) and IL‐18 (I) in the midbrain of mice.
• J
  Western blot analysis of caspase‐1 activation and GSDMD cleavage in the striatum of mice.
• K
  Quantification of caspase‐1 in (J).
• L, M
  ELISA of IL‐1β (H) and IL‐18 (I) in the striatum of mice.
• N
  Nlrp3^+/+ and Nlrp3^−/− mice were pretreated with Mef (20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg) for 12 h. Microphotographs of IBA‐1‐positive microglia (red) in the midbrain and striatum. Nuclei were stained with DAPI (blue). Scale bar: 200 μm.
• O, P
  ELISA of IL‐1β in the midbrain (O) and striatum (P).

Data information: data are expressed as mean ± SEM, n = 3 animals/group (B, C), *P < 0.05, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (E, H, I, L, M, n = 6 animals/group), (G, K, n = 4 animals/group), and ***P < 0.001 as assessed by two‐way ANOVA, followed by the Tukey's post hoc test (O, P, n = 6 animals/group).

Source data are available online for this figure.

Figure EV5. Mefloquine relieves LPS‐induced neuroinflammation via inhibition of NLRP3 inflammasome activation in hippocampus and prefrontal cortex.

• A
  Mice were pretreated with Mef (5, 20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg) for 12 h. Western blot analysis of caspase‐1 activation in the hippocampus of mice.
• B
  Quantification of caspase‐1 in (A).
• C
  ELISA of IL‐1β in the hippocampus of mice.
• D
  Western blot analysis of caspase‐1 activation in the prefrontal cortex of mice.
• E
  Quantification of caspase‐1 in (D).
• F
  ELISA of IL‐1β in the prefrontal cortex of mice.
• G
  Nlrp3^+/+ and Nlrp3^−/− mice were pretreated with Mef (20 mg/kg, i.p) daily for 3 days and then intraperitoneally injected with LPS (20 mg/kg) for 12 h. Microphotographs of IBA‐1‐positive microglia (red) in the hippocampus and prefrontal cortex. Nuclei were stained with DAPI (blue). Scale bar: 200 μm.
• H, I
  ELISA of IL‐1β in hippocampus (H) and prefrontal cortex (I).

Data information: data are expressed as mean ± SEM, *P < 0.05, ***P < 0.001 as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (B, E, n = 3 animals/group), (C, F, n = 6 animals/group), and ***P < 0.001 as assessed by two‐way ANOVA, followed by the Tukey's post hoc test (H, I, n = 5–6 animals/group).

Mefloquine ameliorates PD‐like pathology in an LPS‐induced PD model by blocking NLRP3 inflammasome activation

In addition to acute inflammation, NLRP3 inflammasome has been regarded as an important contributor for the chronic inflammation‐associated complex diseases such as PD (Haque et al, 2020). We then tested whether mefloquine treatment was effective in reversing PD‐like pathology in PD mice (Fig 6A). As expected, mefloquine significantly improved the behavioral deficits in PD mice as measured by the rotarod test and the pole test (Fig 6B–D). LPS injection led to a significant loss of TH in the substantia nigra pars compacta (SNc), which was prevented by mefloquine treatment (Fig 6E and F). Western blot analysis revealed that LPS decreased TH protein expression in the SNc, which was also restored by mefloquine (Fig 6G and H). We next determined whether mefloquine inhibited NLRP3‐dependent inflammation in PD. Double immunostaining analysis showed that mefloquine significantly reduced the number of microglia and inhibited NLRP3‐mediated caspase‐1 activation in microglia in PD mice (Fig 6I–K). Furthermore, mefloquine prevented LPS‐induced caspase 1 activation, GSDMD cleavage, IL‐18, and IL‐1β production in the SNc (Fig 6L–P). These data indicate that mefloquine rescues LPS‐induced PD like pathology in mice by blocking NLRP3 inflammasome activation.

Figure 6. Mefloquine ameliorates PD‐like pathology in an LPS‐induced PD model by blocking NLRP3 inflammasome activation.

• A
  One hour after stereotaxic injection of LPS, mice were injected intraperitoneally with mefloquine (5, 20 mg/kg) or vehicle once a day for 1 week. Diagram of the experimental design.
• B, C
  The time taken to descend a pole (Time‐total) and turn around (Time‐turn) was recorded in pole test in mice.
• D
  Time on the rod was measured in the rotarod test in mice.
• E
  Microphotographs of Tyrosine hydroxylase (TH)‐positive neurons in the SNc of mice. Scale bar: 200 μm.
• F
  Stereological counts of TH‐positive neurons in the SNc.
• G, H
  Representative immunoblots (G) and quantification of relative expression of TH (H) in the SNc.
• I
  Representative double‐immunostaining for caspase‐1 p10 (green) and microglial marker IBA‐1 (red) in the SNc. DAPI stains nucleus (blue). Scale bar: 20 μm. White arrowheads show examples of IBA‐1⁺ caspase‐1⁺ cells.
• J
  Quantification of IBA‐1‐positive microglia in the SNc.
• K
  Quantification of the percentage of IBA‐1 positive cells that are caspase‐1 p10 positive in the SNc.
• L–N
  Representative immunoblots (L) and quantification of caspase‐1 activation (M) and GSDMD cleavage (N) in the SNc.
• O, P
  ELISA of IL‐1β (O) and IL‐18 (P) in the SNc.

Data information: data are expressed as mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001, as assessed by one‐way ANOVA, followed by the Tukey's post hoc test (n = 8 animals/group, B–D), (n = 6 animals/group, F, O, P), (n = 3–4 animals/group, H, M, N), and (n = 6–8 animals/group, J, K).

Source data are available online for this figure.

Discussion

In this study, we report that mefloquine, an antimalarial drug currently in clinical, can strongly inhibit NLRP3 inflammasome activation and is effective in the treatment of NLRP3‐driven diseases in mouse models. This finding may provide new therapeutic approaches for NLRP3‐driven diseases and suggest that mefloquine is a versatile drug that can be used in the treatment of inflammatory diseases in addition to malaria and expands its new clinical use.

NLRP3 is currently the best‐studied member of the NLR family due to its extensive involvement in peripheral metabolism diseases (Mortimer et al, 2016; Booshehri & Hoffman, 2019) and its implication in several neurodegenerative conditions in the brain (Hooftman et al, 2020; Milner et al, 2021). NLRP3 inflammasome inhibition can be achieved by indirectly regulating upstream or downstream signaling events (Yu et al, 2017) or by directly targeting NLRP3 inflammasome components (Dekker et al, 2021). Several NLRP3 inflammasome inhibitors have been reported including sulforaphane (Kiser et al, 2021), β‐hydroxybutyrate (Youm et al, 2015) and MCC950 (Coll et al, 2015). However, most of these inhibitors are not available for clinical use due to efficacy and safety (Yang et al, 2019). Therefore, the overarching goal of this study was to screen NLRP3 inflammasome inhibitors from the 2,513 marketed drugs in clinical by a virtual screening, SPR assay, the subsequent validation of the effectiveness in vitro and in vivo. Among the tested compounds, mefloquine is the most promising.

Mefloquine has been described to exert anti‐inflammatory effects by inhibiting the neutrophil iodination reaction (Bates & Ferrante, 1988). Mefloquine might be warranted for treatment of progressive multifocal leukoencephalopathy in HIV‐infected patients (Adachi et al, 2012). Here, we show that mefloquine is a direct and specific NLRP3 inhibitor. The first evidence to support this hypothesis is that mefloquine inhibits NLRP3 inflammasome‐dependent Il‐1β secretion, but does not affect inflammasome‐independent TNF‐α production. Another piece of evidence substantiating this notion is that mefloquine selectively suppresses the NLRP3 inflammasome activation, but not other inflammasomes, including NLRC4 and AIM2. Third, we demonstrate that mefloquine fails to reduce mitochondrial ROS production and potassium efflux, which have been proposed as upstream signaling events of NLRP3 activation, suggesting that mefloquine does not affect the upstream signaling events of NLRP3. Fourth, we find that mefloquine has no significant impact on LPS‐induced priming for NLRP3 inflammasome. Fifth, mefloquine is reported to be a pannexin1 inhibitor. But, we find that mefloquine inhibits NLRP3 inflammasome activation in a pannexin1‐independent manner. Finally and most importantly, we show that mefloquine directly binds to NACHT and LRR domain of NLRP3. This binding might trigger a conformational change in NLRP3 and thereby inhibit the interaction between NLRP3 and NEK7, which helps to suppress the assembly and activation of NLRP3 inflammasome. However, the detailed mechanisms by which mefloquine affects the NLRP3 conformation need to be further investigated.

We provide strong evidence further that mefloquine effectively prevents NLRP3‐driven diseases by blocking NLRP3 inflammasome activation in vivo. It has been demonstrated that excessive activation of the NLRP3 inflammasome is associated with the onset and progression of LPS‐induced inflammatory injury in the brain (Han et al, 2021) and peripheral organs (Yan et al, 2015). Our study demonstrates that inhibition of NLRP3‐dependent inflammation by mefloquine is efficient to reverse the LPS‐induced liver and spleen injury in mice. Mefloquine treatment has remarkable beneficial effects including reduced the levels of IL‐1β and IL‐18 in serum, decreased the AST and ALT level in blood, declined neutrophil infiltration in liver, and improved morphological change of liver and spleen. However, the therapeutic effects of mefloquine on LPS‐induced liver and spleen injury are not observed in Nlrp3 knockout mice. These findings indicate that mefloquine can target NLRP3 to treat LPS‐induced inflammation injury in the periphery. More importantly, we find that mefloquine can cross the blood–brain barrier and inhibit LPS‐induced inflammation in the brain. Mefloquine treatment significantly inhibits the microglia activation, caspase‐1 cleavage, IL‐1β secretion, and behavior dysfunction in the brain. But, Nlrp3 knockout cancels the therapeutic effects of mefloquine on LPS‐induced neuroinflammation in mice. These findings reveal its therapeutic potential for NLRP3‐driven diseases in vivo.

Growing evidence indicates that NLRP3 inflammasome has been regarded as an important contributor for the progression of PD (Lee et al, 2019; Panicker et al, 2022). Thus, modulating NLRP3‐dependent neuroinflammation might be an effective approach to treat PD (Nguyen et al, 2022). In the present study, we find that mefloquine treatment markedly inhibits microglia activation and reduces the NLRP3‐dependent caspase‐1 activation and IL‐1β production in microglia. Moreover, mefloquine treatment noticeably alleviates the behavior dysfunction and DA neuron loss in in LPS‐induced PD model. These finding demonstrate that mefloquine effectively prevents DA degeneration in mouse PD model via suppression of NLRP3‐dependent neuroinflammation. Notably, mefloquine reduces the procaspase‐1 expression in vivo, but does not change the procaspase‐1 expression in vitro. Given that the factors in vitro are relatively simple and controllable, while the influencing factors in vivo are relatively complex, one possible mechanism is that mefloquine inhibits NLRP3 activation to reduce IL‐1β production, which in turn leads to a decrease in procaspase‐1 expression through a feedback in vivo.

The current available clinical treatment for NLRP3‐related diseases is the use of agents that target IL‐1β. IL‐1β is also produced by other inflammasomes or in an inflammasome‐independent way, so inhibition of NLRP3 itself might have less immunosuppressive side effects than blockade of IL‐1β. The inflammasomes play important roles in host defense. Indeed, our results show that mefloquine is a direct and specific NLRP3 inhibitor. Mefloquine has no effect on the activation of AIM2 or NLRC4 inflammasomes, suggesting that mefloquine might not impair the role of these inflammasomes in host defense.

In conclusion, we identify mefloquine as potent NLRP3 inhibitor by high throughput screening to efficiently treat NLRP3‐driven diseases such as LPS‐induced systemic inflammation and Parkinson's disease. These findings indicate that mefloquine is a potential therapeutic agent for NLRP3‐related diseases and expand its clinical use. However, mefloquine has other targets, such as pannexin1, and has psychiatric side effects such as depression, anxiety and even suicidality. These side effects need to be carefully evaluated to when considering mefloquine's application as an NLRP3 inhibitor.

Materials and Methods

Experimental animals

Mice (C57Bl/6 background) were bred and maintained with an ambient temperature of 22 ± 2°C in the Animal Resource Centre of the Faculty of Medicine (Nanjing Medical University) on a 12‐h light/dark cycle, with ad libitum access to food and water. Nlrp3^−/− mice were described previously (Li et al, 2022). All animal procedures were performed in strict accordance with the guideline of the Institutional Animal Care and Use Committee (IACUC) of Nanjing Medical University.

Reagents

Mefloquine was obtained from Selleck. ATP was obtained from Sigma. Nigericin, flagellin and poly(dA:dT) were from Invivogen. Ultrapure LPS, MitoSOX, DAPI, Lipofectamine 3000 were obtained from Invitrogen. Anti‐Flag antibody beads, protein G agarose and anti‐NEK7 (ab133514) antibody were obtained from Abcam. The anti‐mouse IL‐1β (p17) (AF‐401‐NA) antibody was obtained from R&D. Anti‐mouse caspase‐1 (p20) (AG‐20B‐0042), and anti‐NLRP3 (AG‐20B‐0014) antibodies were obtained from Adipogen. The anti‐ASC (67824) antibody was obtained from Cell Signaling Technology.

Virtual screening analysis

The Alphafold 2 database model was applied to predict the potential binding region of the target NLRP3 protein (PDB: 6NPY), then proteins were docked with 2,513 FDA‐approved drugs via virtual screening presented by the Pymol software. The score was ranked according to the value of Gibbs free energy.

Surface plasmon resonance (SPR) analysis

The SPR was performed in selected 10 compounds using a Reichert 4SPR instrument (Reichert, USA). Recombinant human NLRP3 protein was purchased from CUSBIO (#CSB‐EP822275HU3). Different concentrations of compounds (Selleck, USA) were run over SPR with the CM5 chip (GE, USA) using the running buffer containing 1.8 mmol/l KH₂PO₄, 10 mmol/l Na₂HPO₄, 137 mmol/L NaCl, 2.7 mmol/L KCl, and 0.005% Tween‐20 (pH 7.8). The binding and dissociation rates were measured at a flow rate of 25 μl/min. The injection of the ligands was performed for 1.5 min followed by a flow with ligand‐free buffer to analyze the dissociation for 2.5 min. Curves were corrected for nonspecific ligand binding by subtracting the signal obtained for the negative control flow cell. The equilibrium dissociation constant (Kd) was derived from a simple 1:1 interaction model using the Reichert data evaluation software.

Cell preparation and stimulation

Bone marrow‐derived macrophages (BMDMs) were isolated and cultured as described (Du et al, 2019). THP‐1 human monocytes were purchased from the American Type Culture Collection and tested for mycoplasma contamination. THP‐1 cells were differentiated to a macrophage‐like state by incubating with 20 nM PMA overnight. To induce NLRP3 inflammasome activation, BMDMs (5 × 10⁵ cells/ml) or THP‐1 cells (1 × 10⁶ cells/ml) were plated in 12‐well plates and were primed with 100 ng/ml LPS for 3 h and were then treated with mefloquine for another 30 min. After that, cells were stimulated with ATP (5 mM) or nigericin (10 μM) for 30 min. For AIM2 or NLRC4 inflammasome activation, BMDMs were primed with 100 ng/ml LPS for 3 h and were then treated with mefloquine for another 30 min. After that, cells were stimulated with poly (dA:dT) (1 μg/ml) or flagellin (1 μg/ml) for 6 h, respectively. Precipitated supernatants and cell extracts were analyzed by immunoblotting.

LDH release assay

Bone marrow‐derived macrophages were seeded on 96‐well plates. After treatment with indicated stimuli, supernatants were collected and LDH activity was determined with the Cytotoxicity Detection Kit (LDH; Roche). The LDH activity of control cells was considered to be 1.

ELISA

Supernatants from cell culture, tissue, or serum were assayed for mouse IL‐1β (DY‐401, R&D Systems), IL‐18 (DY7625‐05, R&D Systems) or TNF‐α (DY410, R&D Systems) and for human IL‐1β (DY201, R&D Systems) or IL‐18 (DY318‐05, R&D Systems) according to the manufacturer's instructions. The levels of alanine aminotransferase (ALT), and aspartate aminotransferase (AST) were measured by ALT and AST reagent kits (Nanjing Jiancheng) according to the manufacturer's instructions.

Quantitative real‐time PCR (qPCR)

Total RNA was isolated from BMDMs by extraction with Trizol reagent (Invitrogen, USA). Reverse transcription PCR was carried out using a TAKARA PrimeScript RT reagent kit, and qPCR was performed in duplicate for each sample using a QuantiTect SYBR Green PCR kit (Qiagen, Germany) with an ABI 7300 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). GAPDH was used as an internal control for the real‐time PCR amplification. The sequences of primers used are as follows: NLRP3 forward: GCCATAGAACTGATGAGAGGGAG, reverse: TCACAACTCGCCCAAGGAGGAA. IL‐1β forward: TGGACCTTCCAGGATGAGGACA, reverse: GTTCATCTCGGAGCCTGTAGTG. GAPDH forward: CAAAAGGGTCATCTCC, reverse: CCCCAGCATCAAAGGTG.

Measurement of mitochondrial superoxide

MitoSOX (M36008, Invitrogen, USA) was used to detect superoxide in the mitochondria of live cells. Bone marrow‐derived macrophages were stimulated and then stained with MitoSOX at 2.5 μM for 30 min at 37°C. After that, the cells were washed with PBS twice and then resuspended in cold PBS containing 1% FBS for flow cytometric analyses. Flow data were analyzed with the FCS Express software (Guava Easy Cyte™ 8, Millipore, USA).

Intracellular potassium determination

To measure the intracellular potassium concentration, BMDMs plated in six‐well plates were stimulated to activate the NLRP3 inflammasome. Culture medium was removed, and cells were washed three times in potassium‐free buffer (139 mM NaCl, 1.7 mM NaH₂PO₄, and 10 mM Na₂HPO₄, pH 7.2). Ultrapure HNO₃ was added to lyse cells, and the samples were boiled for 30 min at 100°C. Then, ddH₂O was added to dissolve the precipitated products. Inductively Coupled Plasma Mass Spectrometry was used to measure intracellular K⁺.

SiRNA‐mediated gene silencing in BMDMs

Bone marrow‐derived macrophages (3 × 10⁵ cells/ml) were plated in 12‐well plates. siRNA (100 nM, Genepharma) targeting pannexin1 (sense: GGUGACAUUUGUGGUUAUATT; antisense: UAUAACCACAAAUGUCACCTT) was transfected into the cells in each well by using Lipofectamine 3000 (Invitrogen) for 48 h according to the manufacturer's instructions.

Immunoprecipitation (IP) and pulldown assay

For the endogenous IP assay, BMDMs were stimulated and lysed with NP‐40 lysis buffer with cocktail. The cell lysates were incubated overnight at 4°C with the primary antibodies. The proteins bound by antibody were precipitated by protein G beads and subjected to immunoblotting analysis.

For pull‐down assay, HEK‐293T cells in six‐well plates were transfected with human Flag‐NLRP3 plasmids (PPL00151‐2b), Flag‐AIM2 plasmids (pHBLP002226), Flag‐NLRC4 plasmids (PPL01760‐2a), Flag‐NLRP3 (PYD 1‐93aa) plasmids (PPL00151‐2f), Flag‐NLRP3 (NACHT 220‐536aa) plasmids (PPL00151‐2g), or Flag‐NLRP3 (LRR 742‐991aa) plasmids (PPL00151‐2h) for 24 h and then were collected, lysed, and centrifuged at 8,000 rpm. Prewashed streptavidin beads were added into the supernatant for 2 h at 4°C and centrifuging at 7,100 g. The supernatant was incubated with biotin‐mefloquine for 2 h. After that, the samples were then incubated with streptavidin beads overnight. Beads were washed twice with 1% NP‐40 in PBS to remove unspecific binding proteins and boiled in SDS buffer and then were analyzed by immunoblot.

LPS‐induced systemic inflammation

C57BL/6 mice (10–12 weeks, male) were intraperitoneally injected with mefloquine (5, 20 mg/kg) or vehicle once a day for 3 days and then intraperitoneally injected with LPS (serotype 0127:B8; Sigma, USA, 20 mg/kg). After 12 h, serum samples were collected, and cytokines were measured by ELISA.

Histological analysis

Twelve hours after LPS injection, mouse livers and spleens were postfixed with 4% PFA for 24 h and sectioned after embedding in paraffin. Sections were prepared and stained with H&E using standard procedures. Slides were examined under a Nikon ECL IPSE Ci biological microscope, and images were acquired with a Nikon DS‐U3 color digital camera.

Ultra‐performance liquid chromatography‐mass spectrum (UPLC–MS)

The concentrations of analytes in mouse plasma and brain were quantified using liquid chromatography‐mass spectrometry with a Thermo TSQ Quantis LC‐MS/MS System equipped with an electrospray ionization interface used to generate positive ions [M + H] + for mefloquine and IS (quinine). The compounds were separated on a reversed‐phase column (BEH C18, 100 × 2.1 mm internal diameter, 1.7 mm particle size; Waters, USA) with a mobile phase consisting of acetonitrile (B)/0.1% formic acid (A). An elution gradient was used as follows (0.0–1.0 min, B 10%; 1.0–3.0 min, B 10–50%; 3.0–5.0 min, B 50–100%; 5.0–6.0 min, B 100%). The mobile phase was eluted using an HP 1100 series pump (Agilent, Wilmington, DE, USA) at 0.2 ml/min, and the pressure was ~60 psi. The turbo ion spray interface was operated in the positive ion mode at 3,500 V and 350°C. The operating conditions were optimized by the flow injection of a mixture of all analytes and were determined as follows: sheath gas (Arb), 50 l/min; auxiliary gas, 10.0 l/min; sweep gas (Arb), 1.0 l/min. Quantitation was performed by multiple reaction monitoring (MRM) of the precursor ions and the related product ions for mefloquine using the internal standard method with the peak‐area ratios. The analytical data were processed by Analyst software (Ver. 1.4.1, Applied Biosystems).

LPS‐induced PD mouse model

The protocol was similar to that described previously (Chen et al, 2021). Under anesthesia, 1 μl of LPS (2.5 mg/ml, serotype 0127:B8; Sigma, USA) was bilaterally delivered into the substantia nigra pars compacta (SNc) at a rate of 0.2 μl/min using the following coordinates: −3.0 mm A/P, ±1.3 mm M/L, and −4.5 mm D/V from bregma. One hour after stereotaxic injection, mice were injected intraperitoneally with mefloquine (5, 20 mg/kg) or vehicle once a day for 1 week.

Behavioral analysis

Behavioral analyses were performed as described previously (Xia et al, 2020). The pole test and rotarod test were performed at 7 days after stereotaxic injection of LPS. For the rotarod test, mice were accustomed to the apparatus before testing. The mice were then placed on the rod and tested at 20 rpm for 300 s. The latency time that each mouse stays on the rod at rotarod speed was recorded. For the pole test, the mice were placed head upward on the top of a vertical wooden rough‐surfaced pole (diameter 1 cm, height 50 cm). The total time until the mouse reached the floor with its four paws (T‐total) and the time needed for the mouse to turn completely head downward (T‐turn) were recorded. Open field test was performed at 10 h after intraperitoneal injection of LPS. The mouse was placed into activity monitor chambers (20 × 20 × 15 cm) for 30 min, and the activities were recorded at 5‐min intervals. The tester was blinded to all treatment groups for each behavioral testing.

Immunohistochemistry and immunofluorescence

Serial sections of the brains were cut (30‐μm section) through each entire midbrain using a freezing microtome (Leica M1950, Nussloch, Germany), as described previously (Han et al, 2019). To detect tyrosine hydroxylase (TH), brain slices were incubated with mouse antibody against TH (T1299, 1:1,000, Sigma, St Louis, MO, USA) overnight. Control staining was performed without primary antibodies. Immunoreactivity was visualized by incubation in substrate‐chromogen solution. The number of TH‐positive cells in the SNc was counted using an optical fractionator (Stereo Investigator 7, MBF Bioscience, Williston, VT, USA).

For immunofluorescence staining, after blocking with 10% bovine serum albumin for 1 h at 20°C, the slices were incubated with anti‐IBA‐1 (Abcam, ab178846, 1:1,000 dilution), anti‐caspase‐1 (AG‐20B‐0042, Adipogen, 1:400 dilution), or anti‐ASC (Abcam, ab307560, 1:200 dilution) overnight at 4°C and then incubated with Alexa Fluor 555‐conjugated antibody (Invitrogen, 21,432; 1:1,000) or Alexa Fluor 488‐conjugated antibody (Invitrogen, A21202; 1:1,000 dilution) for 1 h at 20°C. DAPI (P36931, Life Technologies) visualizes nuclei. Images were acquired by a confocal microscope (Axiovert LSM510, Carl Zeiss Co., Germany) and then processed by Image J.

Western blotting analysis

Cell lysates and tissues were homogenized in RIPA lysis buffer (Beyotime Biotechnology, China). A 25‐μg protein aliquot of each sample was separated and then electrophoretically transferred onto PVDF membranes (IPVH00010, Millipore, USA). Immunoreactive bands were analyzed with ImageQuant™ LAS 4000 imaging system (GE Healthcare, Pittsburgh, PA, USA). Protein levels were determined by normalizing to the level of β‐actin. The following primary antibodies were used: anti‐NLRP3 (AG‐20B‐0014‐C100, Adipogen), anti‐GSDMD (ab219800, Abcam), anti‐phospho‐NF‐κB p65 (3033, Cell Signaling Technology), anti‐caspase‐1 (AG‐20B‐0042, Adipogen), anti‐IL‐1β (AF‐401‐NA, R&D), and anti‐β‐actin (BM0627, Boster).

Statistical analysis

All data are expressed as means ± SEM. The data were collected and analyzed using GraphPad Prism 7. The differences with different treatments and genotypes were determined by one‐way or two‐way analysis of variance (ANOVA), followed by the Tukey's post hoc test and were considered as statistically significant at P < 0.05.

Author contributions

Si‐Yuan Jiang: Software; formal analysis; funding acquisition; validation; investigation; methodology. Tian Tian: Software; formal analysis; validation; investigation; visualization; methodology. Wen‐Jie Li: Data curation; formal analysis; investigation; methodology. Ting Liu: Visualization; methodology. Cong Wang: Data curation; software; writing – review and editing. Gang Hu: Conceptualization; funding acquisition; writing – review and editing. Ren‐Hong Du: Conceptualization; supervision; funding acquisition; writing – original draft; project administration; writing – review and editing. Yang Liu: Resources; software; writing – original draft; project administration. Ming Lu: Conceptualization; supervision; funding acquisition; validation; project administration; writing – review and editing.

Disclosure and competing interests statement

The authors declare that they have no conflict of interest.

Supporting information

Expanded View Figures PDF

PDF+

Source Data for Figure 1

Source Data for Figure 2

Source Data for Figure 3

Source Data for Figure 4

Source Data for Figure 5

Source Data for Figure 6

EMBO reports (2023) 24: e57101

Data availability

The liquid chromatography‐mass spectrometry dataset produced in this study is available at the MetaboLights database with the accession code MTBLS8346 (https://www.ebi.ac.uk/metabolights/MTBLS8346).