Skip to main content
BMC Medical Genomics logoLink to BMC Medical Genomics
. 2023 Oct 11;16:239. doi: 10.1186/s12920-023-01680-y

Whole exome sequencing revealed variants in four genes underlying X-linked intellectual disability in four Iranian families: novel deleterious variants and clinical features with the review of literature

Atefeh Mir 1, Yongjun Song 2, Hane Lee 2, Hossein Khanahmad 1,3, Erfan Khorram 1, Jafar Nasiri 4, Mohammad Amin Tabatabaiefar 1,3,5,
PMCID: PMC10566173  PMID: 37821930

Abstract

Aim and Objective

Intellectual disability (ID) is a heterogeneous condition affecting brain development, function, and/or structure. The X-linked mode of inheritance of ID (X-linked intellectual disability; XLID) has a prevalence of 1 out of 600 to 1000 males. In the last decades, exome sequencing technology has revolutionized the process of disease-causing gene discovery in XLIDs. Nevertheless, so many of them still remain with unknown etiology. This study investigated four families with severe XLID to identify deleterious variants for possible diagnostics and prevention aims.

Methods

Nine male patients belonging to four pedigrees were included in this study. The patients were studied genetically for Fragile X syndrome, followed by whole exome sequencing and analysis of intellectual disability-related genes variants. Sanger sequencing, co-segregation analysis, structural modeling, and in silico analysis were done to verify the causative variants. In addition, we collected data from previous studies to compare and situate our work with existing knowledge.

Results

In three of four families, novel deleterious variants have been identified in three different genes, including ZDHHC9 (p. Leu189Pro), ATP2B3 (p. Asp847Glu), and GLRA2 (p. Arg350Cys) and also with new clinical features and in another one family, a reported pathogenic variant in the L1CAM (p. Glu309Lys) gene has been identified related to new clinical findings.

Conclusion

The current study's findings expand the existing knowledge of variants of the genes implicated in XLID and broaden the spectrum of phenotypes associated with the related conditions. The data have implications for genetic diagnosis and counseling.

Keywords: XLID, L1CAM, ZDHHC9, ATP2B3, GLRA2, Intellectual disability, Exome sequencing, Iran

Introduction

Intellectual disability (ID) is a heterogeneous condition affecting brain development, function, and/or structure. ID has a prevalence of about 2–3% of global populations, and males exceed females by 20–30%, likely due to an enrichment of genes on the X-chromosome that are required for the neurodevelopment and the genetic imbalances in X-chromosomes. The prevalence of X-linked ID (XLID) in males has been estimated at 1 case in 600 to 1000 births. Thus, it is the most frequent cause of ID in males [1, 2]. XLID can be grouped into syndromic and non-syndromic forms. At least 209 different XLID disorders have been described, including 143 syndromic forms [3]. Fragile X syndrome is the most common and most studied XLID syndrome. In the recent decade, remarkable progress has been made in identifying new causative genes and understanding the underlying mechanisms in over 100 XLID conditions [4]. Next-generation sequencing (NGS) is the most powerful technique for identifying new variants and genes in XLID conditions [5]. Despite all advances, more than 80 XLID conditions remain without a molecular diagnosis [6], and identifying disease-causing genes and variants is necessary for precise diagnosis. It would expand the existing knowledge of XLID and the spectrum of phenotypes associated with the identified variants. A vast majority of known causative genes are highly expressed in the brain and involved in different biological functions and pathways [7]. Four of XLID- associated genes involved in neuronal signaling pathways are L1CAM, ZDHHC9, GLRA2, and ATP2B3. The L1CAM gene (MIM No. 308840) encodes a neural cell adhesion molecule involved in cell adhesion dynamics and the generation of transmembrane signals at tyrosine kinase receptors. It is critical in multiple processes during brain development, including neuronal migration, axonal growth and fasciculation, and synaptogenesis [8]. The ZDHHC9 gene (MIM No. 300646) encodes a palmitoyl-transferase that adds palmitate onto various protein substrates. It is implicated in neurological disorders [9]. The GLRA2 gene (MIM No. 305990) encodes a glycine receptor responsible for mediating glycine's inhibitory effects in neurons and is widely distributed throughout the CNS, particularly within the hippocampus, spinal cord, and brain stem [10]. The ATP2B3 gene (MIM No. 300014) encodes an ATP-driven calcium ion pump involved in the maintenance of basal intracellular calcium levels at the presynaptic terminals [11]. Clinical and genetic studies on these genes are few and more studies have led to precise diagnoses of the conditions and the design of new therapeutic approaches; the knowledge could also be helpful in genetic counseling, prenatal diagnosis (PND), pre-implementation genetic diagnosis (PGD), and predict prognosis of the disease.

The present study was launched on four families suspected with XLID. Whole exome sequencing (WES) and clinical evidence were used to identify pathogenic variants in the subjects. Furthermore, precise phenotyping and literature review were performed.

Material and methods

Human subject and consent approval

The research was performed according to the Declaration of Helsinki and was approved by the Ethics Committee of the Medical University of Isfahan, Isfahan, Iran (Ethics code: IR.MUI.MED.REC.1400.042). Four families with two or more ID patients suspected with the X-linked mode of inheritance were ascertained from the Isfahan and, Sistan & Balouchestan provinces of Iran. Through genetic counseling, medical history was taken, and pedigrees were drawn by the “Progeny” software (Progeny Software, LLC).

DNA extraction and molecular testing

Peripheral blood was withdrawn after taking informed written consent from the legal guardians. DNA was extracted using the DNSol Miniprep Kit (provided by ROJETECHNOLOGIES company, Tehran, Iran). All probands were tested for FMR1 CGG repeats to rule out Fragile X syndrome. It was done using Deviner® Fragile X (FMR1 Gene) Carrier Screen Kit (provided by KEYSAR Company, Tehran, Iran).

Library preparation & whole exome sequencing

WES was done by 3Billion Inc. Exome capture was performed using xGen Exome Research Panel v2 (Integrated DNA Technologies, Coralville, Iowa, USA). Sequencing was performed using NovaSeq 6000 (Illumina, San Diego, CA, USA).

Data analysis

The bases of the sequences were generated and uniquely aligned to the Genome Reference Consortium Human Build 37 (GRCh37) and revised Cambridge Reference Sequence (rCRS) of the mitochondrial genome. The variant interpretation was performed using the EVIDENCE software [12] to prioritize variants and interpreted based on the guideline recommended by the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) [13] in the context of the patient’s phenotypes. Relevant family history and previous clinical test results were provided through genetic counseling. Only variants deemed to be clinically significant and relevant to the patient's primary clinical indications at the time of variant interpretation were considered.

Bioinformatics tools

We used the Genome Aggregation Database (gnomAD v2.1.1) for population allele frequency analysis. The potential pathogenicity of the variants was assessed using the following prediction tools: FATHMM & FATHMM-MKL (Functional Analysis through Hidden Markov Models (v2.3), http://fathmm.biocompute.org.uk), LIST-S2 (https://list-s2.msl.ubc.ca/?session=28AB3E5B08FD16AF971162581885ACC2), M-CAP (Mendelian Clinically Applicable Pathogenicity, http://bejerano.stanford.edu/mcap/), Mutation assessor (http://mutationassessor.org/), MutPred (http://mutpred.mutdb.org/), PROVEAN (PROVEAN scores (v1.1)), SIFT (Scale-Invariant Feature Transform, https://sift.bii.a-star.edu.sg) & SIFT4G, MutationTaster (https://www.mutationtaster.org/), BayesDel (addAF and noAF)( https://fenglab.chpc.utah.edu/BayesDel/), MetaLR (e!Ensembl https://useast.ensembl.org/index.html), MetaRNN (http://www.liulab.science/metarnn.html), REVEL (Rare Exome Variant Ensemble Learner, e!Ensembl https://useast.ensembl.org/index.html), DEOGEN2 (http://deogen2.mutaframe.com/).

Primer designing and sanger validation

All candidate variants were confirmed using Sanger sequencing, and co-segregation analysis was performed on affected and unaffected members of the families. Specific primers for the variants were designed using the Primer3 online tool (Primer3web, version 4.1.0) and validated by online tools such as Primer-BLAST [14], MFEprimer3.1 [15] and SNPCheck (gene tools, SNPCheck V3). The used primers sequences include L1CAM (F: CCACGCCCACCATCAAATG, R: CGGTGACATAGTACGCATGC (product size of 177bp)), ZDHHC9 (F: CTGGGTGGGGAATTGTGTTG, R: GTGCTCATTTCTAACCTGTCCT (product size of 250bp)), GLRA2 (F: CTCTCTCTCTCAGGTCTCCTATG, R: TCTGAACTGAGGGGCAATCAT (product size of 186 bp)), ATP2B3 (F: CAACTTCACCAGCATCGTCAA, R: ACCCTCACTCTCACAATCTG (product size of 213 bp)).

Homology modeling

I-TASSER Web Server (https://zhanggroup.org/I-TASSER/) was used for modeling the 3-dimensional structure of proteins, and the structure refinement was done by Galaxy Refine (https://galaxy.seoklab.org/cgi-bin/submit.cgi?type=REFINE). Also, we used the PROCHECK program to generate the Ramachandran plot for the evaluation of the predicted 3-D structures. PyMOL (Version 2.2.3, Schrödinger, LLC.) software was used for visualization, mutagenesis, and structural analysis. Also, multiple stability prediction tools (SAAFEC-SEQ, mCSM, INPS-3D, and I-Mutant2.0) were used for evaluating the effects of mutations on the proteins’ stabilities.

Results

Clinical manifestations

Nine severe ID male patients belonging to four families were recruited from the Isfahan and, Sistan & Balouchestan provinces of Iran. Pedigree analysis suggested the possibility of XLID (Fig. 1). The ages of patients ranged from 3 to 40 years at the time of recruitment, and they mainly exhibited severe ID with or without dysmorphic features congenitally. Clinical descriptions of patients are as follows:

  • Family I: The proband (Fig. 1-I-A-P(III-3)) was a 14-year-old boy with severe ID who was prenatally diagnosed with hydrocephalus and underwent ventriculoperitoneal shun surgery ten days after birth. He had lower limb muscle weakness in infancy and delayed milestones. He started walking at five years old through occupational therapy. He had no history of difficulties with upper limbs. He suffered from delayed speech and language development and showed poor unclear speech (aphasia). He experienced multiple spasms, such as persistent neck and back muscle spasms that lasted about ten days (spastic paraplegia) and persistent stomach spasms since childhood. He manifested behavior problems, including; aggressive behavior, stressfulness, agitation, and self-injurious behavior (He showed bumps on finger joints due to chewing his fingers). He shows some dysmorphic features such as a long thin face, strabismus (hypertropia type), low-set ears, wide nasal bone, and a severe toe deformity that was corrected by surgery a couple of years ago. The mother had an abortion history of a male fetus in the 5th month of pregnancy for an unknown reason. He has two normal sisters without any medical issues. There are family histories of brain hemangioblastoma and severe ID in the maternal uncle (34 years old).

  • Family II: The proband (Fig. 1-II-A-P(III-3)) was a three-year-old boy with severe ID, neurodevelopmental delay, delayed milestones with no speech, and no walking. The Magnetic Resonance Imaging (MRI) showed corpus callosum agenesis and colpocephaly. His parents were not consanguineous. He has an elder brother (8 years old) with a similar condition who suffered from severe ID, developmental delay (delayed milestone; i.e., he started walking at six years old), and speech disorder, and also shows vision problems, persistent leg pains, and muscle weakness beginning from six years old of age. They have a sister with no medical issues. There is a family history of severe ID, speech disorder, and vision problems in the maternal uncle, who is 40 years old and a child of consanguineous marriage.

  • Family III: The proband (Fig. 1-III-A-P(III-5)) was a 17-year-old boy with severe ID and aggressive behavior. He had speech and developmental delays diagnosed as pervasive developmental disorders (PDD) by a pediatric neurologist due to behavioral and communication problems. He also shows some facial features such as a broad face, prominent lips, low-set-ears, broad eyebrows, long eyelashes, prominent eyelashes, and a broad nasal tip. His electroencephalogram (EEG) reports were normal. He is not a child of consanguineous marriage. He has an elder brother (29 years old) with similar conditions, including; severe ID and developmental and speech delay. However, there are some differences between these affected brothers in phenotype; the elder brother did not show aggressive behavior, is incommunicative and silent, shows a milder phenotype in facial features, and also experienced epilepsy in childhood, which was controlled by medicine. The mother had a history of abortion in the 3rd month of pregnancy. They had no positive family history of intellectual disability.

  • Family IV: The proband (Fig. 1-IV-A-P(IV-1)) was a four-year-old boy with severe ID, neurodevelopmental delay, delayed milestones with no speech, no walking, and hearing impairment. He manifested behavioral problems such as restlessness and crying. He shows dysmorphic facial features such as strabismus, congenital hypotrichosis, and low eyebrow. He had seizures at the age of two that is controlled by medicine. There are some bumps on the skull in touch examinations with no medical diagnosis. EEG showed a severe abnormality, and Auditory Brainstem Response (ABR) showed moderate hearing loss in the right ear and moderate to severe hearing loss in the left ear. Metabolic panel screening was negative. Brain computerized tomography (CT) scan showed coronal and axial thin sections in petrous bone, normal appearance of both external auditory canal, middle ear cavity, ossicular chain, and inner ear structure, no bony erosion, and normal scan of petrous bones. His parents are relatives. He had a family history of severe ID and seizures in the maternal uncle (19 years old), who has a movement disability in the left limbs. He also has facial features such as; a long face, prominent ear, low eyebrow, and broad nasal tip.

Fig. 1.

Fig. 1

The pedigrees, and chromatogram of studied patients. I: Family I, A: pedigree of the family, B: Sanger sequencing data of the normal, mutant hemizygous, and heterozygous female carrier of the family; II: Family II, A: pedigree of the family, B: Sanger sequencing data of the normal, mutant hemizygous and the heterozygous female carrier of the family; III: Family III, A: pedigree of the family, B: Sanger sequencing data of the normal, mutant hemizygous and the heterozygous female carrier of the family; IV: Family IV, A: pedigree of the family, B: Sanger sequencing data of the normal, mutant hemizygous and the heterozygous female carrier of the family

Molecular analysis

Screening for CGG trinucleotide repeats in the 5′ untranslated regions of the FMR1 gene showed normal ranges of repeat numbers (less than 55). All of the probands were selected for WES, and after WES data analysis, deleterious candidate variants were revealed on the X chromosome; L1CAM (ChrX:153,135,577:C > T(GRCh37), NM_001278116.2, c.925G > A, p.Glu309Lys), ZDHHC9 (ChrX:128,948,693:A > G(GRCh37), NM_016032.4, c.566T > C, p.Leu189Pro), GLRA2(ChrX:14,708,949:C > T(GRCh37), NM_002063.4, c.1048C > T, p.Arg350Cys) and ATP2B3 (ChrX:152,823,677:C > G(GRCh37), NM_001001344.2, c.2541C > G, p.Asp847Glu). Sanger sequencing validated candidate variants. In Family I, the variant was found to be co-segregated with the conditions in the proband, and his maternal uncle and mother and one of the proband’s sisters showed carrier status (Fig. 1-I-B). In Family II and IV, the variants were segregated in affected members, while the mothers were heterozygote carriers (Fig. 1-II-B and Fig. 1-IV-B). In Family III, two brothers were hemizygous for the candidate variant, the mother was heterozygote, and the candidate variant was not seen in healthy males in the pedigree (Fig. 1-III-B).

The stability tools predicted all three novel candidate variants to be destabilizing/decreased stability (Table 1). Population frequency databases revealed the NM_016032.4(ZDHHC9): c.566T > C and NM_001001344.2(ATP2B3), c.2541C > G were not observed in the gnomAD database. The NM_002063.4(GLRA2):c.1048C > T variant was observed at an extremely low frequency in the gnomAD database (total allele frequency: 0.002%).

Table 1.

The results of prediction servers on protein stability due to three novel deleterious variants

Stability prediction server INPS-3D mCSM SAAFEC-SEQ I-Mutant2.0
GLRA2: (p.Arg350Cys) Destabilizing Destabilizing Destabilizing Decreased stability
ZDHHC9: (p.Leu189Pro) Destabilizing Destabilizing Destabilizing Decreased stability
ATP2B3: (p.Asp847Glu) Destabilizing Destabilizing Destabilizing Decreased stability

The NM_016032.4(ZDHHC9): c.566T > C variant has a damaging effect based on FATHMM-MKL (score = 0.9845), LIST-S2 (score = 0.9765), M-CAP (score = 0.3318), Mutation assessor (score = 4.115), MutPred (score = 0.749), PROVEAN (score = 4.25), SIFT (score = -0.003), SIFT4G (score = -0.031), MutationTaster (score = 1).

Pathogenicity score of the NM_002063.4(GLRA2):c.1048C > T variant using in silico prediction tools such as BayesDel addAF (score = 0.2), BayesDel noAF (score = 0.17), MetaLR (score = 0.7), MetaRNN (score = 0.68), REVEL (score = 0.69), DEOGEN2 (score = 0.77), FATHMM (score = 1.68), FATHMM-MKL (score = 0.85), LIST-S2 (score = 0.99), M-CAP(score = 0.38), MutationTaster (score = 1), PROVEAN (score = 4.16, 4.08,4.28), SIFT (score = -0.01, -0.003), SIFT4G (score = -0.005, -0.009) showed this variant as damaging.

The pathogenicity of the NM_001001344.2(ATP2B3), c.2541C > G variant had been analyzed by BayesDel addAF (score = 0.4), BayesDel noAF (score = 0.33), MetaLR (score = 0.93), MetaRNN (score = 0.85), REVEL (score = 0.84), FATHMM (score = 4.49), FATHMM-MKL (score = 0.95), LIST-S2 (score = 0.96), M-CAP (score = 0.45), MutationTaster (score = 0.9999), PROVEAN (score = 3.71) and SIFT (score = -0.001), which suggested it’s the damaging effect.

According to the results of the current study, the NM_016032.4(ZDHHC9): c.566T > C and the NM_001001344.2 (ATP2B3), c.2541C > G variants met the criteria of PM1 (located in a mutational hot spot and/or critical and well-established functional domain without benign variation), PM2 (absent from controls or at extremely low frequency if recessive in Exome Sequencing Project, 1000 Genomes or ExAC), PP1 (co-segregation with the disease in multiple affected family members in a gene definitively known to cause the disease) and PP3 (Multiple lines of computational evidence support a deleterious effect on the gene or gene product) and the NM_002063.4(GLRA2):c.1048C > T variant had evidence for PM1, PM2, PM5 (novel missense change at an amino acid residue where a different missense change determined to be pathogenic has been seen before), PP1 and PP3 criteria. Therefore, all three novel candidate variants were classified as “likely pathogenic” based on ACMG guideline of variant interpretation [13].

Homology modeling

The Ramachandran plot of predicted 3-D structures of three proteins is shown in Fig. 2. In general, a good quality model should contain > 90% amino acids in favorable region [16]. As shown in Table 2, more than 90% of the amino acids in all three predicted models are located in the favorable region, so all three can be considered suitable. As a result of the p.Leu189Pro variant in the ZDHHC9 gene, which was found in Family II, a leucine amino acid (Fig. 3-B) at position 189 of ZDHHC9 protein (Fig. 3-A) has been substituted with a proline (Fig. 3-C). Figure 3-A shows that this residue is located in an alpha helix secondary structure.

Fig. 2.

Fig. 2

Ramachandran plot of three predicted structures. Plot of ZDHHC9, GLRA2, and ATP2B3 proteins depicted in A, B, and C numbers, respectively. Four colored areas of red, yellow, cream, and white show the most favored region, the additional allowed region, the generously allowed region, and the non-allowed region, respectively

Table 2.

Ramachandran plot statics. As shown, all three predicted structures have > 90% amino acids in the most favored region so they are good structures

Protein ZDHHC9 GLRA2 ATP2B3
Residue in most favored region (178) 90.4% (371) 90.7% (1017) 95.6%
Residue in additional allowed region (17) 8.6% (26) 6.4% (41) 3.9%
Residue in generously allowed region (1) 0.5% (7) 1.7% (2) 0.2%
Residue in disallowed region (1) 0.5% (5) 1.2% (4) 0.4%

Fig. 3.

Fig. 3

The 3-D structure of the ZDHHC9, GLRA2, and ATP2B3 proteins. A: The modeled structure of the mutated ZDHHC9 protein containing the p.Leu189Pro variant, the Leucine residue has been substituted with proline 189 (B, C); due to its irregular geometry, the proline residue destabilizes α-helices and probably disrupts the protein function. D: It illustrated the structure of the GLRA2 protein. Figure E shows that arginine 350 forms a salt bridge and a hydrogen bond with glutamic acid 347 and a salt bridge with arginine 343 (p.Arg350Cys). As a result of cysteine substitution, all of the mentioned hydrogen bonds are lost (F). G: The modeled structure of the ATP2B3 protein containing the p.Asp847Glu variant, the aspartic acid residue, has been substituted with glutamic acid 847 (H, I). As with aspartic acid, glutamic acid is an acidic residue; however, it has a smaller side chain, and due to its distance from the arginine 911 side chain, the salt bridge is broken

The variant p.Arg350Cys in the GLRA2 protein (Fig. 3-D) in Family III leads to the replacement of arginine 350, which forms salt bridges and hydrogen bonds with glutamic acid 347 and salt bridges with arginine 343 (Fig. 3-E), to the cysteine, and all the mentioned bonds are lost (Fig. 3-F).

Finally, in the ATP2B3 protein (Fig. 3-G), because of the p.Asp847Glu variant in Family IV, an aspartic acid 847 (Fig. 3-H), which is an acidic residue, is replaced with another acidic residue (glutamic acid) (Fig. 3-I). As shown in Fig. (3-H), aspartic acid 847 forms a salt bridge and a hydrogen bond with arginine 911. Due to its smaller side chain, the glutamic acid replacement results in the loss of the abovementioned salt bridge and hydrogen bond (Fig. 3-I). Moreover, several stability tools predicted all of the tree mutations as destabilizing.

Discussion

X-linked intellectual disability (XLID) is characterized by extensive genetic heterogeneity; to date, variants in more than 100 genes on the X-chromosome are known to be associated with XLID [17]. Here, we investigated four families with XLID conditions using WES and identified novel deleterious variants in three genes with variable clinical findings and a reported deleterious variant with new clinical features.

In Family I, a previously known pathogenic variant (NM_001278116.2: c.925G > A, p. Glu309Lys) in the L1CAM gene was identified. The L1CAM gene is located near the telomere of the long arm of the X chromosome at Xq28. It consists of 29 exons and encodes the L1 Cell Adhesion Molecule (L1CAM protein), a neuronal cell adhesion molecule that plays an essential role in nervous system development, including neuronal migration and differentiation [8]. To date, 240 different L1CAM mutations have been reported, scattered over the entire gene without hot spots, and more than 200 are disease-causing mutations [18]. Mutations in this gene are associated with eight phenotypic conditions and, interestingly, can lead to a clinical spectrum called L1 syndrome that varies not only between families but sometimes also within families. The p.Glu309Lys (c.925G > A) variant in this gene identified in the present study is related to the phenotypic features in two relative patients( Fig. 1-I-A). It is located in exon 8 and affects the Ig-like C2-type 3 ectodomain of the L1CAM protein [8]. The identified p.Glu309Lys (c.925G > A) variant in the L1CAM gene was previously described [19, 20], related to MASA (Mental retardation, Aphasia, Shuffling gait, Adducted thumbs) syndrome and is confirming genotype–phenotype correlation in which milder phenotypes are related to the missense mutation in the extracellular domain of the L1CAM gene. However, there are phenotypic differences between the previous studies on this deleterious variant and the current study on patients diagnosed with this variant (Table 3). We encountered some new clinical features in the present study, including; behavior problems such as self-injurious, aggressive behavior, agitation, and stressfulness, and some dysmorphic characteristics such as a long thin face, strabismus (hypertropia type), low set ears, wide nasal bone, and severe toe deformity, not previously reported for L1 syndrome or other L1CAM gene mutations. These differences can be due to variable expression related to the L1CAM gene mutations, which may be caused by modifier genes, epigenetics, or environmental factors. This study confirmed prior knowledge of a broad range of phenotypic manifestations of L1CAM gene mutations and the pleiotropic effects of the L1CAM gene.

Table 3.

A review of the literature on the NM_001278116.2(L1CAM): c.925G > A (p. Glu309Lys) variant

NM_001278116.2(L1CAM): c.925G > A (p. Glu309Lys) Intellectual disability Adducted thumbs Spastic paraplegia Aphasia Hydrocephalus Behavior problems Dysmorphic features
Jouet et al. (1995) [20] Yes Yes Yes Yes Yes - -
Straussberg et al. (1991) [19] Yes Yes Yes No - - -
Patients in this study A Yes No Yes Yes Yes Yes Yes
B Yes No Yes Yes Yes Yes Yes

In the second family (Family II), a novel deleterious hemizygous missense variant in the ZDHHC9 gene (NM_016032.4: c.566T > C, p.Leu189Pro) in two brothers with severe ID, developmental delay, and speech disorder (Fig. 1-II-A) was identified. The ZDHHC9 gene is located on chromosome Xq26.1 and consists of 12 exons and encoded five transcripts. It encodes an integral membrane protein member of the zinc finger DHHC domain-containing protein family which forms a complex with golgin subfamily A member seven and functions as a palmitoyl transferase [9]. The ZDHHC enzymes are implicated in several neurological and neurodevelopmental disorders. Loss-of-function mutations in the ZDHHC9 gene have been identified in XLID patients and are related to increased seizure risk [21]. According to the Human Gene Mutation Database (HGMD), LOVD3, ClinVar, and literature review, to date, about 18 pathogenic/likely pathogenic mutations have been identified, all of which are related to intellectual disability except one is related to an abnormality of the nervous system (Table 4). Hence, the ZDHHC9 gene is frequently associated with a syndromic condition called “Raymond-type X-linked syndromic intellectual developmental disorder (MRXSR, OMIM: 300,799)” that is characterized by mild to severe intellectual disability, speech and language difficulties, and additional variable features including marfanoid habitus, epilepsy, facial dysmorphism, hypotonia, and behavioral problems. In family II, the c.566T > C (p. Leu189Pro) variant of the ZDHHC9 gene was identified, which is located on exon seven and in the DHHC domain that is required for palmitoyl transferase activity [9]. As a result of this study, this mutation causes the enzyme aberrant activity, leading to the disease conditions. In this Family, two brothers and their maternal uncle were studied (Fig. 1-II-A), all three patients suffer from severe ID, developmental delay, and speech disorder that met the primary phenotype of the MRXSR, but there are some additional and variable clinical manifestations in these patients. The proband shows agenesis of the corpus callosum and Colpocephaly which is a new and previously unreported symptom in this condition. His elder brother has new clinical features, including vision problems, persistent leg pains, and muscle weakness beginning at six years of age. A similar vision problem has been encountered in their maternal uncle. These differences in phenotype between previous studies and within the presented family signify variable expression and pleiotropic effects of the ZDHHC9 gene (Table 4). Notably, vision and muscular problems may be due to the progression of the disorder by age (age-related onset). As few clinical features have been reported related to the variants of this gene, the genotype–phenotype correlations cannot be a result at this stage.

Table 4.

A review of the literature and databases on the known variants of the ZDHHC9 gene

Variant Type of Mutation Protein Change ACMG Classification Related Condition IDa SDa Aa Sa Ha DFa BPa Other Clinical Findings References
NM_016032.3(ZDHHC9): c.145T > C Missense p.Cys49Arg Pathogenic Not Provided N/R* N/R N/R N/R N/R N/R N/R - Hu (2016) Mol Psychiatry 21, 133 [22]
NM_016032.4(ZDHHC9):c.251T > C Missense p.Leu84Ser Likely Pathogenic Not Provided N/R N/R N/R N/R N/R N/R N/R - ClinVar (RCV000484510.1)
NM_016032.4(ZDHHC9):c.268G > A Missense p.Asp90Asn Likely Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type N/R N/R N/R N/R N/R N/R N/R - ClinVar (RCV000760177.1)
NM_016032.4(ZDHHC9):c.286C > T Missense p.Arg96Trp Pathogenic/Likely Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type Yes N/R N/R Yes N/R N/R N/R Global Developmental Delays without Marfanoid habitus, Structural Brain Abnormalities Tzschach (2015) Eur J Hum Genet 23 [17]
NM_016032.4(ZDHHC9):c.442C > T Patient 1 Missense p.Arg148Trp Pathogenic/Likely Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type, Intellectual Disability Yes N/R Yes N/R N/R Yes N/R Developmental Delay, Mild Fixed Flexion Deformity at the Elbows, Large Ears, Long Fingers and Toes, Pes Planus

Raymond (2007) Am J Hum Genet 80, 982

[23]

Patient 2 Developmental Delay, Large Ears, Long Fingers and Toes, Pes Planus
NM_016032.4(ZDHHC9):c.448C > T Missense p.Pro150Ser Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type Yes N/R Yes N/R N/R N/R N/R Joint Hypermobility, Pectus Excavatum, Long Digits, Delayed Sitting, Adducted Thumbs at Birth that resolved spontaneously, Long Face, Strabismus, Prominent Ears, Long, Thin Limbs, 5th-Finger Camptodactyly, Long Toes with Camptodactyly

Raymond (2007) Am J Hum Genet 80, 982

[23]

NM_016032.4(ZDHHC9):c.496G > A Missense p.Asp166Asn Likely Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type N/R N/R N/R N/R N/R N/R N/R - ClinVar (RCV001754546.1)
NM_016032.3( ZDHHC9): c.892C > T Missense p.Arg298Gln Pathogenic Moderate Intellectual Disability with Speech Delay Yes Yes N/R Yes N/R N/R N/R MRI Brain: Retro-Cerebellar CSF Fluid Collection Bowling (2017) Genome Med 9, 43 [24]
NM_016032.3( ZDHHC9): c.892C > T Nonsense p.Arg298* Pathogenic Intellectual Disability Yes N/R N/R N/R N/R N/R Yes Limited Extension of the Elbows and Metacarpophalangeal Joints, Acrocyanosis, Dysplastic Corpus Callosum, Lingual Fasciculation

Masurel-Paulet (2014) Am J Med Genet A 164, 789

[25]

NM_016032.4(ZDHHC9):c.167 + 5G > C Patient 1 Splicing p.Thr11Profs833 Pathogenic Not Provided Yes Yes Yes N/R N/R Yes Yes Developmental Delay, Pectus Carinatum, Pes Planus, Thin Facial Features

Raymond (2007) Am J Hum Genet 80, 982

[23]

Patient 2
NM_016032.3 ( ZDHHC9):c.172-175dup 1 (Two sibs) Splicing p.Tyr59Serfs*33 Pathogenic Not Provided Yes Yes N/R N/R Yes N/R N/R Developmental Delay and Moderate Learning Disability, a High Forehead, Severe Constipation, Hypertelorism

Raymond (2007) Am J Hum Genet 80, 982

[23]

2 (Maternal uncle) No Walking, Need Full-Time Care
NM_016032.3( ZDHHC9):c.361C > T Missense p.(Arg121Ter) Likely Pathogenic Not Provided N/R N/R N/R N/R N/R N/R N/R - LovD3 (https://databases.lovd.nl/shared/variants/ZDHHC9/unique)
NM_016032.3( ZDHHC9): c.878_879insA Frameshift (Small Insertion) p.Ser294Glnfs*26 Likely Pathogenic Not Provided Yes N/R N/R N/R N/R N/R N/R - Grozeva (2015) Hum Mutat 36, 1197 [26]
NM_016032.4(ZDHHC9):c.777 + 1G > A Splicing - Likely Pathogenic Abnormality of the Nervous System N/R N/R N/R N/R N/R N/R N/R - Retterer (2016) Genet Med 18, 696
NM_016032.3 (ZDHHC9):c.487 + 5_487 + 19del Small Deletion - Likely Pathogenic Not Provided Yes N/R N/R N/R N/R N/R N/R Global Developmental Delay, Gait Ataxia, Macrotia, High Narrow Palate, Hypertonia, Hyperreflexia

Anazi (2017) Hum Genet 136, 1419

[27]

6-31kb DEL, EX10-11DEL Gross Deletion - Pathogenic Mental Retardation, X-linked Yes N/R N/R N/R N/R N/R N/R - Boone (2010) Hum Mutat 31, 1326 [28]
2-KB DEL, EX6-7DEL Gross Deletion - Pathogenic Intellectual Disability Yes No N/R N/R Yes N/R Elongated and Down‐Slanting Palpebral Fissures and High Hairline Schirwani (2018) Am J Med Genet A 176, 1238 [29]
Insertion of 4.68Mb Gross Insertion - Likely Pathogenic Not Provided Yes N/R N/R N/R N/R N/R N/R Short Stature, Microcephaly

Willemsen (2012) Eur J Med Genet 55, 586

[30]

NM_016032.4 (ZDHHC9): c.566T > C 1 (proband) Missense p.Leu189Pro Likely Pathogenic Syndromic X-Linked Intellectual Disability Raymond Type Yes Yes No No No No No Developmental Delay, Vision Problem (in older brother and maternal uncle), Muscular Weakness (in older brother), Brain Tumor (in proband) Current Study
2 (older brother)
3 (maternal uncle)

aN/R Not reported, ID Intellectual disability, SD Speech disorder, A Arachnodactyly, S Seizures, H Hypotonia, DF Dysmorphic features, BP Behavioral problem

In the third family (Family III), a novel deleterious hemizygous missense variant in the GLRA2 gene (NM_002063.4:c.1048C > T, p.Arg350Cys) was identified. The GLRA2 gene is located on Xp22.2, consists of 13 exons, and encodes eight transcripts. GLRA2 is a protein-coding gene that encodes the alpha subunit of the glycine receptor; which are widely distributed throughout the CNS, particularly within the hippocampus, spinal cord, and brain stem. It plays a role in the down-regulation of neuronal excitability and contributes to generating inhibitory postsynaptic currents [10]. Recent investigations have noted that missense variants in this gene can result in a loss, gain, or altered function of the encoded protein. In turn, missense variants are likely to either negatively or positively deregulate cortical progenitor homeostasis and neuronal migration in the developing brain, leading to changes in cognition, learning, and memory [31]. The most associated disorder with GLRA2 is X-Linked Intellectual Developmental Disorder, Syndromic, Pilorge Type (MRXSP, OMIM: 301,076). The MRXSP is characterized by a global developmental delay with variably impaired intellectual development, speech delay, behavioral abnormalities, autism spectrum disorder (ASD), and more variable features, including motor incoordination, seizures, and ocular abnormalities. Based on our knowledge, to date, about 12 pathogenic/likely pathogenic variants have been reported according to literature, HGMD, LOVD3, and ClinVar (Table 5), most of which are related to MRXSP or ASD. Here, we identified a novel deleterious hemizygous missense variant (NM_002063.4:c.1048C > T, p.Arg350Cys) in this gene in a family with two affected boys with severe ID. They suffered developmental and speech delays, but some differences were found, including seizures in the elder brother and behavior problems in the younger one. In addition, Piton et al. (2011) previously described a pathogenic mutation in a similar amino acid codon (NM_002063.4(GLRA2):c.1049G > T, p.Arg350Leu), related to ASD [32]. After a while, Zhang et al. (2017) showed that the R350L mutation altered glycine receptor channel properties and kinetics, with increased inhibitory postsynaptic current (IPSC) and decreased decay times. The reduced decay times lead to longer duration of active periods, and increased conductance of the mutant channel indicated that the R350L mutation results in a gain-of-function effect [33]. In line with Piton et al. (2011) study, the two brothers of the current research in Family III also showed PDD, a subtype or milder type of ASD. The differences in phenotypic manifestation within these two brothers and between other studies may be due to the gene's variable expression or modifier genes and pleiotropic effects. We also encountered some facial features that have been reported for a likely pathogenic variant of this gene in ClinVar submission (ClinVar: RCV001813921.1), including some minor features: a broad face, prominent lips, broad eyebrows, long eyelashes, prominent eyelashes, and a broad nasal tip, which can expand the spectrum of clinical manifestations associated with the disorder. On the other hand, there are few detailed clinical features that have been reported related to this gene's variants, and the lack of such clinical details makes it impossible to find the genotype–phenotype correlations regarding this gene.

Table 5.

A review of literature and databases on the variants of the GLRA2 gene

Variant Type of Mutation Protein Change ACMG Classification Related Condition IDa GDDa SDa BPa Other Clinical Findings Reference
NM_002063.4(GLRA2):c.16C > G Missense p. val6leu Pathogenic Autism Spectrum Disorder N/Ra N/R N/R Yes Autism Spectrum Disorder Iossifov (2014) Nature 515, 216 [34]
NM_002063.4(GLRA2):c.140T > C Missense p.Phe47Ser Likely Pathogenic​ Not Provided N/R N/R N/R Global Developmental Delay, Seizure, Infantile Spasms, Nystagmus, Strabismus, Hyperactivity, Sleep Disturbance, Normal Interictal EEG ClinVar (RCV001810525.1)
NM_002063.4(GLRA2):c.407A > G Missense p.Asn136Ser Pathogenic Intellectual Developmental Disorder, X-Linked, Syndromic, Pilorge Type N/R N/R N/R Yes Autism Spectrum Disorder Pilorge (2016) Mol Psychiatry 21, 936 [35]
NM_002063.4(GLRA2):c.458G > A Missense p.Arg153Gln Pathogenic Intellectual Developmental Disorder, X-Linked, Syndromic, Pilorge Type N/R N/R N/R Yes Autism Spectrum Disorder Pilorge (2016) Mol Psychiatry 21, 936[35]
NM_002063.4(GLRA2):c.718A > G Missense p.Lys240Glu Likely Pathogenic Autism Spectrum Disorder and Developmental Disorder N/R N/R N/R N/R - Chen X (2022) Front Mol Neurosci 15 [36]
NM_002063.4(GLRA2):c.777C > G Missense p.Ile259Met Likely Pathogenic Autism Spectrum Disorder N/R N/R N/R N/R - Marcogliese (2022), Cell Report 15;38 [37]
NM_002063.4(GLRA2):c.754C > T Missense p.Arg252Cys Likely Pathogenic Autism Spectrum Disorder N/R N/R N/R N/R - Marcogliese (2022), Cell Report 15;38 [37]
NM_002063.4(GLRA2):c.1049G > T Missense p.Arg350Leu Pathogenic Intellectual Developmental Disorder, X-Linked, Syndromic, Pilorge Type N/R N/R N/R Yes Autism Spectrum Disorder Piton A (2011) Mol Psychiatry 16 (8) [32]
NM_002063.4(GLRA2):c.862G > A Missense p.Ala288Thr Likely Pathogenic Not Provided N/R N/R N/R N/R Seizure, Myoclonus, Cerebellar Ataxia, Developmental Regression ClinVar (RCV001813918.1)
NM_002063.4(GLRA2):c.1199C > T Missense p.Pro400Leu Likely Pathogenic Not Provided N/R N/R Yes Yes Seizure, Disorder of Language, Febrile Seizure (within the age range of 3 months to 6 years), Developmental Regression, Delayed Speech and Language Development, Anxiety, Obesity, Broad Face, Widow's Peak, Broad Eyebrow, Long Eyelashes, Prominent Eyelashes, Broad Nasal Tip, EEG Abnormality, Alpha-EEG ClinVar(RCV001813921.1)
NM_002063.4(GLRA2):c.887C > T Missense p.Thr296Met Likely Pathogenic Autism Spectrum Disorder N/R N/R N/R N/R - Marcogliese (2022), cell Report 15;38 [37]
NM_002063.4(GLRA2):c.1334G > A Missense p.Arg445Gln Likely Pathogenic Not Provided Yes Yes Yes Yes Seizure, Autistic Disorder, Cognitive Impairment, Short Attention Span, Sleep Disturbance, Downslanted Palpebral Fissures ClinVar (RCV001813920.1)
NM_002063.4(GLRA2): c.1048C > T Patient 1 Missense p.Arg350Cys Likely Pathogenic Intellectual Developmental Disorder, X-Linked, Syndromic, Pilorge Type Yes Yes Yes Yes Seizures, PDD, Some Facial Features such as; a Broad Face, Prominent Lips, Broad Eyebrows, Long Eyelashes, Prominent Eyelashes, and a Broad Nasal Tip. Normal EEG (in proband) Current Study
Patient 2

aN/R Not reported, ID Intellectual disability, GDD Global developmental delay, SD Speech disorder, BP Behavioral problem

Family IV represents a novel deleterious hemizygous missense variant in the ATP2B3 gene. The ATP2B3 gene is located on Xq28 and consists of 26 exons. The ATP2B3 gene encodes ATPase Plasma Membrane Ca2 + , Transporting three involved in the maintenance of basal intracellular Calcium levels at the presynaptic terminals [38]. The most condition related to the ATP2B3 gene is X-linked Cerebellar ataxia-1 (SCAX1, OMIM: 302,500), an X-linked recessive neurologic disorder characterized by hypotonia at birth, delayed motor development, gait ataxia, difficulty standing, dysarthria, and slow eye movements. Brain MRI shows cerebellar ataxia. To our knowledge, 10 pathogenic/likely pathogenic mutations in this gene have been reported according to literature, HGMD, LOVD3, and ClinVar databases (Table 6) related to SCAX1, ataxic disorders, and other neurological disorders. The studied family (Family IV) resulted in the NM_001001344.2, c.2541C > G, p.Asp847Glu variant on the ATP2B3 gene. Clinical findings matched other studies on ATP2B3 gene variants related to SCAX1 (Table 6). The proband and his maternal uncle (Fig. 1-IV-A) both suffer from severe ID and seizure. The different clinical manifestations in the proband include neurodevelopmental delay, delayed milestones, no speech, no walking, hearing impairment, agitation, and excessive crying. He shows dysmorphic facial features such as strabismus, congenital hypotrichosis, and low eyebrow. His maternal uncles have movement disability in the left limb that began after multiple seizures early after birth. He also shows facial features such as a long face, prominent ear, low eyebrow, and broad nasal tip. Additionally, as shown in Table 6, missense changes are a common disease-causing mechanism in this gene. Another key finding in this study was the existence of subtle differences in some clinical features that suggest variable expression between and within families with the same gene defects. Again, few clinical features have been reported related to the variants of this gene, and the genotype–phenotype correlations cannot be resolved at the moment.

Table 6.

A review of literature and databases on the variants of the ATP2B3 gene

Variant Type of Mutation Protein Change ACMG Classification Related Condition IDa GDDa SDa BPa Other Clinical Findings Reference
NM_001001344.3(ATP2B3):c.130G > A Missense p.Glu44Lys Likely Pathogenic Spastic Ataxia N/Ra N/R N/R N/R N/R ClinVar (RCV001647254.1)
NM_001001344.3(ATP2B3):c.197C > T Missense p.Ser66Leu Likely Pathogenic Arthrogryposis Multiplex Congenita, Fetal Akinesia Deformation Sequence 1 N/R N/R N/R N/R N/R ClinVar(RCV000855493.1), Pergande(2020) Genet Med 22(3) -511 [39]
NM_001001344.3(ATP2B3):c.1445G > A Missense p.Arg482His Pathogenic Cerebellar ataxia, X-linked N/R Yes N/R N/R Generalized Hypotonia, Cerebellar Ataxia Calì (2015) J Biol Chem 290, 16,132 [38]
NM_001001344.3(ATP2B3): c.1610G > A Missense p.Arg537His Pathogenic Abnormality of the Nervous System N/R N/R N/R N/R N/R Retterer (2016) Genet Med 18, 696 [40]
NM_001001344.3(ATP2B3): c.1678C > G Missense p.Pro560Ala Pathogenic Autism Spectrum Disorder N/R N/R N/R N/R N/R Al-Mubarak (2017) Sci Rep 7, 5679 [41]
NM_001001344.3(ATP2B3):c.2197G > A Missense p.Gly733Arg Pathogenic Cerebellar Ataxia Yes Yes Yes N/R Psychomotor Retardation, Generalized Hypotonia, Hyporeflexia, Dysmetria and Trunk Ataxia, Exotropia and Nystagmus, Skin & Joint Hyperlaxity, Mild Dorsal Kyphosis, Structural Brain Anomalies Vicario (2017) Biochim Biophys Acta 1863, 3303 [42]
NM_001001344.3(ATP2B3):c.2770A > G Missense p.Thr924Ala Likely Pathogenic X-linked Progressive Cerebellar Ataxia Yes Yes Yes N/R Cognitive Impairment, Psychomotor Retardation, Inability to Walk, Limb Tremor ClinVar (RCV001420157.1)
NM_001001344.3(ATP2B3):c.3320G > A Missense p.Gly1107Asp Pathogenic /Likely Pathogenic X-linked Progressive Cerebellar Ataxia, N/R N/R N/R N/R N/R Zanni (2012) Proc Natl Acad Sci U S A 109, 14,514 [43]
NM_001001344.3(ATP2B3):c.3338C > T Missense p.Thr1113Met Likely Pathogenic Epileptic Encephalopathy with Infantile Spasms N/R N/R N/R N/R N/R Helbig (2016) Genet Med 18, 898 [44]
NM_001001344.3(ATP2B3):c.3594G > T Missense p.Lys1198Asn Pathogenic /Likely Pathogenic X-linked progressive cerebellar ataxia Yes Yes N/R N/R Microcephaly, Abnormal Cerebral Cortex Morphology, Hypotonia, Muscular Atrophy, Carious Teeth, Oral-Pharyngeal Dysphagia Charng (2016) BMC Med Genomics 9, 42 [45]
NM_001001344.2(ATP2B3), c.2541C > G Patient A Missense p.Asp847Glu Likely Pathogenic X-linked Progressive Cerebellar Ataxia Yes Yes Yes Yes Delayed in Milestones, no Walking, Hearing Impairment, Agitation and Crying, Dysmorphic Facial Features such as Strabismus, Congenital Hypotrichosis, and Low Eyebrow, Seizure, Severe Abnormality in EEG Current Study
Patient B

aN/R Not reported, ID Intellectual disability, GDD Global developmental delay, SD Speech disorder, BP Behavioral problem

Conclusion

In conclusion, this study revealed three novel deleterious variants in three known genes on X- chromosomes by whole exome sequencing and described novel clinical findings in four unrelated families with XLID disorders. The results broaden the mutational and clinical spectrum of four rare XLID conditions and provide insights into this highly heterogeneous disorder. New mutational reports of families with detailed clinical descriptions will add to the existing knowledge and help to a comprehensive and clear picture of the genetic landscape of XLID.

Acknowledgements

We sincerely thank families and patients who participate in this study. We are sincerely grateful to 3Billion Inc., Seoul, South Korea, for performing the whole exome sequencing. The Medical University of Isfahan also supported the study, Isfahan, Iran (Grant N0. 3991102). This is a part of A. M.’s Ph.D. thesis.

Authors’ contributions

A.M.: recruitment of patients and family members, exome data analysis, mutation screening, performing molecular experiments and segregation analysis in families by Sanger sequencing, and writing the first draft of the manuscript; Y. S.: performing whole exome sequencing and data analysis; H.L.: performing whole exome sequencing and data analysis; H. K.: performing molecular analysis experiments for exclusion Fragile X syndromes; E.K.: analysis of structural effects of mutations; J.N.: patient identification and provision of clinical data; MA.T.: design and supervision of the research, review and editing the first draft of the manuscript.

Funding

This study was funded by the Medical University of Isfahan, Isfahan, Iran (Grant N0. 3991102).

Availability of data and materials

All data generated or analyzed during this study are included in this published article and the raw data that support the findings of this study are available from the corresponding author upon reasonable request. In addition, the datasets generated and/or analyzed during the current study are available in the ClinVar repository with accession numbers as: VCV000838485.11, VCV001705288.1, VCV001705404.3, VCV001705366.1.

Declarations

Ethics approval consent to participate

The research was performed according to the Declaration of Helsinki and was approved by the Ethics Committee of the Medical University of Isfahan (Ethics code: IR.MUI.MED.REC.1400.042).

Informed consent was obtained from all subjects and/or their parents or legal guardian(s) for this study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

The original version of this article has been revised: figure 1 has been corrected.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

2/27/2025

A Correction to this paper has been published: 10.1186/s12920-025-02100-z

References

  • 1.Ropers H, Hamel BC. X-linked mental retardation. Nat Rev Genet. 2005;6(1):46–57. [DOI] [PubMed] [Google Scholar]
  • 2.Chelly J, Khelfaoui M, Francis F, Chérif B, Bienvenu T. Genetics and pathophysiology of mental retardation. Eur J Hum Genet. 2006;14(6):701–13. [DOI] [PubMed] [Google Scholar]
  • 3.Lisik MZ. Genetics of X-Linked Intellectual Disability. eLS.1–13.
  • 4.Lisik MZ. Genetics of X-linked Mental Retardation. eLS.
  • 5.Kvarnung M, Nordgren A. Intellectual disability & rare disorders: a diagnostic challenge. Rare Diseases Epidemiology: Update and Overview. 2017:39–54. [DOI] [PubMed]
  • 6.Lee Y-R, Khan K, Armfield-Uhas K, Srikanth S, Thompson NA, Pardo M, et al. Mutations in FAM50A suggest that Armfield XLID syndrome is a spliceosomopathy. Nat Commun. 2020;11(1):1–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.De Luca C, Race V, Keldermans L, Bauters M, Van Esch H. Challenges in molecular diagnosis of X-linked Intellectual disability. Br Med Bull. 2020;133(1):36–48. [DOI] [PubMed] [Google Scholar]
  • 8.Schäfer MKE, Nam Y-C, Moumen A, Keglowich L, Bouché E, Küffner M, et al. L1 syndrome mutations impair neuronal L1 function at different levels by divergent mechanisms. Neurobiol Dis. 2010;40(1):222–37. [DOI] [PubMed] [Google Scholar]
  • 9.Swarthout JT, Lobo S, Farh L, Croke MR, Greentree WK, Deschenes RJ, et al. DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras. J Biol Chem. 2005;280(35):31141–8. [DOI] [PubMed] [Google Scholar]
  • 10.Grenningloh G, Schmieden V, Schofield PR, Seeburg PH, Siddique T, Mohandas TK, et al. Alpha subunit variants of the human glycine receptor: primary structures, functional expression and chromosomal localization of the corresponding genes. Embo j. 1990;9(3):771–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Calì T, Lopreiato R, Shimony J, Vineyard M, Frizzarin M, Zanni G, et al. A Novel Mutation in Isoform 3 of the Plasma Membrane Ca2+ Pump Impairs Cellular Ca2+ Homeostasis in a Patient with Cerebellar Ataxia and Laminin Subunit 1α Mutations. J Biol Chem. 2015;290(26):16132–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Seo GH, Kim T, Choi IH, Park Jy, Lee J, Kim S, et al. Diagnostic yield and clinical utility of whole exome sequencing using an automated variant prioritization system, EVIDENCE. Clin Genet. 2020;98(6):562–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17(5):405–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13(1):1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang K, Li H, Xu Y, Shao Q, Yi J, Wang R, et al. MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Ress. 2019;47(W1):W610–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sultana MS, Ojha RK, Islam MM, Ashfaq MA, Khan KF, Sutradhar P. Computational study of SnRK2 in Arabidopsis thaliana: An in silico approach for homology modeling and functional characterization of SRK2G/SnRK2.
  • 17.Tzschach A, Grasshoff U, Beck-Woedl S, Dufke C, Bauer C, Kehrer M, et al. Next-generation sequencing in X-linked intellectual disability. Eur J Hum Genet. 2015;23(11):1513–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Vos YJ, Hofstra RM. An updated and upgraded L1CAM mutation database. Hum Mutat. 2010;31(1):E1102–9. [DOI] [PubMed] [Google Scholar]
  • 19.Straussberg R, Blatt I, Brand N, Kessler D, Katznelson MBM, Goodman TLR. X-linked mental retardation with bilateral clasped thumbs: report of another affected family. Clin Genet. 1991;40(5):337–41. [DOI] [PubMed] [Google Scholar]
  • 20.Jouet M, Moncla A, Paterson J, McKeown C, Fryer A, Carpenter N, et al. New domains of neural cell-adhesion molecule L1 implicated in X-linked hydrocephalus and MASA syndrome. Am J Hum Genet. 1995;56(6):1304. [PMC free article] [PubMed] [Google Scholar]
  • 21.Shimell JJ, Shah BS, Cain SM, Thouta S, Kuhlmann N, Tatarnikov I, et al. The X-linked intellectual disability gene Zdhhc9 is essential for dendrite outgrowth and inhibitory synapse formation. Cell Rep. 2019;29(8):2422-37e8. [DOI] [PubMed] [Google Scholar]
  • 22.Hu H, Haas SA, Chelly J, Van Esch H, Raynaud M, de Brouwer AP, et al. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes. Mol Psychiatry. 2016;21(1):133–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Raymond FL, Tarpey PS, Edkins S, Tofts C, O’Meara S, Teague J, et al. Mutations in ZDHHC9, which encodes a palmitoyltransferase of NRAS and HRAS, cause X-linked mental retardation associated with a Marfanoid habitus. Am J Human Genet. 2007;80(5):982–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bowling K, Thompson M, Amaral M. Genomic diagnosis for children with intellectual disability and/or developmental delay. Genome Med. 2017;9:43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Masurel-Paulet A, Kalscheuer VM, Lebrun N, Hu H, Levy F, Thauvin-Robinet C, et al. Expanding the clinical phenotype of patients with a ZDHHC9 mutation. Am J Med Genet A. 2014;164(3):789–95. [DOI] [PubMed] [Google Scholar]
  • 26.Grozeva D, Carss K, Spasic-Boskovic O, Tejada MI, Gecz J, Shaw M, et al. Targeted next-generation sequencing analysis of 1,000 individuals with intellectual disability. Hum Mutat. 2015;36(12):1197–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Anazi S, Maddirevula S, Salpietro V, Asi YT, Alsahli S, Alhashem A, et al. Expanding the genetic heterogeneity of intellectual disability. Hum Genet. 2017;136(11):1419–29. [DOI] [PubMed] [Google Scholar]
  • 28.Boone PM, Bacino CA, Shaw CA, Eng PA, Hixson PM, Pursley AN, et al. Detection of clinically relevant exonic copy-number changes by array CGH. Hum Mutat. 2010;31(12):1326–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Schirwani S, Wakeling E, Smith K, Study D, Balasubramanian M. Expanding the molecular basis and phenotypic spectrum of ZDHHC9-associated X-linked intellectual disability. Am J Med Genet A. 2018;176(5):1238–44. [DOI] [PubMed] [Google Scholar]
  • 30.Willemsen MH, de Leeuw N, de Brouwer AP, Pfundt R, Hehir-Kwa JY, Yntema HG, et al. Interpretation of clinical relevance of X-chromosome copy number variations identified in a large cohort of individuals with cognitive disorders and/or congenital anomalies. Eur J Med Genet. 2012;55(11):586–98. [DOI] [PubMed] [Google Scholar]
  • 31.Chen X, Wilson KA, Schaefer N, De Hayr L, Windsor M, Scalais E, et al. Loss, Gain and Altered Function of GlyR α2 Subunit Mutations in Neurodevelopmental Disorders. Front Mol Neurosci. 2022;15:886729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Piton A, Gauthier J, Hamdan F, Lafreniere R, Yang Y, Henrion E, et al. Systematic resequencing of X-chromosome synaptic genes in autism spectrum disorder and schizophrenia. Mol Psychiatry. 2011;16(8):867–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhang Y, Ho TNT, Harvey RJ, Lynch JW, Keramidas A. Structure-function analysis of the GlyR α2 subunit autism mutation p. R323L reveals a gain-of-function. Front Mol Neurosci. 2017;10:158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Iossifov I, O’roak BJ, Sanders SJ, Ronemus M, Krumm N, Levy D, et al. The contribution of de novo coding mutations to autism spectrum disorder. Nature. 2014;515(7526):216–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Pilorge M, Fassier C, Le Corronc H, Potey A, Bai J, De Gois S, et al. Genetic and functional analyses demonstrate a role for abnormal glycinergic signaling in autism. Mol Psychiatry. 2016;21(7):936–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chen X, Wilson KA, Schaefer N, De Hayr L, Windsor M, Scalais E, et al. Loss, gain and altered function of GlyR α2 subunit mutations in neurodevelopmental disorders. Frontiers in molecular neuroscience. 2022;15. [DOI] [PMC free article] [PubMed]
  • 37.Marcogliese PC, Deal SL, Andrews J, Harnish JM, Bhavana VH, Graves HK, et al. Drosophila functional screening of de novo variants in autism uncovers damaging variants and facilitates discovery of rare neurodevelopmental diseases. Cell Rep. 2022;38(11):110517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Calì T, Lopreiato R, Shimony J, Vineyard M, Frizzarin M, Zanni G, et al. A novel mutation in isoform 3 of the plasma membrane Ca2+ pump impairs cellular Ca2+ homeostasis in a patient with cerebellar ataxia and laminin subunit 1α mutations. J Biol Chem. 2015;290(26):16132–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Pergande M, Motameny S, Özdemir Ö, Kreutzer M, Wang H, Daimagueler H-S, et al. The genomic and clinical landscape of fetal akinesia. Genet Med. 2020;22(3):511–23. [DOI] [PubMed] [Google Scholar]
  • 40.Retterer K, Juusola J, Cho MT, Vitazka P, Millan F, Gibellini F, et al. Clinical application of whole-exome sequencing across clinical indications. Genet Med. 2016;18(7):696–704. [DOI] [PubMed] [Google Scholar]
  • 41.Al-Mubarak B, Abouelhoda M, Omar A, AlDhalaan H, Aldosari M, Nester M, et al. Whole exome sequencing reveals inherited and de novo variants in autism spectrum disorder: a trio study from Saudi families. Sci Rep. 2017;7(1):1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Vicario M, Calì T, Cieri D, Vallese F, Bortolotto R, Lopreiato R, et al. A novel PMCA3 mutation in an ataxic patient with hypomorphic phosphomannomutase 2 (PMM2) heterozygote mutations: Biochemical characterization of the pump defect. Biochim Biophys Acta Mol Basis Dis. 2017;1863(12):3303–12. [DOI] [PubMed] [Google Scholar]
  • 43.Zanni G, Calì T, Kalscheuer VM, Ottolini D, Barresi S, Lebrun N, et al. Mutation of plasma membrane Ca2+ ATPase isoform 3 in a family with X-linked congenital cerebellar ataxia impairs Ca2+ homeostasis. Proc Natl Acad Sci. 2012;109(36):14514–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Helbig KL, Farwell Hagman KD, Shinde DN, Mroske C, Powis Z, Li S, et al. Diagnostic exome sequencing provides a molecular diagnosis for a significant proportion of patients with epilepsy. Genet Med. 2016;18(9):898–905. [DOI] [PubMed] [Google Scholar]
  • 45.Charng W-L, Karaca E, Coban Akdemir Z, Gambin T, Atik MM, Gu S, et al. Exome sequencing in mostly consanguineous Arab families with neurologic disease provides a high potential molecular diagnosis rate. BMC Med Genomics. 2016;9(1):1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article and the raw data that support the findings of this study are available from the corresponding author upon reasonable request. In addition, the datasets generated and/or analyzed during the current study are available in the ClinVar repository with accession numbers as: VCV000838485.11, VCV001705288.1, VCV001705404.3, VCV001705366.1.


Articles from BMC Medical Genomics are provided here courtesy of BMC

RESOURCES