Detection of Point Mutations in rpoB Gene of Rifampin-Resistant Rickettsia typhi

Abstract

The rpoB gene of rifampin-resistant Rickettsia typhi (Rif mutant) and wild-type R. typhi were sequenced and compared. The Rif mutant rpoB had three nucleotide substitutions, which resulted in amino acid changes at residues 151, 201, and 271 and may be the basis for the rifampin resistance.

Rickettsia typhi, the causative agent of murine typhus, is transmitted to humans by fleas. Rickettsiae infect the host’s endothelial cells and cause symptoms including rashes, severe headaches, fever, chills, hepatic and renal dysfunction, central nervous system abnormalities, and pulmonary compromise (2). Most cases are clinically mild, but severe and even fatal cases have been reported (1, 2). The recommended antibiotic regimen includes administration of doxycyline, tetracycline, or chloramphenicol (9). Here, we report the detection of a rifampin-resistant laboratory strain of R. typhi (Ethiopian) during the development of a transformation protocol for Rickettsia. The basis of resistance was investigated by sequencing and mapping point mutations in the rpoB gene of the mutant.

Renografin-purified R. typhi (Ethiopian, 10⁸ PFU/ml) was subjected to electroporation in 100 μl of electroporation buffer (272 mM sucrose, 15% glycerol, which was filter sterilized [0.2-μm-pore-size filter; Millipore]) with a 0.1-cm gap cuvette (BTX Inc., San Diego, Calif.). The samples were electroporated at 2.5 kV, 200 Ω, and 25 μF, with a time constant of approximately 5 ms (nonelectroporated controls remained on ice). Immediately, 400 μl of cold SPG buffer (0.218 M sucrose, 0.0038 M KH₂PO₄, 0.0072 M K₂HPO₄, and 0.0049 M l-glutamate [pH 7.2]) was added to the cuvette. The electroporated R. typhi PFU were then grown in Vero cells in the presence of rifampin, chloramphenicol, doxycycline, or erythromycin (1, 2, 4, 8, or 100 μg/ml) (Sigma Chemical Co., St. Louis, Mo.) in Dulbecco modified Eagle medium and 1% fetal bovine serum at 34°C. After 8 days, samples were assayed for detection of Rickettsia by indirect fluorescent-antibody assay (7) with monoclonal antibody T62-3-A6 (mouse anti-R. typhi lipopolysaccharide, kindly provided by D. H. Walker, University of Texas Medical Branch at Galveston, Tex.) and by dye uptake assay (8) for antibiotic susceptibility.

Rifampin-resistant R. typhi (Rif mutant) was detected in the electroporated sample. The mutant, grown in the presence of 100 μg of rifampin per ml, infected 75% of the Vero cells by day 8 postinfection (approximately 10⁹ bacteria/ml of culture). In contrast, 1.0 μg of rifampin per ml inhibited growth of wild-type R. typhi (Ethiopian) in the control groups (R. typhi with no electroporation). Rickettsial growth was not detected by indirect fluorescent-antibody assay on day 8 in these samples (data not shown). All R. typhi (with or without electroporation) incubated without rifampin infected approximately 75% of the Vero cells on day 8. The rifampin-resistant R. typhi isolate remained susceptible to chloramphenicol (MIC = 1 μg/ml), doxycycline (MIC = 1 μg/ml), and erythromycin (MIC = 2 μg/ml); these values are comparable to that for the susceptibility of wild-type R. typhi; therefore, electroporation did not affect the Rickettsia susceptibilities to these antibiotics.

Both the wild-type R. typhi (Ethiopian) rpoB gene and the Rif mutant (Ethiopian) rpoB gene were amplified by PCR, cloned, and sequenced. Primers (Table 1) were selected on the basis of the rpoB gene sequence of Rickettsia prowazekii (GenBank accession no. Z82356). The PCR included 10 μM each primer, 0.5 μg of R. typhi genomic DNA, 47 μl of PCR Supermix (Gibco), and an overlay of 50 μl of mineral oil. All reactions consisted of 25 cycles each, with an initial denaturing temperature of 94°C for 1 min, the specified annealing temperature (Table 1) for 90 s, and an extension temperature of 72°C for 2 min on a DNA thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.). PCR products were cloned with the TA cloning kit (Invitrogen) and sequenced by the dye terminator method with an automated sequencer (model 373; Applied Biosystems, Foster City, Calif.). All gene segments were sequenced a minimum of two times (forward and reverse each time) to allow detection and elimination of errors in the sequencing process.

TABLE 1.

Oligonucleotide primers used for PCR amplification of the R. typhi rpoB gene

Primer name	5′ position	Sequence (5′–3′)	Annealing tempa (°C)
1fwd	5–18	GGTTTCATTAAGGG	45
1rev	520–502	GATAAAAGAATACACCTG	45
2fwd	466–488	CGGAAAGAGTAGTTGTATCACA	37
2rev	673–656	TGCTGCCTCACGGTCCT	37
3fwd	1139–1156	AGGACCGTGAGGCAGCA	37
3rev	1708–1688	CGACCGTAATGAGTAGGATG	37
4fwd	1654–1671	AGACTTTCAGCCCTTGG	50
4rev	2089–2072	CGGTTCGCATCATCATT	50
5fwd	2083–2098	TTAGAAAATGATGAT	46
5rev	2594–2577	AGGACCAAGGCGTGTAT	46
6fwd	2592–2609	AGATACACGCCTTGGTC	46
6rev	3122–3105	TTCATTCATTACATTTG	46
7fwd	3122–3139	CAAATGTAATGAATGAA	45
7rev	3889–3872	CCACCAAAATGAGACTT	45
8fwd	3839–3856	ATTCACTCTCGTTCTAT	45
8rev	4105–4088	AGCTTTACGTTGAGACA	45

^aAnnealing temperature used during PCR amplification. 

The sequences of wild-type and Rif mutant R. typhi rpoB genes were compared. The rpoB sequence was 4,127 bp, and identity between R. typhi and the R. typhi Rif mutant was approximately 99.8%. A total of eight nucleotide substitutions occurred, three of which resulted in amino acid substitutions in the Rif mutant RpoB: leucine for phenylalanine at residue 151, phenylalanine for leucine at residue 201, and valine for isoleucine at residue 271.

The mutations described in our study (residues 151, 201, and 271) do not correspond exactly to amino acid substitutions seen in rifampin-resistant Escherichia coli (4, 5, 10) or rifampin-resistant Mycobacterium spp. (3, 6, 11). However, identity of the rpoB gene between Rickettsia and rpoB of E. coli or Mycobacterium is less than 40%, so a direct correlation is not expected. Many of the amino acid substitutions in the RpoB of rifampin-resistant E. coli occur between residues 500 and 600. However, one rifampin-resistant E. coli isolate was characterized with an amino acid substitution at residue 146 of RpoB (5). This substitution is located closer to the R. typhi amino acid substitutions (residues 151, 201, and 271). At present, it is unclear if one or all three of the mutations are responsible for the rifampin resistance in R. typhi. In future research we will address this issue by mutating the rpoB genes in these specific areas and subsequently assessing rifampin sensitivity.

Nucleotide sequence accession number.

The GenBank accession number for the wild-type R. typhi rpoB gene sequence is U73742.