A novel splice variant of the human MSTN gene encodes a myostatin‐specific myostatin inhibitor

Abstract

Background

Myostatin, encoded by the MSTN gene comprising 3 exons, is a potent negative regulator of skeletal muscle growth. Although a variety of myostatin inhibitors have been invented for increasing muscle mass in muscle wasting diseases, no effective inhibitor is currently available for clinical use. Myostatin isoforms in several animals have been reported to inhibit myostatin, but an isoform has never been identified for the human MSTN gene, a conserved gene among animals. Here, a splice variant of the human MSTN gene was explored.

Methods

Transcripts and proteins were analysed by reverse transcription‐PCR amplification and western blotting, respectively. Proteins were expressed from expression plasmid. Myostatin signalling was assayed by the SMAD‐responsive luciferase activity. Cell proliferation was assayed by the Cell Counting Kit‐8 (CCK‐8) assay and cell counting. Cell cycle was analysed by the FastFUCCI system.

Results

Reverse transcription‐PCR amplification of the full‐length MSTN transcript in CRL‐2061 rhabdomyosarcoma cells revealed two bands consisting of a thick expected‐size product and a thin additional small‐size product. Sequencing of the small‐size product showed a 963‐bp deletion in the 5′ end of exon 3, creating exon 3s, which contained unusual splice acceptor TG dinucleotides. The novel variant was identified in other human cell lines, although it was not identified in skeletal muscle. The 251‐amino acid isoform encoded by the novel variant (myostatin‐b) was identified in CRL‐2061 rhabdomyosarcoma cells. Transfection of a myostatin‐b expression plasmid into CRL‐2061 and myoblast cells inhibited endogenous myostatin signalling (44%, P < 0.001 and 63%, P < 0.001, respectively). Furthermore, myostatin‐b inhibited myostatin signalling induced by recombinant myostatin (68.8%, P < 0.001). In remarkable contrast, myostatin‐b did not inhibit the myostatin signalling induced by recombinant growth differentiation factor 11 (9.2%, P = 0.70), transforming growth factor β (+3.1%, P = 0.83) or activin A (+1.1%, P = 0.96). These results indicate the myostatin‐specific inhibitory effect of myostatin‐b. Notably, the expression of myostatin‐b in myoblasts significantly enhanced cell proliferation higher than the mock‐transfected cells by the CCK‐8 and direct cell counting assays (60%, P < 0.05 and 39%, P < 0.05, respectively). Myostatin‐b increased the percentage of S‐phase cells significantly higher than that of the mock‐transfected cells (53% vs. 80%, P < 0.05).

Conclusions

We cloned a novel human MSTN variant produced by unorthodox splicing. The variant encoded a novel myostatin isoform, myostatin‐b, that inhibited myostatin signalling by myostatin‐specific manner and enhanced myoblast proliferation by shifting cell cycle. Myostatin‐b, which has myostatin‐specific inhibitory activity, could be developed as a natural myostatin inhibitor.

Introduction

Myostatin, also known as growth differentiation factor 8 (GDF8), is one of the members of the transforming growth factor β (TGF‐β) superfamily and is a potent negative regulator of skeletal muscle growth. ¹ It is encoded in a 2823‐bp transcript transcribed from the MSTN gene that comprises 3 exons and spreads over 7 kb on chromosome 2. ² Myostatin, a secretory protein, is synthesized in skeletal muscle as a precursor that undergoes maturation steps. ³ , ⁴ The inactive precursor (pro‐myostatin) comprises 375 amino acid residues, with an N‐terminal signal peptide, a prodomain and a C‐terminal active growth factor domain. ¹ It is cleaved by a furin to produce the latent myostatin complex, which is further cleaved by metalloproteinase, allowing the release of the active domain. The mature active domain binds and activates receptors on the surface of muscle cells.

Knocking out the myostatin gene in mice resulted in a two‐ to three‐fold increase in muscle mass. ⁵ Mutations in the MSTN gene have been reported to produce the double muscled phenotype in animals such as cattle, sheep and dogs. ⁶ , ⁷ , ⁸ , ⁹ Consistent with the fact that the MSTN gene is highly conserved among animals, ¹ a mutation in the human MSTN gene produced remarkably increased musculature in a child. ¹⁰ Therefore, myostatin inhibition has become an attractive prospect for increasing muscle mass in muscle wasting conditions, such as muscular dystrophy, sarcopenia and cancer‐associated cachexia. ¹¹ , ¹² Multiple therapeutic agents, such as an anti‐active domain antibody, a soluble decoy receptor, a myostatin adnectin and modified follistatin and antisense oligonucleotides, have been shown to have effective myostatin blocking activity in preclinical studies. ¹³ , ¹⁴ , ¹⁵ However, clinical trials of these myostatin inhibitors did not demonstrate functional improvement in muscular dystrophies. ¹⁵ The development of clinically effective myostatin inhibitors is still awaited.

Alternative splicing of pre‐mRNA is a mechanism that allows the generation of multiple transcripts that differ in terms of the usage of exons and subsequently produce structurally and functionally distinct proteins from a given gene. Although nearly all multiexon human genes are alternatively spliced, ¹⁶ alternative splicing has never been observed for the human MSTN gene. A splice variant of the MSTN gene was first described in the developing skeletal muscle of ducks. ¹⁷ Subsequently, an MSTN splice variant was discovered in the skeletal muscles of avians, such as chickens, turkeys and quails. ¹⁸ In mammals, a splice variant was first disclosed in sheep skeletal muscle. ¹⁹ Remarkably, myostatin isoforms, protein products from splice variants, have been shown to inhibit myostatin in avians and sheep. ¹⁸ , ¹⁹ Furthermore, a myostatin isoform expressed from a vector was shown to lead to muscle fiber hyperplasia in avians. ²⁰ These results strongly suggest the possibility that the identification of a human MSTN splice variant could enable the identification of a natural myostatin inhibitor.

Here, a splice variant of the human MSTN gene was explored in rhabdomyosarcoma, a high‐grade neoplasia of skeletal myoblast‐like cells. A novel MSTN splice variant was cloned and predicted to encode an isoform of myostatin‐b. Remarkably, myostatin‐b inhibited myostatin signalling in a myostatin‐specific manner. Myostatin‐b expression enhanced the proliferation of myoblasts by shifting the cell cycle. Myostatin‐b is a natural myostatin inhibitor with high potential for clinical use.

Materials and methods

Cell lines

CRL‐2061 and CCL‐136 rhabdomyosarcoma cells, HEK293 embryonic kidney cells, HeLa cervical carcinoma cells, AGS gastric adenocarcinoma cells and HepG2 hepatocellular carcinoma cells were purchased from ATCC (Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM; 4.5 g/L glucose) or Roswell Park Memorial Institute (RPMI) 1640 (Nacalai Tesque, Inc., Kyoto, Japan) supplemented with 10% foetal bovine serum (FBS) (Gibco by Life Technologies, Grand Island, NY, USA) and 1% antibiotic–antimycotic solution (Nacalai Tesque, Inc.) at 37°C in a humidified incubator with 5% CO₂.

Human myoblasts, generated by the immortalization of primary cultured human myogenic cells, were a kind gift from Dr. Hashimoto. ²¹ Myoblast cells were grown in DMEM supplemented with 20% FBS, 2% Ultroser G (Pall Life Sciences, NY, USA) and 1% antibiotic–antimycotic solution (Nacalai Tesque, Inc.) at 37°C in a humidified incubator with 5% CO₂ as described previously. ²²

Transcript analysis

Cultured cells were rinsed twice with phosphate‐buffered saline (Nacalai Tesque, Inc.) and then collected using the lysis/binding buffer of the High Pure RNA isolation kit (Roche Diagnostics, Basel, Switzerland). RNA was extracted using the High Pure RNA isolation kit (Roche Diagnostics). Human total RNA from the brain, kidney, liver, small intestine, colon, heart, skeletal muscle and uterus was obtained from a Human Total RNA Master Panel II (Clontech Laboratories, Inc., Mountain View, CA, USA). cDNA was synthesized from 0.5‐μg samples of total RNA using random primers as described previously. ²³ The MSTN transcript was PCR amplified using a set of primers on exons 1 and 3 (MSTN Ex1F3, 5′‐tggctctttggaagatgacg‐3′ and MSTN Ex3R, 5′‐cgtgattctgttgagtgctcat‐3). ²⁴ To amplify a full length of the MSTN transcript, another set of primers was designed in the far deep 5′ and 3′ untranslated regions (MSTN Ex1F1, 5′‐agattcactggtgtggcaag‐3′ and MSTN R2, 5′‐tgcatgacatgtctttgtgc‐3′). The sequences of the human MSTN gene and cDNA were obtained with the following accession numbers: NCBI NG_009800.1 and NCBI NM_005259.2, respectively. The integrity and concentration of the cDNA were examined by amplifying the mRNA of the housekeeping gene glyceraldehyde 3‐phosphate dehydrogenase (GAPDH). PCR amplification and sequencing of amplified products were performed as described previously. ²²

Splice site analysis

The splicing probability score was calculated by the equation by the Shapiro–Senapathy algorithm. ²⁵ Branch points were searched using an algorithm (Human Splicing Finder 3.1 [http://www.umd.be/HSF3/index.html]).

Expression of pro‐myostatin and myostatin‐b

Plasmids for pro‐myostatin and myostatin‐b expression were constructed by inserting the coding sequences of pro‐myostatin (2823 bp) and myostatin‐b (1860 bp) into the mammalian expression vector pcDNA3.1(+) with a cytomegalovirus (CMV) promoter (Invitrogen, Thermo Fisher Scientific, Inc., Carlsbad, CA, USA). These constructs were synthesized by FASMAC Co., Ltd., and their sequences were confirmed by sequencing. The plasmids carrying either the pro‐myostatin and myostatin‐b coding sequences or the empty pcDNA3.1(+) vector were transfected into HeLa cells. Cells (2 × 10⁵) grown to 80% confluency on 12‐well culture dishes were transfected with 2 μg of the synthesized plasmids in 4 μL of Lipofectamine 3000 (Thermo Fisher Scientific, Inc.). After incubation for 24 h, the cells were harvested, lysed in Cell Lysis Buffer (Cell Signaling Technology Inc., Danvers, MA, USA) containing protease inhibitors and sonicated. After incubation on ice for 10 min, the lysates were centrifuged at 12 000 g for 10 min to remove insoluble material. The protein concentrations of the cell lysates were determined using Qubit Protein Assay kits (Thermo Fisher Scientific, Inc.).

Western blotting

Lysates of cells transfected with pro‐myostatin or myostatin‐b plasmids and CRL‐2061 cells (4 × 10⁵) were analysed by western blotting. Briefly, lysates containing 20 μg of protein were mixed 3:1 with Laemmli Sample Buffer (Bio‐Rad Laboratories, Inc., Hercules, CA, USA) containing 0% or 10% 2‐mercaptoethanol and boiled for 5 min. These samples and protein size markers (Protein Ladder One Plus, Triple‐color for SDS‐PAGE; Nacalai Tesque, Inc.) were loaded onto MINI‐PROTEAN TGX Precast Gels 4–20% (Bio‐Rad Laboratories, Inc.). Following electrophoresis, the proteins were transferred to PVDF Transfer Membranes (Trans‐Blot Turbo Mini PVDF Transfer Packs, Bio‐Rad Laboratories, Inc.). The membrane was blocked with 2% ECL Prime Blocking Reagent (GE Healthcare, Little Chalfont, UK). The primary antibody reaction was performed overnight using rabbit monoclonal antibodies against a synthetic peptide corresponding to amino acids 1–300 of the N‐terminal domain and 267–375 of the C‐terminal domain of human myostatin (ab236511, Abcam, Cambridge, UK; and AF788, R&D Systems, Minneapolis, MN, USA, respectively) at dilutions of 1:2000 and 1:10 000. Actin antibody (C4, Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) was also used at a dilution of 1:5000. The myostatin–anti‐myostatin and actin–anti‐actin immune complexes were detected with anti‐mouse IgG (GE Healthcare). Immunoreactive bands were detected with ECL Select Western Blotting Detection Reagent (GE Healthcare).

SMAD‐responsive luciferase assay

Myostatin signal activity was assayed using the SBE4‐Luc luciferase reporter gene containing the Smad‐binding sequence (CAGA) (#16495, Addgene, Watertown, MA, USA). ²⁶ Rhabdomyosarcoma or HeLa cells were seeded at a density of 2 × 10⁵ cells per well in 12‐well plates for 24 h before transfection with the SBE4‐Luc luciferase reporter gene and pSV‐β‐galactosidase control vector (#E1081, Promega, Madison, WI, USA) and either the empty vector (pcDNA3.1(+)) or pcDNA3.1(+) harbouring pro‐myostatin and myostatin‐b sequences. After 24 h, the medium was replaced with serum‐free RPMI 1640 or DMEM containing recombinant myostatin (788‐G8, R&D Systems), recombinant growth differentiation factor 11 (GDF11) (1958‐GD, R&D Systems), recombinant TGF‐β1 (240‐B/CF, R&D Systems) or recombinant activin A (338‐AC/CF, R&D Systems). After an additional 24 h of culture, the cells were processed, and their luciferase and β‐galactosidase activities were analysed using a luciferase reporter assay system and a β‐galactosidase enzyme assay system, respectively (Promega). All experiments were performed in triplicate. Activity was normalized to β‐galactosidase activity and expressed as relative luminescence units (RLUs), as calculated by the following equation: RLU = luminescence/absorbance reading of β‐galactosidase.

Cell proliferation assay

Myoblasts (1 × 10³ per well) were plated in triplicate in 96‐well plates. After 24 h, the cells were transfected with 100 ng of pcDNA3.1(+) containing the coding sequence for pro‐myostatin, myostatin‐b or no insert in 0.4 μL of Lipofectamine 3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Three hours later, the media were replaced by DMEM. For the Cell Counting Kit‐8 (CCK‐8, Dojindo, MD, USA) assay, 10 μL of CCK‐8 solution was added to each well at 24, 48 and 72 h after transfection. The absorbance of each well at 450 nm was determined using a microplate reader (ARVO X3, PerkinElmer). The results shown are representative of three identical experiments.

Cells in a microscopic field of each well captured by the ×4 Plan Fluor lens of a BZ‐X710 fluorescence microscope (Keyence, Osaka, Japan) were counted 0, 24, 48 and 72 h after transfection and analysed using BZ‐X analytic software. The same area of each well was analysed at each time point. The numbers of cells were reported as the average of three wells containing the same cell populations. The results shown are representative of three identical experiments.

FastFUCCI cell cycle assay

The fluorescent ubiquitination‐based cell cycle indicator (FUCCI) is a method for visualizing the cell cycle of live cells. In this system, cells in G1 and S/G2/M phases emit red from monomeric Kusabira Orange 2 (mKO2) and green from monomeric Azami Green (mAG) fluorescence, respectively. In addition, cells in early S phase emit both types of fluorescence. FastFUCCI that has all FUCCI genes under the control of a single promoter was developed. ²⁷ pBOB‐EF1‐FastFUCCI‐Puro was a gift from Kevin Brindle and Duncan Jodrell (Addgene plasmid #86849; http://n2t.net/addgene:86849; RRID:Addgene_86849).

Statistical analyses

All assays were repeated three times to ensure reproducibility. Results reported as the mean ± SE were analysed by one‐way analysis of variance (ANOVA) and least significant difference (LSD) test. All statistical analyses were performed using SPSS software (Version 17.0; SPSS Inc., Chicago, IL, USA), with P < 0.05 considered to indicate statistical significance.

Results

Identification of a splicing variant of the MSTN gene

To examine the production of splicing variants of the MSTN gene, MSTN transcripts were analysed in CRL‐2061 rhabdomyosarcoma cells, a high‐grade neoplasia of skeletal myoblast‐like cells, by reverse transcription (RT)‐PCR amplification (Figure 1 A ). Amplification using a conventional set of primers on exons 1 and 3 revealed one expected‐size product (531 bp) without any aberrant size product (Figure 1 B ). This matched with the consensus that the MSTN gene produces only one mRNA. To further explore splicing variants, a full length of the MSTN transcript (2328 bp) was amplified using primers designed on the deep 5′ and 3′ untranslated regions (Figure 1 A ). Remarkably, this amplification revealed two bands consisting of a thick expected‐size product and a thin additional small‐size product located near the 1500‐bp size marker (Figure 1 B ). Sequencing of the small‐size product revealed sequences of exons 1 and 2 and an ambiguous sequence downstream of exon 2. Notably, the ambiguous sequence matched completely with that of the 3′ end of exon 3. The results indicated that 963 bp of the 5′ end of exon 3 was deleted from the MSTN transcript. As a result, the size of exon 3 was shortened from 1939 to 976 bp, creating exon 3s (deposited as GenBank, MZ436933) (Figure 1 B ). It was concluded that a novel MSTN transcript containing exon 3s was expressed in rhabdomyosarcoma cells. In a parallel examination of total RNA from skeletal muscle, the novel transcript was not observed, and the normal product was observed (Figure 1 B ).

Figure 1.

Identification of a novel variant of the MSTN gene. (A) PCR amplified fragments of MSTN cDNA. Schematic structure of the human MSTN cDNA is shown. Two fragments covering the coding region (MSTN‐C) or the full length (MSTN‐F) were PCR amplified (bracket). The box and number in the box indicate the exon and exon number, respectively. Numbers over the box indicate the size of exons. Amplified sizes are described over the bracket. The shaded region represents the coding region. (B) Amplified products of the MSTN transcript. Electropherograms of the PCR‐amplified products are shown. Amplification of the coding region (MSTN‐C) of the MSTN transcript revealed a band in CRL‐2061 rhabdomyosarcoma cells (CRL) and skeletal muscle cells (Sk) but not in HeLa (HeLa) cells (left middle). In contrast, PCR amplification of the full length (MSTN‐F) revealed two products in CRL‐2061 cells (CRL) and one expected‐size product in skeletal muscle (Sk) (left top). As an internal control, glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was amplified (left bottom). The exon structures of the amplified products are schematically described on the right side. Box and number in the box indicate exon and exon number, respectively. Some sequences at the junction of exons 2 and 3s are shown under the exon structure. The small product in CRL‐2061 cells lacked 963 bp from exon 3, creating exon 3s. (C) Characteristics of the cloned nucleotide sequences. The sequences of MSTN cDNA and the variant are described. In the variant sequence, 963 bp from the 881st to 1843rd nucleotide of the MSTN cDNA sequence was not present (open boxes), while all other sequence regions remained intact. As a result, a shortened, 963‐bp exon 3 (exon 3s) was created. Vertical lines indicate the identical nucleotides. The splice acceptor site (TG) and consensus broch point sequences (CTAAT) are marked red and green, respectively. AG dinucleotides with the highest probable splicing acceptor site score (90) (coloured in red) are present 366 bp upstream from the alternative splice site. (D) Amino acid sequence translated from the novel transcript. Nucleotide and its translated amino acid sequences of exon 3s are shown (upper line) together with those of exon 3 of the pro‐myostatin transcript (lower line). Exon 3s of the variant encoded a TGA stop at the third codon. The first N residue matches that of pro‐myostatin. Numbers indicate the amino acid residues of myostatin. (E) Structure of myostatin‐b. The structure of myostatin‐b is schematically described (top). Pro‐myostatin, comprising 375 amino acids, consists of a signal domain, prodomain and active domain (bottom). Myostatin‐b is composed of 251 amino acids, and 250 out of 251 amino acids are identical to those of pro‐myostatin. Myostatin‐b has 2 amino acids in exon 3s instead of 126 amino acids, as in exon 3, implying an isoform that is 124 amino acids shorter.

Alternative splicing‐mediated activation of a cryptic splice acceptor site is supposed to be a mechanism for producing exon 3s. At the presumed splice acceptor site, TG dinucleotides were identified, making Shapiro's splicing probability score low (Figure 1 C ). However, penta CTAAT nucleotides matching perfectly with the human consensus branch point sequence (yUnAy) ²⁸ were identified 12 bp upstream from the splice site (Figure 1 C ). Considering that TG dinucleotides are a rare splice acceptor site sequence, ²⁹ it was concluded that exon 3s is produced by activation of the cryptic splice acceptor site embedded in the 3′ untranslated region of the MSTN gene.

It was suspected that the identified transcript was specific to CRL‐2061 cells because the novel transcript was not amplified in skeletal muscle where the MSTN gene is actively expressed. To examine the versality of the novel transcript expression, the full length of the MSTN transcript was analysed by RT‐PCR amplification in other human cell lines and tissues (Figure  2 ). In six human cell lines, the novel transcript was observed in two cell lines, CCL‐136 rhabdomyosarcoma cells and myoblast cells, but not in HeLa, HEK293, HepG2 and AGS cells. Of seven assessed human tissues, no tissue had the novel transcript. It was concluded that the novel transcript is not a specific product in CRL‐2061 rhabdomyosarcoma cells but is expressed in other myogenic cells.

Figure 2.

Amplification of the MSTN transcript in human cells and tissues. The full‐length MSTN cDNA was PCR amplified from seven human cell lines (A) and eight tissues (B). Electropherograms of the amplified products are shown. Normal‐sized bands and additional small‐sized bands were revealed in CCL‐136 cells and myoblasts, as in CRL‐2061 cells. In tissues, the normal‐size product was not revealed in any tissues except skeletal muscle. Black and open arrowheads indicate normal MSTN cDNA and the MSTN variant, respectively. * indicates a nonspecific product.

Production of a myostatin isoform from the novel variant sequence

The identified splicing variant was highly likely to produce a myostatin isoform. Then, amino acid sequences encoded by the variant were estimated (Figure 1 D ). The sequence comprising exons 1 and 2 was predicted to encode 249 amino acids identical to those of pro‐myostatin. In the exon 3s sequence, the 250th and 251st codons (AAT and GTC) encoded asparagine (N) and valine (V), respectively. Finally, a TGA stop codon appeared at the third 252nd codon, leaving the rest of the sequences as the noncoding sequence. As a result, the variant was estimated to encode a protein comprising 251 amino acid residues, and this isoform was named myostatin‐b. In other words, myostatin‐b is a short isoform deleting the active domain (Figure 1 E ).

Identification of endogenous myostatin‐b

Myostatin‐b was expected to be expressed from the variant transcript in CRL‐2061 cells. For references in the western blot assay, two expression plasmids (pcDNA3.1(+) plasmid with myostatin‐b or pro‐myostatin nucleotide sequences) were prepared and transfected into HeLa cells. Then, lysates of CRL‐2061 cells and HeLa cells transfected with pro‐myostatin or myostatin‐b plasmids were analysed by western blot assay using an N‐terminal antibody against pro‐myostatin as the primary antibody. A band located at approximately 40‐kDa size was identified and matched the position of the comigrating artificial myostatin‐b (Figure  3 ). In addition, a band above the 75‐kDa size marker was detected, matching the band for pro‐myostatin. These results indicated that myostatin‐b was expressed in CRL‐2061 rhabdomyosarcoma cells.

Figure 3.

Identification of endogenous myostatin‐b. (A) Plasmids encoding myostatin‐b and pro‐myostatin were constructed. Sequences of myostatin‐b (2823 bp) and pro‐myostatin (1860 bp) were inserted into the pcDNA3.1(+) expression plasmid encoding the promoter and polyadenylation signal. (B) Lysates of CRL‐2061 cells were analysed by western blot assay using an N‐terminal antibody. Immunoblotting results are shown. A weak band located at the position corresponding to artificial myostatin‐b was revealed (arrow) in the lysates (CRL‐2061). Artificially expressed pro‐myostatin and myostatin‐b were co‐electrophoresed (pro‐myostatin and myostatin‐b, respectively).

Inhibition of myostatin signalling by myostatin‐b

Myostatin‐b was assumed to inhibit myostatin signalling, because myostatin isoforms in avians have been reported to inhibit myostatin signalling. ¹⁸ To explore this assumption, myostatin signalling activity was assayed using a TGF‐β‐sensitive Smad‐responsive luciferase reporter gene. ¹¹ , ³⁰ The reporter (Luc) gene and the pSV‐β‐galactosidase control vector (Gal) were transfected into both CRL‐2061 cells and myoblasts. Accordingly, luciferase activity was clearly detected in both cell lines, reflecting endogenous myostatin expression (Figure 4 A ). Cotransfection with the pro‐myostatin plasmid further increased the activity in both cell lines. Remarkably, cotransfection with the myostatin‐b plasmid significantly reduced the luciferase activity in both cell lines (44%, P < 0.001 and 63%, P < 0.001, respectively) (Figure 4 A ). These results indicated that myostatin‐b inhibits endogenous myostatin signalling.

Figure 4.

Inhibition of endogenous myostatin activity with myostatin‐b. (A) Myostatin signalling activity was assayed by a cell‐based assay system. The reporter Luc and Gal plasmids were transfected into CRL‐2061 cells and myoblast cells. Luciferase activity was measured in both cell lines. Furthermore, these cells were cotransfected with myostatin‐b or pro‐myostatin plasmids. The luciferase activity of each cell group is shown as a bar (upper, CRL‐2061; lower, myoblasts). The data are expressed as the mean ± SEM of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001. (B) Dose‐dependent changes in luciferase activity with myostatin‐b and pro‐myostatin plasmid transfection. CRL‐2061 cells were cotransfected with different amounts of myostatin‐b and pro‐myostatin plasmids and Luc and Gal plasmids, and the luciferase activity of transfected cells was measured. The activity increased with increasing myostatin‐b plasmid concentrations, while it decreased with increasing pro‐myostatin plasmid concentrations. The data are expressed as the mean ± SEM of three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001. RLU, relative luminescence unit.

To confirm the inhibitory effect of myostatin‐b on myostatin signalling, the dose of myostatin‐b plasmid was changed from 0 to 2 μg (Figure 4 B ). As expected, luciferase activity decreased with the increase in the dose of myostatin‐b plasmid. Moreover, the pro‐myostatin plasmid increased luciferase activity. Myostatin‐b was concluded to inhibit endogenous myostatin signalling.

Myostatin‐specific inhibition by myostatin‐b

We assessed whether myostatin‐b affected myostatin signalling by TGF‐β family members. First, we examined whether the reporter system in HeLa cells reacted with exogenous myostatin (Figure 5 A ). Recombinant myostatin at concentrations of 0, 20, 40 and 60 ng/mL in the culture medium increased the luciferase activity in a dose‐dependent manner (Figure 5 A ). When myostatin‐b was cotransfected, the luciferase activity significantly decreased at concentrations of 20, 40 and 60 ng/mL recombinant myostatin (Figure 5 A ). In the case of 60 ng/mL recombinant myostatin, myostatin‐b abolished nearly 70% of the activity (68.8%, P < 0.001). Next, recombinant GDF11, recombinant TGF‐β1 and recombinant activin A were added to the culture medium of HeLa cells transfected with both the Luc and Gal plasmids. As expected, recombinant GDF11 at concentrations from 0 to 30 ng/mL increased luciferase activity in a dose‐dependent manner (Figure 5 B ). In contrast to the results observed for recombinant myostatin, coexpression of myostatin‐b did not significantly decrease the luciferase activity at any concentration of recombinant GDF11 (9.2%, P = 0.70) (Figure 5 B ). Consequently, the addition of recombinant TGF‐β1 at 0, 0.5, 1 and 2 ng/mL and activin A at 0, 10, 20 and 30 ng/mL increased the luciferase activity in a dose‐dependent manner. However, these activities were not decreased significantly by coexpression of myostatin‐b (+3.1%, P = 0.83 in TGF‐β and +1.1%, P = 0.96 in activin A) (Figure 5 C,D , respectively). These results indicated that myostatin‐b inhibited myostatin signalling in a myostatin‐specific manner.

Figure 5.

Myostatin‐specific inhibition by myostatin‐b. HeLa cells cotransfected with Luc and Gal plasmids were treated with recombinant myostatin at concentrations of 0, 20, 40 and 60 ng/mL (A); recombinant growth differentiation factor 11 (GDF11) at concentrations of 0, 10, 20 and 30 ng/mL (B); recombinant transforming growth factor β1 (TGF‐β1) at concentrations of 0, 0.5, 1 and 2 ng/mL (C); and activin A at concentrations of 0, 10, 20 and 30 ng/mL (D). In addition, the myostatin‐b plasmid was cotransfected into each treated cell. The results of luciferase activity are shown. Myostatin‐b inhibited myostatin signalling induced only by recombinant myostatin but not by recombinant GDF11, recombinant TGF‐β1 or recombinant activin A (red bars). The data are expressed as the mean ± SEM of three independent experiments. **P < 0.01, ***P < 0.001. RLU, relative luminescence unit.

Myostatin‐b enhanced the proliferation of myoblasts

Myostatin‐b was analysed for the proliferation of human myoblast cells. Myostatin‐b, pro‐myostatin and mock plasmids were transfected into immortalized human myoblasts. The cells were quantified by the CCK‐8 assay and microscopic cell counting for 3 days. In the CCK‐8 assay, the absorbance increased in all three cell groups (mock‐, myostatin‐b‐ and pro‐myostatin‐transfected cells) (Figure 6 A ). Notably, the absorbance of the cells transfected with the myostatin‐b plasmid was significantly higher at 72 h than that of cells transfected with the mock plasmid (60%, P < 0.05), indicating cell proliferation enhancement by myostatin‐b. In contrast, the absorbance of cells transfected with the pro‐myostatin plasmid was significantly decreased at 72 h compared with that of the mock‐transfected cells (28%, P < 0.05).

Figure 6.

Enhancement of myoblast proliferation by myostatin‐b expression. (A) Cell Counting Kit‐8 assay of the proliferation of myoblasts transfected with mock, pro‐myostatin and myostatin‐b plasmids from 0 to 72 h. The absorbance of cells expressing myostatin‐b was significantly higher than the absorbance of mock‐transfected cells. Absorbance is expressed as the mean ± SEM of three independent experiments. *P < 0.05. (B) Time course of the numbers of myoblasts transfected with mock, pro‐myostatin and myostatin‐b plasmids from 0 to 72 h. Cells were counted in 1‐mm² areas of each well at 0, 24, 48 and 72 h. The data are expressed as the mean ± SEM of three independent experiments. Scale bar is 200 μm. *P < 0.05.

Direct cell counting using a fluorescence microscope showed that, despite the seeding of the same number of cells in each well, the density of cells transfected with the plasmid expressing myostatin‐b was higher than that of the mock‐transfected cells (Figure 6 B ). Cell counting over time showed that the numbers of cells increased over time in all three transfected cell groups. Notably, the number of cells in the myostatin‐b plasmid transfection group was significantly higher than that of the mock plasmid transfection group at 72 h (39%, P < 0.05) (Figure 6 B ). However, the number of cells in the pro‐myostatin plasmid group was significantly lower than that in the mock plasmid group at 72 h (22%, P < 0.05) (Figure 6 B ). These results indicated that myostatin‐b is an enhancer of myoblast cell proliferation.

Myostatin‐b increases the number of cells in S phase

As myostatin‐b enhanced myoblast proliferation, the effects of myostatin‐b on the cell cycle were analysed using the FastFUCCI system, which enables monitoring living cell cycle changes by time‐lapse analysis. In myoblast cells transfected with myostatin‐b, pro‐myostatin or mock plasmid and FastFUCCI, fluorescence was captured at 4‐h intervals for 24 h after transfection. The percentages of G2/M‐, S‐ and G1‐phase cells were calculated. There was no significant difference in these percentages until 20 h (Figure 7 A ). At 24 h, remarkably, the percentage of myostatin‐b‐expressing cells in S phase was significantly higher than that of mock‐transfected cells (53% vs. 80%, P < 0.05) (Figure 7B ). No significant difference was disclosed in G2/M‐ and G1‐phase cells among the three cell groups. This indicated that myostatin‐b shifted the cell cycle to enable cell proliferation.

Figure 7.

Myostatin‐b increased the number of S‐phase myeloblasts. FastFUCCI analysis of myoblasts transfected with mock, pro‐myostatin or myostatin‐b plasmids was conducted for 24 h. (A) Percentages of S‐phase cells were calculated in three cells every 4 h, and changes over time are shown. A significant difference between cell groups was observed at 24 h. (B) The percentages of G2/M‐, S‐ and G1‐phase cells at 24 h are shown as bars. The percentage of S‐phase cells was significantly higher in the myostatin‐b‐transfected group than in the mock‐transfected group. The data are expressed as the mean ± SEM of three independent experiments. *P < 0.05.

In this study, a splicing variant of the MSTN gene was first identified in humans. The variant encodes myostatin‐b, which inhibits myostatin. Remarkably, its inhibitory effect was myostatin specific, thus providing a novel natural myostatin inhibitor that could be clinically applied in the future.

Discussion

We identified the first splicing variant in the human MSTN gene; this is the second identified variant in mammals (after sheep). These results are reasonable because alternative splicing of the MSTN gene, a well‐conserved gene, has been identified in other animals. ¹⁷ , ¹⁸ Notably, the human variant was not identified in skeletal muscle, where the MSTN gene is highly expressed and where splice variants have been identified in other animals. ¹⁷ , ¹⁹ Before concluding its lack of expression in skeletal muscle, it was necessary to analyse the MSTN transcript in different developmental stages of human skeletal muscle. Alternative splicing of the duck MSTN gene was first identified in developing muscle. ¹⁷ We identified a novel variant in human myoblasts. Further study is needed to determine the expression of the variant throughout development.

There are several reasons why the novel variant was not disclosed before. (1) Northern blot analysis of MSTN transcripts has not been performed in humans, although it successfully revealed a splice variant in sheep. ¹⁹ (2) RT‐PCR amplification of human MSTN mRNA has focused on examining the coding region but not the noncoding region. ³¹ (3) The location of the activated cryptic splice acceptor site in humans was far downstream from the cryptic splice known to occur in sheep. ¹⁹ (4) The activated cryptic splice acceptor site was composed of unusual TG dinucleotides and not common AG dinucleotides. The unusual splice site may have led to the dismissal of the product as a nonspecific product, even when it was cloned. (5) The novel transcript was not expressed in human adult skeletal muscle, where MSTN transcripts have been studied well. In this study, CRL‐2061 rhabdomyosarcoma cells were employed as a starting material for splice variant analysis considering that the cell line has been used as a skeletal muscle surrogate. ³² Altogether, these factors might intermingle to unravel the variant.

Myostatin‐b exerted myostatin inhibitory activity. Isoforms produced by a mechanism of alternative splicing sometimes play antagonistic functional roles to the original role. ³³ Myostatin‐b is an additional example of splicing‐driven functional inversion. Functional inversion of the MSTN gene has been reported in avian isoforms that exert myostatin inhibitory function, inducing an increase in myoblast proliferation. ¹⁸ In other words, the MSTN gene has dual functions in muscle cell growth. Myostatin‐b enhanced the proliferation of myoblasts. With the expression of myostatin‐b, the percentage of S‐phase cell cycle cells was significantly increased compared with that in mock cells. This was compatible with previous reports that myostatin is a negative regulator of cell cycle progression ³⁴ and that myostatin inhibits the progression of myoblasts into S phase of the cell cycle. ³⁵

The myostatin inhibitory function of myostatin‐b was reasonable, because myostatin‐b contains the amino acid residues critical for inhibiting mature myostatin activity. ³⁶ Myostatin‐b with an inhibitory core was expected to exert myostatin inhibition through an inhibitor of metalloprotease cleavage. The most remarkable characteristic of myostatin‐b was its myostatin‐specific inhibitory activity. Although myostatin isoforms in avians and sheep were shown to inhibit myostatin, they have never been examined for cross‐reactivity to GDF11, TGF‐β or activin A. ¹⁸ , ¹⁹ In this study, the myostatin isoform of myostatin‐b was shown to inhibit myostatin signalling in a myostatin‐specific manner for the first time. As GDF11 and myostatin are closely related TGF‐β family members and share 89% sequence identity in their mature form, ³⁷ myostatin inhibitors cross‐inactivate GDF11. Myostatin‐b contains the inhibitory core region, where its derived peptides inhibit not only myostatin but also GDF11. ³⁸ Therefore, myostatin‐b was speculated to cross‐inactivate GDF11. However, it did not inhibit recombinant GDF11 signalling activity. Considering that myostatin‐b is a shortened myostatin prodomain that shares only 48% amino acid sequence identity with GDF11 and that GDF11 has functional significance in the prodomain, ³⁷ myostatin‐b with a part of the prodomain was not expected to inhibit GDF11 through its difference in prodomain. However, the exact mechanism that differentiates the specific inhibitory function remains to be elucidated.

Theoretically, myostatin inhibitors could attenuate, halt or reverse severe and progressive muscle wasting. A range of myostatin inhibitors have been developed, and preclinical studies on these inhibitors have shown promising results. However, no inhibitor has been shown to be effective in human trials. ¹⁵ The development of efficacious myostatin‐specific inhibitors is awaited. Recently, Muramatsu et al. developed a myostatin‐specific antibody that targets the prodomain and showed superior efficiency in restoring muscle strength compared with conventional anti‐myostatin agents. ³⁹ Overexpression of a transgenic quail myostatin isoform consisting of the first 129 amino acids has been reported to increase muscle fiber number and muscle size. ²⁰ As myostatin‐b consists of the first 251 amino acids, myostatin‐b is highly likely to increase muscle size, as shown with the quail isoform. Myostatin‐b, which has myostatin‐specific inhibitory activity, could be developed as a natural type of myostatin inhibitor.

Limitations

This study was done only in cultured cells. As a preclinical study, it is necessary to study the in vivo effect of myostatin inhibition by myostatin‐b. In the next study, recombinant myostatin‐b will be injected into a mouse model. Myostatin‐b was expressed transiently using an expression vector. Therefore, protein–protein interactions were not analysed using pure proteins. The expression of myostatin‐b was not analysed in foetal skeletal muscle because foetal skeletal muscle was not available. To confirm the foetal type of isoform, it is necessary to analyse this foetal period.

Conflict of interest statement

MM is an advisor to JCR Pharma Co., Ltd., Japan, and Daiichi Sankyo Co., Ltd., Japan. KM is employed by KNC Laboratories Co., Ltd., Japan. The study sponsors played no role in the study design; in the collection, analysis and interpretation of the data; in the writing of the report; or in the decision to submit the manuscript for publication. The other authors declare that they have no competing interests.

Funding

This work was supported by the Japan Society for the Promotion of Science Grants‐in‐Aid for Scientific Research (KAKENHI) (21K07875 to MM) and partly by the Practical Research Project for Rare/Intractable Diseases from the Japan Agency for Medical Research and Development (AMED) (JP20ek0109442h0001).

Maeta K, Farea M, Nishio H, Matsuo M (2023) A novel splice variant of the human MSTN gene encodes a myostatin‐specific myostatin inhibitor, Journal of Cachexia, Sarcopenia and Muscle, 14, 2289–2300, 10.1002/jcsm.13314