G protein-coupled bile acid receptor 1 reduced hepatic immune response and inhibited NFκB, PI₃K/AKT, and PKC/P38 MAPK signaling pathway in hybrid grouper

Abstract

The mammalian G protein-coupled bile acid receptor 1 (TGR5) is involved in the inflammatory response. However, the functions of TGR5 in the immune response of fish remain unclear. In this study, the full-length sequence of tgr5 from hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) was cloned, and the function of TGR5 in the immune response was explored. The results showed that the ORF of tgr5 gene in hybrid grouper was 1029 bp and encoded 342 amino acids. Activation of TGR5 by INT-777 significantly decreased the activities and mRNA expression of TNFα and IL1β, whereas inhibition of TGR5 by SBI-115 showed the opposite effect. SBI-115 treatment significantly increased the expression of phosphorylated inhibitor κB α (p-IKBα) protein. After the INT-777 treatment, the concentration of protein kinase C (PKC) and expression of the p38 mitogen-activated protein kinases (p38a), p38b and p38c, were significantly decreased in vivo. INT-777 agonist significantly decreased the expression of phosphorylated phosphoinositide 3-kinase (p-PI₃K) protein and the ratio of phosphorylated and nonphosphorylated serine/threonine-protein kinase (p-AKT/AKT). In conclusion, activation of hepatic TGR5 inhibited the PKC/P38 MAPK, PI₃K/AKT, NFκB signaling pathway and improved hepatic immune responses of hybrid grouper in vivo and in vitro.

The purpose of this study was to explore the roles of hepatic TGR5 in triggering immune responses and ultimately help develop management strategies to control hepatic inflammation and mortality in cultured fish. Understanding the functions of hepatic TGR5 may help scientists develop management strategies to reduce the liver inflammation in hybrid grouper or other fish.

Introduction

G protein-coupled bile acid receptor 1 (TGR5, GPBAR1), as the first G protein-coupled receptor (GPCR) that was discovered in 2002, is also named as membrane-type bile acids (BAs) receptor (Keitel et al., 2020; Xu et al., 2022a). The wide range of hydrophobic endogenous ligands capable of activating TGR5 includes all known BAs and many neurosteroids, including pregnanolone and estradiol (Sato et al., 2008; Martin et al., 2013). Upon binding to the ligand, TGR5 can activate multiple effector pathways to convert extracellular signals into intracellular downstream cascades (Xiong et al., 2018; Xu et al., 2022e). For example, activation of TGR5 regulates the nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB), serine/threonine-protein kinase (AKT), phosphoinositide 3-kinase (PI3K), protein kinase C (PKC), and mitogen-activated protein kinase (MAPK) pathways to participate in energy metabolism, inflammatory responses, carcinogenesis, and liver regeneration in animals (Anwer, 2012; Reich et al., 2016; Chao-Fan et al., 2018; Keitel et al., 2020). Previous studies that have been conducted focus on the analysis of TGR5 expression, localization, and function in mammals (Keitel et al., 2020). However, to date, there have been no studies on the role of TGR5 in aquatic animals, with the exception of zebrafish (Danio rerio) (Xiong et al., 2021).

Chronic inflammation is known to trigger a variety of diseases and TGR5 may be a key and potential target for intervention in some inflammation-induced diseases (Wang et al., 2018b; Xiong et al., 2021; Zhang et al., 2022). For example, activation of TGR5 can differentially suppress inflammatory responses in the lung, liver, stomach, and intestines (Yoneno et al., 2013; Guo et al., 2016a), and TGR5 was able to exhibit strong anti-inflammatory effects in Kupffer cells and macrophages, including significant inhibition of proinflammatory cytokine expression and secretion (Wang et al., 2011; Guo et al., 2016b). Many different downstream signaling pathways have been proposed to contribute to the anti-inflammatory properties of TGR5, and they seem to focus on inhibiting the NFκB pathway (Guo et al., 2016a). Activated NFκB enters the nucleus, which in turn promotes the transcription of proinflammatory cytokines and the ongoing cycle of inflammation, including tumour necrosis factor-α (TNFα), interleukin 1β (IL1β), and IL6 (Xiong et al., 2021). Although the anti-inflammatory effects of TGR5 have been demonstrated in a variety of mammalian models and cell lines (Perino and Schoonjans, 2015), little is known about the relationship between TGR5 and the immune response of fish in vivo or in vitro.

As a natural ligand for TGR5, treatment with BAs reduced PKC activity, then inhibited the P38 MAPK signaling pathway, which in turn inhibited the P53 and NFκB signaling pathways, leading to reduced apoptosis and a reduced inflammatory response in mice (Anwer, 2012; Pan et al., 2016). In addition, BAs produce different effects by activating different isoforms of PI₃K (Anwer, 2012; Chen et al., 2015), while TGR5 mediates monocyte adhesion and macrophage migration by activating the AKT signaling (Kida et al., 2013). Simultaneously, studies on mammals reported that NFκB could be regulated by the PI₃K/AKT signaling (An et al., 2018; Ji et al., 2020). Therefore, previous studies raise the possibility that TGR5 may regulate the NFκB signaling, PKC/P38 MAPK, and PI₃K/AKT pathway in fish.

The hybrid grouper, Epinephelus fuscoguttatus ♂ × Epinephelus lanceolatus ♀, is a mariculture fish popular with Southeast Asia and China and is farmed at high densities along the region’s coastlines (Xiu-ping et al., 2018; Hong-yu et al., 2021). However, in recent years, various factors, including nutritional imbalance, environmental degradation, and poor management, have in turn compromised the immune system of grouper, thus posing a serious threat to the profitability and sustainability of its commercial culture (Liang et al., 2013; Zhu et al., 2015; Xu et al., 2022b). For example, grouper increase susceptibility to Vibrio under high-density culture patterns (Shapawi et al., 2019). In addition, high-fat diets can induce hepatic inflammatory responses in vivo and in vitro by exacerbating lipid accumulation (Zou et al., 2019) or impairing bile acids metabolism (Xu et al., 2022c). In a previous study, we found the addition of BAs activated the TGR5 signaling pathway and improved the liver health of hybrid grouper, while increasing the mRNA expression of proinflammatory factors and reducing the anti-inflammatory factors (Xu et al., 2022c). Thus, we proposed that TGR5 signaling might play a role in the immunoregulation in hybrid grouper. Based on the research basis and reports in the literature, we hypothesized that TGR5 may regulate the hepatic immune response in hybrid grouper via NFκB, PI3K/AKT, and PKC/P38 MAPK signaling pathways. Thus, in this study, we characterized the tgr5 gene of hybrid grouper, investigated the phylogenetic relationships and expression patterns of tgr5, and explored the functions of TGR5 in the immune response in fish by agonist and antagonist treatments in vivo and in vitro. The purpose of this study was to explore the roles of hepatic TGR5 in triggering immune responses and ultimately help develop management strategies to control hepatic inflammation and mortality in cultured fish.

Materials and Methods

Reagents and animals

Animal handling and experimental procedures were carried out in accordance with the “Care and Use of Laboratory Animals in China” by the Animal Ethical and Welfare Committee of the Chinese Society for Laboratory Animals. This study was approved by the Animal Ethical and Welfare Committee of Guangdong Ocean University. The license to conduct animal experiments was GDOU-AEWC-20180063.

The SBI-115 (TGR5 antagonist, CAS: 882366-16-7) and INT-777 (TGR5 agonist, CAS: 1199796-29-6) were purchased from the MedChemExpress (Monmouth Junction, USA). The MEM medium was purchased from Procell Co. (Wuhan, China). The fetal bovine serum (FBS) was purchased from Gibco Invitrogen (UK). The Penicillin and streptomycin were purchased from Sigma–Aldrich (USA). The kit for the total protein extraction (A045-4) was purchased from Nanjing Jian Cheng Bioengineering Institute (Nanjing, China). The ELISA kits for TNFα (ml025930-2), IL1β (ml036463-2), PKC (ml026738), and P53 (ml027638) were purchased from Shanghai Enzyme-linked Biotechnology (Shanghai, China). The primary antibodies against PI₃K p85 (4292S), phosphor-PI₃K class III (Ser249, 13857S), AKT (9272S), phosphor-AKT (Ser473, 9272S), IKKα (IκB kinase α, 61294S), IKKβ (8943S), phosphor-IKKα/β (Ser176/180, 2697S), IKBα (inhibitor κB α, 4814S), phosphor-IKBα (2859S), GAPDH (2118S) were purchased from the Cell Signaling Technology (MA, USA), whereas primary antibodiy against TGR5 (NBP2-23669SS) was purchased from Novus Co. (China).

Hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂) (weight 11.31 ± 0.12 g, before sex differentiation, n = 500) were purchased obtained all at one time from a hatchery in Zhanjiang (China) and domesticated in concrete pond for 1 week to acclimatize them to the culture environment. During domestication and experiment period, groupers were fed a commercial feed (50% crude protein and 10% crude fat, Haitong, China, mainly composed of imported Antarctic krill powder, white fish powder, squid powder, deep-sea squid oil, and a variety of imported vitamins, minerals, etc.), and approximately, 70% of the water in the tank was replaced daily. Culture water temperature, dissolved oxygen concentration, ammonia, and nitrate levels were maintained at appropriate levels of 28–30 °C, >7 mg/L and <0.03 mg/L, respectively. At the end of the experimental period, fish from each tank were anaesthetized with MS-222 (Sigma–Aldrich) at a concentration of 100 mg L⁻¹ and were euthanized to take sample by a trauma to the head and dissection.

Experimental design and sample collection

Experiment 1: The cloning of tgr5 and patterns of mRNA expression

The healthy groupers (80 fish) were random selected from the domesticated concrete pond to conduct this experiment. These fish were divided into eight plastic tanks (10 fish/tank, 300 L). These tanks were randomly named to the one of eight different time points (0, 6, 12, 24, 48, 72, 120, and 192 h). All fish were injected intraperitoneally with 0.2 ml of Vibrio parahaemolyticus solution at a concentration of 7.41 × 10⁸ CFU/ml. The LD₅₀ for V. parahaemolyticus was based on the results of our team’s pre-experiments (He et al., 2020). Tissue samples were subsequently collected from four fish at eight different time points (0, 6, 12, 24, 48, 72, 120, and 192 h) postinjection, including trunk kidney, spleen, gills, brain, head kidney, liver, white muscle, heart, foregut, midgut, and hindgut. Samples were rapidly frozen in liquid nitrogen immediately after collecting and stored at −80 °C for long periods of time for subsequent analytical experiments.

Experiment 2: Incubation with the agonist or antagonist of TGR5 in primary hepatocytes of hybrid grouper

The healthy groupers (another about 20 fish) were random selected from the domesticated concrete pond to conduct this experiment. Primary hepatocytes were isolated from the liver of hybrid grouper by referring to the previous method and making slight adjustments (Zou et al., 2019). The steps were as follows: 1) the fish were thoroughly disinfected with alcohol; 2) the livers were carefully removed and thoroughly washed twice with MEM medium supplemented with streptomycin (200 μg/ml) and penicillin (200 IU/ml); 3) the livers were cut with a scalpel and scissors, moderately digested with trypsin and terminated with MEM medium containing fetal bovine serum; 4) the cell suspensions were filtered and collected, followed by centrifugation 3 times, including 2 times (100 × g, 5 min) and 1 time (50 × g, 5 min); 5) resuspended the hepatocytes with MEM medium containing 15% fetal bovine serum, penicillin (100 IU/ml) and streptomycin (100 μg/ml) and count them with a haemocytometer. When cell viability exceeded 92%, the cell suspension was inoculated onto cell culture flasks (10⁶ cells/mL). Cells were subsequently digested with trypsin when cell fusion reached 80%–90% and transferred to two new 75 cm² cell flasks. This experiment was divided into three treatments. 1) VCN group: hepatocytes without any treatment; 2) VSBI group: hepatocytes incubated with 1 μM SBI-115; 3) V777 group: hepatocytes incubated with 10 μM INT-777. According to the results of our previous trials (Xu et al., 2022e), the concentrations of SBI-115 and INT-777 incubation were selected. Sampling was conducted after 48 h of incubation.

Experiment 3: Intraperitoneal injection of agonist or antagonist of TGR5

The healthy groupers (another 54 fish) were random selected from the domesticated concrete pond to conduct this experiment. These fish were randomly allocated to nine plastic 500 L culture tanks (six fish/tank), and randomly assigned to three experimental groups: 1) IPBS group: fish were injected with PBS; 2) ISBI group: fish were injected with 1 mg of SBI-115 per kg of fish body weight; 3) I777 group: fish were injected with 1 mg kg⁻¹ of INT-777. All fish specimens were intraperitoneally injected with 0.1 ml of a solution corresponding to their experimental group. Forty-eight hours after the injection, four fish were randomly selected from each tank, and liver samples were collected and subsequently rapidly frozen in liquid nitrogen and stored at −80 °C. The injection periods and concentrations of SBI-115 and INT-777 were based on the results of our pre-experiments (Xu et al., 2022a).

The clone and sequence analyses of the tgr5 gene in hybrid grouper

Total RNA was extracted from sample livers and hepatocytes according to the method in our previous study (Xu et al., 2022d). RNA concentration was determined by UV colorimetry (Nanodrop Thermo Fisher Scientific, USA), and RNA quality was determined by 1.5% agarose gel electrophoresis. To amplify the partial cDNA of tgr5, primers were designed based on a transcript sequence obtained from hybrid grouper (Xu et al., 2022d). The full-length cDNA sequences of tgr5 were amplified by 3ʹ-RACE and 5ʹ-RACE with the SMART^er RACE cDNA Amplification Kit (Clontech, USA) according to the instructions. PCR products of tgr5 amplified with full-length primers were sequenced to verify the results of RACE cloning. The above primers are listed in Table 1.

Table 1.

Primers used for the amplification of tgr5 gene of hybrid grouper

Gene	Primer sequence (5’–3’)	Usage
tgr5-PF	ATGATGGACTGCAACGACTCC	Partial PCR
tgr5-PR	GGTACCCAGCATGCCAGAAA
tgr5 5’	AGTTGGTCGTGTTGTG	RACE-PCR
	ATGATGACAAGGTTGGCC
tgr5 3’	ACATTTGTCGCCTCCATCGCTCAG
	CAGAGGCTGAACCTGCGGTACACT
tgr5-FF	GGAGGAAGTCGGCAGATT	Full-length PCR
tgr5-FR	CGGGTATCAACCACCATCAT

Sequence of tgr5 was analyzed by the methods of previous studies (Zhi-xin et al., 2013; Chao et al., 2017; Shao-hong et al., 2019). The similarity of sequence, sequences of putative amino acid, and localization of nuclear signal were predicted by the BLAST, NCBI’s ORF Finder, and PSORTII online tools, respectively. The physicochemical properties of sequences and signal peptide were predicted by the Expasy’s ProtParam and SignalP v3.0 software. The secondary and tertiary structure of protein domains basing on amino acid sequences were predicted by the SMART, SWISS-MODEL, and NetPhos online tools, respectively. Amino acid sequences of TGR5 from other vertebrates’ animals were aligned and used to reconstruct phylogenies with the help of the neighbor-joining method implemented in MEGA7.0.

The qPCR analyses

The total RNA concentration of all tested samples was diluted to 800 ng/μl and then reverse transcribed using an Evo M-MLV reagent Kit with gDNA Eraser (Accurate Biotechnology (Hunan) Co., Ltd). The qPCR was performed using SYBR Green Pro Taq HS (Accurate Biotechnology (Hunan) Co., Ltd) and quantified on LightCycler 480 (Roche Diagnostics GmbH, USA). The amplification efficiency of the primers was determined after six steps of 10-fold dilutions of the cDNA template. The results showed that the amplification efficiency ranged from 91.82% to 101.83%. The expression of the following genes was tested in the present study: tgr5; three proinflammatory cytokines (tnfα, il1β, and il6); PKC/P38 MAPK pathway genes [p38 mitogen-activated protein kinase a (p38a), p38b, p38c, and p53]; PI₃K/AKT pathway genes [phosphatidylinositol 3-kinase regulatory subunit 5 (pi3k-rs5), 3-phosphoinositide dependent kinase-1 (pdk), akt, tuberous 1 (tsc1), and tsc2]; and NFκB pathway genes (ikkα1, ikkα2, ikkβ, ikbα1, ikbα2, p65) (Table 2). As the references genes, 18s rRNA (F: AGCAACTTTAGTATACGCTATTG; R: CCTGAGAAACGGCTACCACATC) and β-actin (F: TACGAGCTGCCTGACGGACA; R: GGCTGTGATCTCCTTCTGC), were used to calculate the relative expression of genes using the 2^−ΔΔCT method (Xu et al., 2022a).

Table 2.

Primers designed for qPCR

Target	Sequences forward	Sequences reverse	Primer efficiency (%)
tgr5	ATGCCATCACCATACCGCTG	CCAGGCGATGCCTAAGATGA	99.39
tnfα	GCTGCGGCTCGAAGACAAT	CAGACGGTGCGGATGGAGT	96.35
il6	GCACTACAAAATCTCCTCACTTCCA	GACCAGGAGGCCACCGTAGTA	97.67
il1β	CCAGCGTTGAGGGCAGAA	ATCGTCTCCAGATGTAAGGTT	92.45
p38a	AACTGGATGCACTACAACATGACA	TCCTGCTTATGAGGGAGGCTGGGG	94.76
p38b	ATCCTGGACTTTGGTTTGGCACGG	GAGATTTTCATCAAGAGCTCGGGC	101.67
p38c	CAGAGACCTCAAGCCAAGTAATGT	TCGATGTAGTCAGTTCCAGGAAAG	91.82
p53	CGCAACAGGCTTCAATCGT	GAAGCATCAGAGGCGAAGA	94.73
pi3k-rs5	GCCGAGGAGGAAGAGGATGTAGAC	GAGGAGATGGTGGAGAAGGTGGAG	96.65
3-pdk1	GGCAGCCATTACTGGAGCTTCTC	TGCGAGCAGGAACAGATGACAAC	93.69
tsc1	GGACACCAAGGTCCAGAGCA	CGTCTCGGTCTGAAGCGTCT	96.33
tsc2	TACGGAGACGACGGAGAGTTCAC	GGCATCAGTGTGGCTATGTGGAAG	104.26
akt	GGCAGGATGTGGTACAGAAGAAGC	TGTCTGGAGGAGTGAGTGTGATGG	100.56
ikka1	GCAGAGGCAGCAGTGATG	CGCTCATTCTCGTCCAGTAAC	98.22
ikka2	ACTGTTGGAGCCGATGGA	TGTGGACGACCTTCATACTCA	94.92
ikkb	GCCTTGGAGCCTCATGGACT	CGGTTTGGACGAAGCGGATG	93.30
ikbα1	ACGCAGAACAGCCAGCAGCACAT	CGTGAAGCCGCCGTAGTTCAAGC	94.69
ikbα2	CTCACCTACGGTCGCACCAA	GTCAGGCAACTCCCTCAGGT	98.35
p65	AACCTCACCGAGCCCATTA	TTGTCACTCAGCCTGTATTCATCT	101.83

The enzyme activities and western blot analyses

The concentrations of TNFα, IL1β, PKC, and P53 were determined by the method of ELISA kits (Chen et al., 2016; Wang et al., 2018a). Reagent configuration, sample pretreatment, and assay steps were performed according to the operating instructions, and the accuracy of the standard curves made from the standard solutions was to be above 99.9% (Wang et al., 2017; Li et al., 2022).

Western blot analysis followed the protocols detailed in our recent study (Xu et al., 2022c, 2022d). Briefly, hepatocytes or liver samples were lysed in RIPA buffer. After measuring and adjusting the protein concentration, they are denatured in a boiling water bath, added to a 10% SDS-PAGE with 32 mg of protein, electrophoretically separated, transferred to a PVDF membrane and then closed for a period of time with 5% bovine serum albumin (Zhang et al., 2018). The membranes were then incubated overnight at 4 °C with primary antibodies, including PI₃K (1: 1000), p-PI₃K (1: 1000), AKT (1: 1000), p-AKT (1: 1000), IKKα (1: 500), IKKβ (1: 500), p-IKKα/β (1: 500), IKBα (1: 1000), p-IKBα (1: 1000), TGR5 (1: 500), GAPDH (1: 1000). Then, probes were performed with HRP-conjugated anti-rabbit secondary antibodies. Finally, target protein bands were visualized by enhanced ECL reagents (Billerica, MA, USA) and quantified by ImageJ software (version 1.42, National Institutes of Health). The original files of WB image were presented in Supplementary Figure S1–S22.

Statistical analysis

Shapiro–Wilk test and Levene test were used for normality and homogeneity test of results, respectively. One-way ANOVA was used for evaluation, and Duncan’s multiple range test was used for significance analysis. SPSS 23.0 (IBM, Armonk, NY, USA) was used for the above analysis. The final results were expressed as mean ± standard deviation (SD), where the threshold of statistical significance was < 0.05.

Results

Identification of the tgr5 gene in hybrid grouper

As shown in GenBank Accession No. OK572534 and Figure 1, the full-length of hybrid grouper tgr5 is 2525 bp in length and contains a 1029 bp open reading frame (ORF) encoding 342 amino acids. The N-terminal amino acid of tgr5 sequence was methionine, and the predicted eukaryotic localization showed that tgr5 was a membrane protein, mainly distributed on the cell membrane (Supplementary Figure S23). The secondary structure of TGR5 protein consisted of 47.37% alpha helix, 38.60% random coil, and 14.04% extended strand (Supplementary Table S1). The protein domains show that TGR5 contains seven transmembrane (7 TM) domains (at N-terminal positions 19–41, 53–75, 85–107, 128–150, 197–219, 252–274, and 289–311) and two low-complexity domains (at positions 92–102 and 129–141; Figure 1 and Supplementary Figure S23). This was also confirmed by the predicted three-dimensional model (Supplementary Figure S23). The predicted glucorylation sites were not found in the sequence, and the predicted numbers of phosphorylation sites for Ser, Thr, and Tyr were 17, 9, and 4, respectively (Supplementary Figure S23).

Figure 1.

Nucleotide and amino acid sequences of tgr5 in hybrid grouper. The start codon (ATG) is bolded. The stop codon (TGA) is marked with an asterisk. The predicted seven transmembrane domains (transmembrane regions at positions 19–41, 53–75, 85–107, 128–150, 197–219, 252–274, and 289–311 of the N-terminus, respectively) are grayed. The two low-complexity regions (at positions 92–102 and 129–141) are underlined. The predicted phosphorylation sites of Ser, Thr, and Tyr are marked by a square box, triangle box, and rounded box, respectively.

As shown in Supplementary Table S2, the multiple alignments analyses showed that the TGR5 amino acid sequence of hybrid grouper had high similarity to orthologues in other fish. The similarity of TGR5 orthologues was more than 56% in teleost, but below 34% in mammals and birds. In particular, the similarity was high with Perciformes orthologues: 92.98% with Sander lucioperca, 92.11% with Notothenia coriiceps and 91.52% with Perca flavescens. The phylogenetic tree inferred using TGR5 orthologues was divided into two main clades: one containing all of the teleost and amphibian sequences, and the other containing mammalian and avian sequences (Figure 2). Within the teleost clade, the TGR5 of hybrid grouper clustered within the monophyletic Perciformes cluster, with S. lucioperca and P. flavescens as the closest relatives included.

Figure 2.

The Neighbor-Joining phylogenetic dendrogram of 33 vertebrate TGR5 amino acid sequences. TGR5 of hybrid grouper sequence is highlighted by a diamond-shaped sign. Numbers on nodes indicate statistical support, estimated using 1,000 bootstraps.

Modulation of tgr5 expression in response to V. parahaemolyticus stimulation

In healthy hybrid grouper, the tgr5 was expressed in a variety of tissues (Figure 3A). Compared to muscle (set as the reference point: 1×), expression was highest in spleen (10.45×), followed by in midgut (9.69×) and brain (4.88×); whereas lowest in hindgut (0.38×). In response to V. parahaemolyticus, the expression of tgr5 was decreased significantly in the spleen and midgut at all time-points (all P < 0.05, Figure 3B and C). Meanwhile, in the liver, it increased significantly at 6 and 12 h, then decreased significantly at 48, 72, and 120 h, and returned to the initial level (0 h) at 192 h (Figure 3D). In the head kidney, it decreased significantly at most time points (except at 72 h), and returned to the initial level (0 h) at 192 h (Figure 3E).

Figure 3.

The mRNA expression of tgr5 in various tissues of a healthy hybrid grouper (A), and at different time-points in tissues after V. parahaemolyticus stimulation (B–E). (A) Data in relation to the muscle tissue; (B–E) data in relation to the 0 h time-point. Values are presented as means with plus error bars (standard deviation, SD), where significant (P < 0.05) differences between groups are indicated by different letters.

Regulatory effects of TGR5 on hepatic immune responses in vivo

The hepatic level of TNFα was significantly increased in the ISBI group (14.46 ± 0.14 pg/mg prot) and significantly decreased in the I777 group (11.34 ± 0.18 pg/mg prot), compared to the IPBS group (12.29 ± 0.21 pg/mg prot, Figure 4A). The hepatic level of IL1β was significantly increased in the ISBI (18.84 ± 0.15 pg/mg prot), compared to the IPBS (15.30 ± 0.51 pg/mg prot) and I777 (14.34 ± 0.52 pg/mg prot) groups (Figure 4B). The ISBI treatment significantly upregulated the expression of il6 and tnfα, whereas the I777 treatment significantly downregulated the il1β, compared to the IPBS treatment (Figure 4C).

Figure 4.

The alterations of hepatic inflammation (A–C) and NFκB signaling (D–K) induced by an agonist or antagonist of TGR5 in vivo. IPBS group: fish injected with PBS; I777 group: fish injected with INT-777; ISBI group: fish injected with SBI-115. Values are presented as means with SD, where significant (P < 0.05) differences between groups are indicated by different letters.

Regulatory effects of TGR5 on the NFκB signaling pathway in vivo

Compared to the IPBS group, the ISBI treatment significantly decreased the expression of TGR5 and IKBα proteins, and significantly increased the expression of p-IKBα protein and the ratio of p-IKBα/IKBα (Figure 4D–J). The I777 treatment significantly increased the expression of TGR5, and significantly decreased the expression of the IKKβ protein. Compared to the IPBS group, the ISBI treatment significantly upregulated the expression of ikkα1, ikkα2, ikbα1, ikbα2, and p65, and significantly downregulated the expression of tgr5 and ikkβ (Figure 4K). The I777 treatment significantly upregulated the expression of tgr5, and significantly downregulated the expression of ikkα1, ikkα2, ikkβ, ikbα1, ikbα2, and p65.

Regulatory effects of TGR5 on the PKC/P38 MAPK signaling pathway in vivo

The hepatic level of PKC was significantly increased in the ISBI group (13.44 ± 0.17 mU/g prot) and significantly decreased in the I777 group (9.76 ± 0.25 mU/g prot), both compared to the IPBS group (11.20 ± 0.19 mU/g prot, Figure 5A). The hepatic level of P53 was significantly increased in the ISBI group (18.14 ± 0.10 pg/mg prot) and significantly decreased in the I777 group (14.94 ± 0.23 pg/mg prot), both compared to the IPBS group (17.14 ± 0.23 pg/mg prot, Figure 5B). The ISBI treatment significantly upregulated the expression of p38c, whereas the I777 treatment significantly downregulated the expression of p38a, p38b, and p38c (Figure 5C).

Figure 5.

The alterations of PKC/P38 MAPK signaling (A–C) and PI₃K/AKT signaling (D–J) induced by an agonist or antagonist of TGR5 in vivo. IPBS group: fish injected with PBS; I777 group: fish injected with INT-777; ISBI group: fish injected with SBI-115. Values are presented as means with SD, where significant (P < 0.05) differences between groups are indicated by different letters.

Regulatory effects of TGR5 on the PI₃K/AKT signaling pathway in vivo

Compared to the IPBS group, the ISBI treatment significantly decreased the expression of PI₃K protein, and it significantly increased the expression of the p-AKT protein, and the ratio of p-PI₃K/PI₃K (Figure 5D–I). The I777 treatment significantly increased the expression of AKT protein, and significantly decreased the expression of p-PI₃K and PI₃K proteins, and the ratio of p-AKT/AKT. Compared to the IPBS group, the ISBI treatment significantly decreased the expression of pdk, tsc1, and tsc2, and it significantly increased the expression of pi3k-rs5 and akt. The I777 treatment significantly increased the expression of pdk and tsc1, and it significantly decreased the expression of akt (Figure 5J).

Regulatory effects of TGR5 on hepatic immune responses in vitro

The hepatic level of TNFα was significantly increased in the VSBI group (0.65 ± 0.02 pg/mg prot) compared to the V777 group (0.52 ± 0.02 pg/mg prot) and VCN group (0.58 ± 0.02 pg/mg prot, Figure 6A). The hepatic level of IL1β was significantly increased in the VSBI group (1.93 ± 0.04 pg/mg prot) and significantly decreased in the V777 group (1.42 ± 0.04 pg/mg prot), compared to the VCN group (1.58 ± 0.02 pg/mg prot, Figure 6B). The VSBI treatment significantly upregulated the expression of il1β, il6, and tnfα, whereas the V777 treatment significantly downregulated the il6 and tnfα, compared to the VCN treatment (Figure 6C).

Figure 6.

The alterations of hepatic inflammation (A–C) and NFκB signaling (D–K) induced by an agonist or antagonist of TGR5 in vitro. VCN group: hepatocytes without any treatment; V777 group: hepatocytes incubated with INT-777; VSBI group: hepatocytes incubated with SBI-115. Values are presented as means with SD, where significant (P < 0.05) differences between groups are indicated by different letters.

Regulatory effects of TGR5 on the NFκB signaling pathway in vitro

Compared to the VCN group, the VSBI treatment significantly increased the expression of IKKα, IKKβ, p-IKKα/β, IKBα, p-IKBα proteins (Figure 6D–J). The V777 treatment significantly decreased the expression of the IKKβ protein, and it significantly increased the expression of TGR5, IKKα, IKBα and p-IKBα proteins. Compared to the VCN group, the VSBI treatment significantly downregulated the expression of tgr5, and it significantly upregulated the expression of ikkα1, ikkα2, ikkβ, ikbα1, ikbα2, and p65 (Figure 6K). The V777 treatment significantly upregulated the expression of tgr5, and it significantly downregulated the expression of ikkα1 and ikkβ.

Regulatory effects of TGR5 on the PKC/P38 MAPK signaling pathway in vitro

The hepatic level of PKC was significantly decreased in the V777 group (0.74 ± 0.02 mU/g prot), compared to the VSBI (0.96 ± 0.02 mU/g prot) and VCN groups (0.95 ± 0.03 mU/g prot, Figure 7A). The hepatic level of P53 was significantly increased in the VSBI group (1.88 ± 0.06 pg/mg prot), compared to the V777 (1.11 ± 0.04 pg/mg prot) and VCN groups (1.24 ± 0.02 pg/mg prot, Figure 7B). The VSBI treatment significantly upregulated the expression of p38a, p38b, p38c, and p53, whereas the V777 ­treatment ­significantly downregulated the expression of p38b (Figure 7C).

Figure 7.

The alterations of PKC/P38 MAPK signaling (A–C) and PI₃K/AKT signaling (D–J) induced by an agonist or antagonist of TGR5 in vitro. VCN group: hepatocytes without any treatment; V777 group: hepatocytes incubated with INT-777; VSBI group: hepatocytes incubated with SBI-115. Values are presented as means with SD, where significant (P < 0.05) differences between groups are indicated by different letters.

Regulatory effects of TGR5 on the PI₃K/AKT signaling pathway in vitro

Compared to the VCN group, the VSBI treatment significantly decreased the expression of PI₃K proteins, and it significantly increased the ratio of p-PI₃K/PI₃K (Figure 7D–I). The V777 treatment significantly decreased the expression of p-PI₃K and p-AKT proteins, and the ratio of p-AKT/AKT. Compared to the VCN group, the VSBI treatment significantly decreased the expression of tsc2, and it significantly increased the expression of pi3k-rs5, pdk, and akt. The V777 treatment significantly increased the expression of tsc1 and tsc2, and it significantly decreased the expression of pi3k-rs5 and akt (Figure 7J).

Discussion

Sequence analysis of the tgr5 gene in hybrid grouper

The human TGR5 gene has a coding region size of 993 bp, corresponding to 330 amino acids (Godoy et al., 2013), and the rat and mouse tgr5 genes have a coding region size of 990 bp, producing a protein of 329 amino acids (Keitel et al., 2020). However, the ORF of the tgr5 gene in hybrid grouper is 1029 bp and encodes a predicted protein of 342 amino acids. Furthermore, in mammals, the protein sequence of human, bovine, rabbit, rat, and mouse TGR5 is highly conserved, with approximately 82%–91% amino acid identity (Keitel et al., 2020). In bony fish, the homologous similarity of TGR5 was more than 56%. The low conserveness rate of TGR5 in bony fish (compared to mammals) may be due to the high taxonomic and ecological diversity of aquatic animals (Clements et al., 2014). However, tgr5 of hybrid grouper is very similar to that in Perciformes (both over 91%).

Structural predictions of the protein indicated that the TGR5 proteins of all species contains seven TM structural domains, with only slight differences in amino acid lengths between the domains of different species (Xiong et al., 2021). In addition, TGR5 mainly located on the plasma membrane at the subcellular level. Similarly, in the present study, the plastid protein TGR5 from the hybrid grouper contained seven TM domains. BAs link TMs 3 and 6 to activate receptors, which is common in agonists of GPCR, while additional TMs are resolved to enhance its efficacy (Gertzen et al., 2015). For example, one of the TGR5 agonists, INT-777 (α-ethyl-23(S)-methyl-cholic acid), a semi-synthetic BA derived from cholic acid (Pellicciari et al., 2009), is the most potent TGR5 agonist against zebrafish and mammals (Xiong et al., 2021). Despite the wide range of ligands recognized by TGR5, only one antagonist, SBI-115, has been developed (Masyuk et al., 2017). In this study, we further explored the function of TGR5 in hybrid grouper by using INT-777 to activate TGR5 expression and SBI-115 to inhibit TGR5 expression.

High expression of tgr5 has been detected in some mammalian tissues, such as lung, stomach, small intestine, liver, and especially placenta and spleen (Guo et al., 2016a; Keitel et al., 2020). Consistent with this part, in this experiment, highly expressed tgr5 was found in the spleen, midgut, and brain of hybrid grouper. In addition, the expression level of tgr5 in mouse liver tissue was the lowest. The expression level of that in rat liver tissue is average, and the expression level of that in human liver tissue is the highest (Keitel and Häussinger, 2018). In hybrid grouper, the expression level of tgr5 in liver was intermediate. In response to V. parahaemolyticus stimulation, the mRNA level of tgr5 in liver was significantly upregulated at the initial injection stage and then gradually returned to normal (initial) levels. These observations suggested that tgr5 might play an important role in the immune response induced by V. parahaemolyticus infection in the liver of hybrid grouper.

TGR5 signaling pathway reduced the immune response in vivo and in vitro

TGR5 agonists have the potential to ameliorate inflammation in human cell models, as well as in other animal models, including Crohn’s disease and ulcerative colitis (Yoneno et al., 2013; Perino and Schoonjans, 2015). In vivo studies showed that activation of TGR5 recruited cAMP response element-binding protein enrichment to the IL10 promoter in the intestine and liver of mice, which specifically activated the transcriptional promoter of the IL10 gene (Xie et al., 2013; Chiang and Ferrell, 2020), which in turn reduced the levels of pro-inflammatory cytokines, including TNFα, IL1β, IL6, and IL18 (Guo et al., 2015, 2016b; Perino and Schoonjans, 2015; Gui et al., 2019). Similarly, in the present study, the concentrations of TNFα and IL1β decreased significantly in vivo and in vitro after TGR5 was activated by INT-777. In mammalian studies, mice with targeted deletion of TGR5 exhibited severe liver injury and activated immune responses (Keitel et al., 2020). In a model of LPS-induced inflammation, mice with the Tgr5-null mutation exhibited severe liver necrosis and inflammation (Wang et al., 2011). At the same time, the cytokine content in Tgr5^−/− macrophages increased, which further confirmed the role of TGR5 in regulating macrophage immune response (Eggink et al., 2014). Similarly, in this study, the inhibition of TGR5 by SBI-115 increased the concentrations and mRNA levels of proinflammatory cytokines in vivo or in vitro. In general, the TGR5 signaling pathway controls the immune response involved in the production of proinflammatory cytokines in hybrid grouper.

TGR5 inhibited the NFκB signaling pathway in vivo and in vitro

In LPS-stimulated mouse macrophages, activation of Tgr5 inhibits nuclear translocation of NFκB, which exerts anti-inflammatory effects, including the production of proinflammatory cytokines and mediators (Pols et al., 2011). Therefore, the next step in this study was to explore the relationship between TGR5 and the NFκB signaling pathway. NFκB is a transcription factor associated with a variety of cellular processes, such as inflammation, proliferation, apoptosis, and development (Guo et al., 2016a; Papademetrio et al., 2016). NFκB contains five components: p50, RelB, p52, RelA (p65), and c-Rel (Sun et al., 2013). NFκB remain in a nonactivated state in plasma by binding to IKB family members, including BCL3, p100, p105, IKBα, IKBβ, IKBγ, and IKBε (DiDonato et al., 2012). Specifically, IKK regulates the phosphorylation of IKBα or IKBβ to activate NFκB and its downstream target genes (Guo et al., 2016a).

In healthy organisms, NFκB signaling is tightly controlled by multiple negative feedback mechanisms (Guo et al., 2015). However, TGR5 activation inhibits IKK activity and IKB phosphorylation, further suppressing IKB and NFκB p65 activity in the cytoplasm, leading to a decrease in NFκB transcriptional activity in vitro (macrophages, HepG2 cells and gastric cells) (Wang et al., 2011; Guo et al., 2015; Iracheta-Vellve et al., 2018; Lyu et al., 2019; Keitel et al., 2020) and in vivo (Hedvat et al., 2009). In this study, activation of TGR5 by INT-777 significantly repressed the expression of IKKβ protein in vivo, and significantly downregulated the expression of ikkα1, ikkα2, ikkβ, ikbα1, ikbα2, and p65. These results suggested that TGR5 activation inhibited the NFκB pathway in hybrid grouper in vivo. In addition, although the I777 treatment significantly decreased the expression of IKKβ protein and ikkα1 and ikkβ genes, it significantly increased the expression of IKKα, IKBα, and p-IKBα proteins, indicating that activation of TGR5 affected the activation of NFκB pathway in vitro. So, the regulation of the NFκB pathway by TGR5 activation was different in vivo and in vitro, and further studies are needed to clarify this issue.

The inhibition of TGR5 by SBI-115 significantly increased the expression of p-IKB protein and significantly upregulated the expression of ikkα1, ikkα2, ikbα1, ikbα2, and p65 both in vivo and in vitro, indicating that inhibition of TGR5 activated the NFκB pathway of hybrid grouper. Furthermore, we noted that in the present study, activation of TGR5 inhibited specific NFκB target gene sets, but not all target genes, in hybrid grouper. This phenomenon was also observed for TGR5 in a liver inflammation experiment in mice (Wang et al., 2011). These results are in agreement that TGR5 negatively regulated inflammatory response in the liver and stomach by antagonizing NFκB activity, thereby inhibiting NFκB-mediated production of proinflammatory cytokine (Wang et al., 2011; Guo et al., 2015). Our results suggested that activation of TGR5 inhibited the NFκB signaling pathway in hybrid grouper.

TGR5 repressed the PKC/P38 MAPK signaling pathway in vivo and in vitro

PKC is a member of the serine/threonine protein kinase family with at least 12 isoforms and is involved in the regulation of various cellular functions. For example, PKC regulates the body’s immune response by activating P38 MAPK and NFκB (Jia et al., 2018; Keitel et al., 2020). In the present study, the hepatic PKC level was significantly increased in the ISBI group in vivo, and significantly reduced in the INT-777 treatment both in vivo and in vitro, suggesting that TGR5 expression negatively regulated PKC activity in hybrid grouper. MAPKs regulate a variety of cellular functions, including proliferation, immunity, apoptosis, and differentiation, by conducting and processing intracellular and extracellular stimulus signals (Anwer, 2012). In general, there are four main types of MAPK cascades in cells, including P38 MAPK, JNK, ERK1/2, and ERK5 cascades (Morrison, 2012). In the present study, activation of TGR5 significantly downregulated the ­expression of p38a, p38b, and p38c in vivo or in vitro, whereas the inhibition of TGR5 significantly upregulated the expression of these genes, suggesting that TGR5 expression negatively regulated the P38 MAPK activity in hybrid grouper. This was further confirmed by the reduced expression of P53 (both the protein and gene) in the INT-777 treatment, as decreased P38 MAPK activity induces suppression of P53 activity (Anwer, 2012). On one hand, decreased PKC activity downregulated the expression of IKKβ and IKKγ (not IKKα) in Kupffer cells in rats (Anwer, 2012); but on the other hand, TGR5 activation decreased the expression of IL1β, IL6, and TNFα by activating P38 MAPK in mouse macrophages (Wenyu et al., 2012). In addition, agonists of TGR5 inhibited the expression of the IL1β and TNFα through the PKC-JNK/P38-P53 signaling pathway in NR8383 cells (Qi et al., 2021). Combined with our observations that TGR5 expression negatively regulated PKC and P38 MAPK activities, we propose that TGR5 expression inhibited the PKC/P38 MAPK in hybrid grouper.

TGR5 repressed the PI₃K/AKT signaling pathway in vivo and in vitro

PI₃Ks are a class of lipid kinases (classes I, II, and III) that phosphorylate phosphatidylinositol (PI) at position 3 of the inositol ring, a step known as D3 phosphorylation. The resulting phosphorylated PI (PIP) interacts with phosphocreatinine dependent kinases (PDK) and regulates the activity of downstream kinases, such as AKT. In the present study, INT-777 treatment significantly decreased the expression of p-PI₃K protein, whereas SBI-115 treatment significantly increased the ratio of p-PI₃K/PI₃K both in vivo and in vitro. Since the TGR5-PI₃K-mediated pathway play an important role in protecting against liver injury (Stepanov et al., 2013) and PI₃K-p110β can also be activated by GPCR (Guillermet-Guibert et al., 2008), our results suggested that TGR5 expression negatively regulated the PI₃K activity in hybrid grouper. On the plasma membrane, the interaction between the PH structural domain of AKT and phosphatidylinositol trisphosphate (PIP3) leads to the subsequent modification and activation of AKT at position 308 of threonine (Stepanov et al., 2013; Guo et al., 2016a). In the current study, the activation of TGR5 significantly reduced the ratio of p-AKT/AKT both in vivo and in vitro. Meanwhile, TGR5 agonist treatment significantly enhanced the phosphorylation of AKT in bovine aortic endothelial cells (Kida et al., 2013), while the phosphorylation of AKT in mouse TGR5-deficient peritoneal macrophages was significantly decreased (Xiong et al., 2018). These observations indicated that TGR5 expression negatively regulated the AKT activity in hybrid grouper. In general, we suggested that TGR5 expression negatively regulated the PI₃K/AKT signaling pathway in hybrid grouper.

Limitations

Compared with the SBI-115 treatment, IL1β level, IKBα, and p-IKBα protein expression, il6 and IL1β gene expression, p-PI3K/PI3K ratio and other changes were less significant after INT-777 treatment in vivo or in vitro. We hypothesized that the nonsignificant changes in these inflammatory factors and other indicators might be related to the health status of the fish. If the fish immune system is in an inflammatory mode induced by LPS or other factors, these changes in inflammatory status may be more pronounced in response to TGR5 activation. However, this is still hypothetical and more research is needed to clarify the issue.

Conclusion

In conclusion, this study revealed the following results: 1) characterized the tgr5 gene of hybrid grouper, which contains seven trans-membrane structural domains; 2) tgr5 gene was highly expressed in the spleen, midgut, and brain; 3) the activation of TGR5 reduced hepatic immune response and inhibited the NFκB signaling pathway in hybrid grouper; 4) the activation of TGR5 inhibited the PKC/P38 MAPK and PI₃K/AKT pathways. Understanding the functions of hepatic TGR5 may help scientists develop management strategies to reduce the liver inflammation in hybrid grouper or other fish.

Glossary

Abbreviations:

18s

18s rRNA

3-pdk1

3-phosphoinositide dependent kinase-1

7 TM

seven transmembrane

akt

serine/threonine-protein kinase

BAs

bile acids

GPCR

G protein-coupled receptor

I777

fish were injected with 1 mg kg⁻¹ of INT-777

IKBα

inhibitor κB α

ikkα

IκB kinase α

ikkβ

IκB kinase β

il1β

interleukin 1β

il6

interleukin 6

IPBS

fish were injected with PBS

ISBI

fish were injected with 1 mg of SBI-115 per kg of fish body weight

MAPK

mitogen-activated protein kinase

MEM

minimum essential medium

NFκB p65

nuclear factor kappa B p65

ORF

open reading frame

p38a

p38 mitogen-activated protein kinase a

p38b

p38 mitogen-activated protein kinase b

p38c

p38 mitogen-activated protein kinase c

PI₃K

phosphoinositide 3-kinase

PKC

protein kinase C

p-IKBα

phosphorylated-inhibitor κB α

p-IKKα

phosphorylated-IκB kinase α

p-IKKβ

phosphorylated-IκB kinase β

tgr5

G protein-coupled bile acid receptor 1

tnfα

tumor necrosis factor-alpha

tsc1

tuberous 1

tsc2

tuberous 2

V777

hepatocytes incubated with 10 μM INT-777

VCN

hepatocytes without any treatment

Vibrio parahaemolyticus

V. parahaemolyticus

VSBI

hepatocytes incubated with 1 μM SBI-115

Acknowledgments

This work was supported by the National Key R&D Program of China (2019YFD0900200), the Science and Technology Project of Zhanjiang (2020A05003), the China Agriculture Research System of MOF and MARA (CARS-47), the Natural Science Foundation of Guangdong Province (2018A030313154 & 2020A1515011129), and the National Natural Science Foundation of China (31772864).

Author Contributions

Conceptualization: Jia Xu: Conceptualization, Data Curation, Methodology, Formal analysis, Investigation, Software, Validation, Writing-Original Draft; Junming Cao: Methodology, Resources, Validation, Funding acquisition; Beiping Tan: Project administration, Conceptualization, Investigation, Supervision, Writing-Review & Editing, Funding acquisition; Shiwei Xie: Conceptualization, Data Curation, Resources, Software, Visualization, Supervision. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare no real or perceived conflict of interests.

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethical Approval

The experimental procedures were approved by the Animal Ethical and Welfare Committee of Guangdong Ocean University (Guangdong, China), processing ID: GDOU-AEWC-20180063.