Detection of tetracycline resistance genes and their diversity in Escherichia coli isolated from pig farm waste in Banten province, Indonesia

Abstract

Background and Aim:

Livestock waste in the form of feces and liquid represents an important reservoir of antibiotic resistance genes (ARGs). Because many ARGs can be horizontally transferred to other pathogens, livestock waste plays an essential role in the emergence and transmission of various ARGs in the environment. Therefore, this study aimed to detect and assess the diversity of tet genes in Escherichia coli isolated from pig farm waste in Banten province, Indonesia.

Materials and Methods:

Solid waste (feces) and wastewater were collected from 44 pig farms in Banten province. The isolation and identification of E. coli referred to the Global Tricycle Surveillance extended-spectrum beta-lactamase E. coli World Health Organization (2021) guidelines. tet genes were detected using quantitative real-time polymerase chain reaction after dividing pig farms in the province into four clusters based on their adjacent areas and characteristics.

Results:

tetA, tetB, tetC, tetM, tetO, and tetX were detected in solid waste and wastewater from pig farms, whereas tetE was not detected in either sample type. tetX (100%) and tetO (75%) were the most dominant genes in solid waste, whereas wastewater samples were dominated by tetA, tetM, tetO, and tetX (prevalence of 50% each). Furthermore, eight tet gene patterns were found in pig farm waste (prevalence of 12.5% each).

Conclusion:

The results showed a high prevalence of tetO and tetX in solid waste and wastewater from pig farms in Banten province. This significant prevalence and diversity indicated the transmission of tet genes from pigs to the environment, posing a serious threat to public health.

Introduction

Antibiotic resistance is a significant issue that influences the effectiveness of treatments for bacterial diseases in humans and animals, making it a major global concern [1, 2]. One factor contributing to the emergence and spread of antibiotic resistance genes (ARGs) is the long-term and extensive use of antibiotics in livestock, which has become a global challenge [3].

More than 85% of administered antibiotics or their metabolites are excreted in the urine or feces of animals and discharged into the environment [4]. The widespread use of antibiotics imposes selective pressure on bacteria, leading to resistant bacterial strains that can spread among humans, animals, and different environments [5]. Several ARGs are encoded in mobile genetic elements (MGEs), enabling their transmission when introduced into a new environment [6]. Consequently, bacteria carrying various ARGs are commonly found in livestock waste and the surrounding environment [4, 7].

Tetracyclines are commonly used in humans and livestock due to their broad-spectrum activity, availability, and affordability. These antibiotics are mostly available in healthcare units, especially community health centers (Puskesmas) [8], and they are frequently used in pig farms across Indonesia [9, 10]. Based on previous studies by Wang et al. [11] and Zhang et al. [12] various bacterial species have developed resistance to tetracycline through their tet genes.

Livestock feces and wastewater treated with antibiotics serve as important reservoirs of antibiotic residues, antibiotic-resistant bacteria, and ARGs that can be horizontally transferred, contributing to the emergence and spread of ARGs in the environment [13, 14]. Furthermore, livestock feces that are stored intensively, either composted or fresh, are generally used as fertilizer, leading to the contamination of agricultural land with antibiotic-resistant bacteria [14, 15]. Livestock wastewater discharged into waters and the wider terrestrial environment can contaminate water [7] and soil [14, 15], promoting the transmission of resistant bacteria and ARGs. This can cause significant environmental problems and threaten public health, particularly through contaminated food chains [16, 17].

Integrons are MGEs that facilitate gene transmission between and within species due to its location on plasmids and transposons. This phenomenon has been widely reported, especially in Enterobacteriaceae species [18, 19], including Escherichia coli [20]. Escherichia coli is classified as a critical pathogen and is a member of the 12 priority pathogenic families. This Gram-negative enteric commensal bacterium is commonly found in humans and animals. Escherichia coli is also one of the most widely used indicator organisms in monitoring antimicrobial resistance due to its susceptibility to the high selective pressure of antimicrobial agents and transmission of ARGs to other bacteria with the same or different species horizontally through MGEs or vertically through self-cleavage [21–24].

Over 40 genes encoding tetracycline resistance (tet) genes have been characterized. Based on their resistance mechanism, these genes were categorized as efflux pumps (n = 28), ribosomal protection proteins (n = 12), enzymatic inactivators (n = 2), and genes that induce mutations within the 16S rRNA that reduce the binding affinity of the drug for the ribosome. tetA, tetB, tetC, tetD, tetE, and tetG have been frequently associated with tetracycline resistance in E. coli through the efflux pump mechanism [25]. tetM and tetO detected in this study induced tetracycline resistance through ribosomal protection, whereas tetX is an enzymatic inactivator. Zhang et al. [26] detected tetA, tetB, tetO, and tetE in pig feces and farm waste. Jia et al. [27] also detected tetB, tetC, tetD, tetE, tetG, tetL, tetO, tetM, tetQ, tetW, tetS, and tetX in pig farm wastewater in Changzhou (Jiangsu, China).

In Indonesia, pig farms are located in Banten province to meet the demand for pork in the community, and the pig population was 7819 in 2021, according to the Banten Province Central Statistics Agency [28]. At present, there are limited data regarding the resistance to antibiotics such as tetracycline in E. coli and ARGs in pig farm waste in the country, especially in Banten province, highlighting the need for study in this area.

This study aimed to detect and assess the diversity of tet genes in E. coli isolated from pig farm waste in Banten province, Indonesia, to assist in developing strategies to prevent and control antimicrobial resistance.

Materials and Methods

Ethical approval

Ethical approval was not required for this study. However, samples were collected according to standard sampling procedures referring to SNI 6989.59–2008 [29] and ISO 19458:2006 [30].

Study period and location

This study was conducted from July to December 2022. Isolation and identification of E. coli from the collected samples were performed at the Microbiology Laboratory of the School of Veterinary Medicine and Biomedical, IPB University, Indonesia. The detection of ARGs using the quantitative real-time polymerase chain reaction (qPCR) method was conducted at the Quality Control Laboratory and Certification of Animal Products, Ministry of Agriculture, Republic of Indonesia.

Sample collection

Solid waste (feces) and wastewater samples were collected from 44 pig farms in Banten province. The solid waste was taken from a collection of fresh pig feces on farms, whereas wastewater was sampled following the standards SNI 6989.59–2008 for wastewater sampling [29] and ISO 19458:2006 regarding microbiological analysis of water quality [30]. Samples were collected aseptically and transported to the laboratory at 4°C followed by the collection of 500-mL liquid waste samples.

Isolation and identification of E. coli

The isolation and identification of E. coli were performed following the guidelines of Global Tricycle Surveillance extended-spectrum beta-lactamase E. coli from the World Health Organization [31]. Serial dilutions of samples up to 1 × 10⁻⁵ were made in duplicate using a solution of sterile phosphate-buffered saline (PBS; pH 7.4) at a ratio of 1:9. This was followed by the collection of 0.1 mL of each dilution, which was transferred to a Petri dish containing Tryptone Bile X-Glucuronide (TBX) agar (Merck KGaA, Darmstadt, Germany) and plated on the surface of agar (spread plate method). Colonies on TBX agar suspected to be E. coli were round, smooth, and bluish-green. Petri dishes with ≤100 colony-forming units/mL were used in the next stage. A minimum of five colonies each selected from TBX agar were inoculated onto MacConkey agar (MCA, Oxoid, Basingstoke, UK). Morphologically, the suspected E. coli colonies on MCA were round, flat, smooth in shape, dark pink in color, and non-mucoid, and they were surrounded by a cloudy zone. Subsequently, the suspected E. coli colonies were cultured on tryptic soy agar (Oxoid) and sulfide indole motility agar (Oxoid) for the confirmatory indole biochemical test. Positive E. coli results were indicated by the formation of a cherry red ring, and E. coli ATCC 25922 served as the positive control.

DNA extraction

DNA extraction from E. coli isolates was performed using a Mericon DNA Bacteria Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The E. coli isolate was transferred using loops from the culture medium into a microtube containing 1 mL of sterile PBS until the turbidity reached at least 0.5 McFarland standard, depending on the availability of isolates. The sample was centrifuged at 13,000× g for 5 min, and the supernatant was discarded, leaving only the bacterial pellet. The bacterial pellets were washed by adding 200 μL of sterile PBS and homogenized using a vortex. Subsequently, the suspension was centrifuged at 13,000× g for 5 min, and the washing process was repeated until a colorless suspension was obtained. In total, 200 µL of Fast Lysis Buffer were added, and the suspension was heated in a ThermoMixer (Eppendorf, Hamburg, Germany) at 100°C and 122× g for 10 min. The suspension was incubated at room temperature (20–25°C) for 2 min and centrifuged at 13,000× g for 5 min. The supernatant containing DNA (100 μL) was transferred to a new 2-mL microtube and stored at −20°C or −80°C until further analysis.

The extracted E. coli DNA was pooled based on clusters and tested by qPCR according to these clusters. Pig farms in Banten province were divided into four clusters based on adjacent areas and characteristics. Cluster 1 (central region) consisted of one subdistrict (Neglasari) with one farm, cluster 2 (western region) comprised three subdistricts (Panongan, Legok, and Tigaraksa) with 24 farms, cluster 3 (southern region) consisted of one subdistrict (Cisauk) with two farms, and cluster 4 (northern region) comprised five subdistricts (Mauk, Teluk Naga, Paku Haji, Kosambi, and Sepatan Timur) with 17 farms.

Quality control of DNA

The DNA concentration and purity were tested using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Massachusetts, US). The DNA concentration needed for the qPCR test was >36 ng/μL, whereas the DNA purity ratio assessed by NanoDrop was commensurate with the set value of 1.8–2.0 (A260/A280).

Detection of tetracycline resistance genes

The presence of tetracycline resistance genes was tested using the SYBR Green qPCR method and primers of the target genes listed in Table-1 [32–34]. The SYBR Green PCR method was performed on a real-time PCR thermal cycler (Rotor-Genes Q, Qiagen, Hilden, Germany). The reagents of the master mix for the SYBR Green qPCR protocol were prepared in each microtube according to the required design plate layout with the following template (25 μL): 12.5 μL of SYBR select master mix, 2 μL each of primary reverse and forward primers (10 µM), 3.5 μL of nuclease-free water, and 5 μL of the DNA sample. Each microtube was placed on a PCR plate cooler to keep the reagent at a low temperature. Subsequently, qPCR and melting were performed using Q-Rex software (Qiagen). The amplification process for tetA, tetM, tetO, and tetX followed the procedure proposed by Li et al. [35] using a two-step qPCR program. This involved initial heating at 95°C for 3 min, followed by 40 cycles of denaturation at 10 s 95°C, annealing for 60 s at a temperature adjusted for the primers of the target genes (as specified in Table-1), and extension for 1 min at 72°C. The amplification process using SYBR Green for tetB, tetC, and tetE was performed as described by Jia et al. [27]. The process included initial heating at 94°C for 5 min, followed by 40 cycles of denaturation for 60 s at 94°C, annealing for 30 s at a temperature selected according to the primers of the target genes (Table-1), and extension for 90 s at 72°C. The specificity of the amplified product was analyzed using a melting curve (95°C for 10 s, 65°C–95°C with a 0.5°C increase every 0.05 s).

Table-1.

Details of the primers used to detect tetracycline resistance genes.

Gene	Primer	Primer sequence (5’ to 3’)	Temperature Annealing (°C)	Reference
tetA	tetA-F	GCTACATCCTGCTTGCCTTC	57	[32]
	tetA-R	CATAGATCGCCGTGAAGAGG
tetB	tetB-F	TTG GTT AGG GGC AAG TTT TG	56	[32]
	tetB-R	GTA ATG GGC CAA TAA CAC CG
tetC	tetC-F	CTTGAGAGCCTTCAACCCAG	55	[32]
	tetC-R	ATGGTCGTCATCTACCTGCC
tetE	tetE-F	AAACCACATCCTCCATACGC	57	[32]
	tetE-F	AAATAGGCCACAACCGTCAG
tetO	tetO-F	ACGGARAGTTTATTGTATACC	57	[33]
	tetO-R	TGGCGTATCTATAATGTTGAC
tetM	tetM-F	ACAGAAAGCTTATTATATAAC	52	[33]
	tetM-R	TGGCGTGTCTATGATGTTCAC
tetX	tetX-F	AGCCTTACCAATGGGTGTAAA	57	[34]
	tetX-R	TTCTTACCTTGGACATCCCG

The results were considered positive when the cycle threshold (CT) value was <40 with an amplification curve [27, 35] and a single melt peak was formed with a melting temperature range smaller than 2°C. However, the results were considered negative/undetectable when the CT value exceeded 40 and no amplification curve was detected. When the CT value ranged >36–<40, the results were considered indeterminate/dubious.

Statistical analysis

The data from the test results are presented in tables and figures and analyzed using a descriptive method.

Results

Isolation and identification of E. coli

All samples analyzed in this study were positive for E. coli, and the complete results for isolation and identification are presented in Table-2.

Table-2.

The result of E. coli isolation and identification.

Sample type	Number of isolate culture	Results at each testing stages			Positive E. coli (%)
		TBX media culture (%)	MCA media culture (%)	Indole test (%)
Solid waste (feces)	44	44 (100)	44 (100)	44 (100)	100
Wastewater	44	44 (100)	44 (100)	44 (100)	100

TBX=Tryptone bile X-glucuronide, E. coli=Escherichia coli, MCA=MacConkey agar

Detection of tetracycline resistance genes

The assessment of tetracycline resistance genes revealed the presence of tetA, tetB, tetC, tetM, tetO, and tetX in solid waste and wastewater samples from pig farms, whereas tetE was not detected in either sample type (Table-3). The amplification and melting curves obtained from testing tetracycline resistance genes by qPCR are presented in Figure-1. Among the solid waste samples, tetX and tetO were the most prevalent (100% and 75%, respectively), followed by tetM (50%), tetA (25%), tetB (25%), and tetC (25%). Meanwhile, wastewater samples were dominated by tetA, tetM, tetO, and tetX (50% each), followed by tetB and tetC (25% each), as presented in Figure-2.

Table-3.

CT and melt peak values of the tet genes detected in solid waste (feces) and wastewater samples of pig farms using qPCR.

Cluster and solid waste sample code	tet genes	CT value	Melt peak (°C)	Cluster and wastewater sample code	tet genes	CT value	Melt peak (°C)
Cluster 1/C1 (141A)	tetM	9.9	85	Cluster 1/C1 (142A)	tetA	11.89	90.6
	tetO	9.6	85		tetM	28.71	85.3
	tetX	31.72	92.5		tetX	19.93	91.3
Cluster 2/C2 (36C, 38D, 40D, 42C, 44D, 46A, 48A, 50B, 52B, 54B, 56A, 58B, 60A, 62B, 64D, 66E2, 68B, 70E1, 72A, 74A, 76A, 78B, 80A, 82D)	tetC	19.97	91.3	Cluster 2/C2 (37A, 39B, 41B, 43A, 45C, 47D2, 49A, 51B, 53A, 55A, 57A, 59A, 61A, 63B, 65A, 67A, 69D, 71B, 73A, 75B, 77A, 79A, 81B, 83A)	tetO	25.35	85.5
	tetO	9.71	85		tetM	28.96	85.3
	tetM	10.03	85
	tetX	19.79	91
Cluster 3/C3 (84A, 87A)	tetA	11.16	90.4	Cluster 3/C3 (85D, 88D)	tetA	11.1	90.5
	tetB	21.4	82.1		tetB	12.49	82
	tetX	19.62	91.3		tetO	24.96	85.3
Cluster 4/C4 (89C, 91A, 93D, 95A, 97C, 100B, 102A, 104B,106D, 108A, 110A,112A, 126A, 129A,132D, 135A, 138A)	tetO	28.63	85.3	Cluster 4/C4 (90E, 92A, 94A, 96A, 98E, 101D, 103A, 105D, 107A, 109A, 111A,113B, 127A, 130A, 133C, 136B, 139A)	tetC	19.93	91.3
	tetX	19.97	91.3		tetX	18.49	93

qPCR=Quantitative real-time polymerase chain reaction, CT=Cycle threshold

Figure-1.

Test results showing detection of tet genes in solid waste (feces) and wastewater samples of pig farms by quantitative real-time polymerase chain reaction. (a) Amplification curve and melting curve of tetA; (b) Amplification curve and melting curve of tetB, (c) Amplification curve and melting curve of tetC, (d) Amplification curve and melting curve of tetM, (e) Amplification curve and melting curve of tetO, and (f) Amplification curve and melting curve of tetX.

Figure-2.

The prevalence percentage of tetracycline resistance genes in solid waste (feces) and wastewater samples from pig farms.

Eight tet gene patterns were found in pig farm samples with the same prevalence of 12.5%, as presented in Table-4.

Table-4.

Patterns of tetracycline resistance genes in waste of pig farms samples.

tet genes pattern	Total number of samples	Total number (%)
tetM + tetO + tetX	1	12.5
tetC + tetM + tetO + tetX	1	12.5
tetA + tetB + tetX	1	12.5
tetO + tetX	1	12.5
tetA + tetM + tetX	1	12.5
tetM + tetO	1	12.5
tetA + tetB + tetO	1	12.5
tetC + tetX	1	12.5
Total number	8	100

Discussion

Isolation and identification of E. coli

All samples tested in this study were positive for E. coli, indicating a high prevalence of E. coli in both solid waste and wastewater from pig farms in Banten province. Similarly, the previous studies by Kallau et al. [36] reported a high E. coli prevalence of 85.40% in pig farms in Kupang City, Indonesia. This significantly high prevalence was attributable to the use of E. coli as a commensal bacterium and the potential of the microbe to cause various digestive tract disorders and other extra-intestinal diseases. Furthermore, this bacterium is widespread and abundant in pig farms [12], pig slaughterhouses [37], and the surrounding environment [16, 38].

The results of the survey revealed that most pig farms in Banten province were traditional or household-scale farms with pens located in close proximity to residential areas. These farms primarily raise pigs for fattening purposes, and their hygiene and sanitation were generally low. Furthermore, most of the farms did not have a waste treatment plant, leading to the direct discharge of waste into the environment. This had caused the spread of E. coli to aquatic and terrestrial environments, posing a serious potential threat to public health. According to Jang et al. [39], the presence and endurance of E. coli in pig feces were affected by the temperature of the environment and the hygiene and sanitation of the cage. Escherichia coli can survive for long periods outside the digestive tract and reproduce in soil, sand, and sediment in environments with tropical, subtropical, and warm climates [40]. Several strains of E. coli, including pathogenic strains such as E. coli O157:H7, have shown the ability to adapt to the environment and survive in fertilizer and on the surface of vegetables, namely, lettuce and spinach. The presence of pathogenic E. coli in food has caused outbreaks of food poisoning in the community [39].

Escherichia coli carries ARGs that can be transferred horizontally to bacteria of the same or different species through conjugation events such as the transfer of ARGs through plasmids or other genetic materials, namely, transposons and integrons [41]. The World Organization for Animal Health has identified E. coli (commensal) and Salmonella spp. (pathogens) as indicator bacteria in monitoring and surveillance programs of antibiotic resistance in animals and the environment. This recognition is attributable to the susceptibility of these bacteria to high selective pressure from antimicrobial agents in contact with the host, leading to an increase in the relative abundance of resistant bacterial populations [42].

Detection of tetracycline resistance genes

In this study, seven tet genes responsible for the emergence of E. coli resistance to tetracycline antibiotics with different resistance mechanisms, including drug efflux (tetA, tetB, tetC, and tetE), ribosomal protection (tetM and tetO), and enzymatic inactivation (tetX), were tested. Almost all of the tested genes excluding tetE were detected in both solid waste and wastewater samples from pig farms. This is consistent with the findings of AbuOun et al. [43], who detected tetA, tetB, tetC, and tetM in pigs. Similarly, Zhang et al. [26] detected tetA, tetB, tetO, and tetE in pig feces and farm waste. Jia et al. [27] detected tetB, tetC, tetD, tetE, tetG, tetL, tetO, tetM, tetQ, tetW, tetS, and tetX in pig farm wastewater in Changzhou (Jiangsu, China).

tetX and tetO were the most common genes in the solid waste samples with prevalences of 100% and 75%, respectively, whereas the prevalence of tetA, tetM, tetO, and tetX in wastewater samples was 50%. The previous studies also reported that tetA was dominantly detected in pig feces (44.9% [43] and 94.7% [44]), pig farm waste (66.7% [45]), pig slaughterhouse wastewater (50% [37]), and the environment (88.9% [44] and 100% [45]). Plasmid-mediated tetX (variant tetX4) was detected in E. coli from samples of pig feces (31.03%), pig anal swabs (37.93%), farm environments such as water (6.89%), soil (6.89%) [46], dust (0.9%) [47], and pig slaughterhouses [48]. According to Jia et al. [27], tetX exhibited a high relative abundance in pig farm wastewater of 106.3 copies/16S rRNA gene copies. Similarly, tetO recorded a high relative abundance (22.71 copies/16S rDNA gene copies) in pig farm waste [26].

According to Nguyen et al. [25], tetA, tetB, tetC, tetD, tetE, and tetG were frequently associated with tetracycline resistance in E. coli through the efflux pump mechanism. tetA was the most dominant efflux pump gene in this study, especially in wastewater samples (50%), followed by tetB and tetC (25% each), whereas tetE was not detected in either sample type. This finding was consistent with those of previous studies, in which tetA was most commonly found in Gram-negative bacteria such as E. coli [20, 49]. tetA is located in a conjugation plasmid, facilitating the easy spread of resistance genes to other bacteria of the same or different species through horizontal gene transfer with conjugation. Similarly, tetC is located in bacterial plasmids, tetB is found on transposons and integrative and conjugative elements [50], whereas tetE is often associated with non-conjugative plasmids [34], limiting its transmission.

In this study, the two tet genes responsible for the ribosomal protection resistance mechanism were tetO and tetM. tetO was more prevalent than tetM, especially in solid waste samples. According to Avrain et al. [51], tetO is mostly associated with conjugative plasmids in Campylobacter spp., and transfer between Campylobacter jejuni isolates has been reported. Recent studies have reported that tetO was integrated into transposons carrying the macrolide-resistant efflux genes mefA and msrD. These transposons can be transferred conjugatively to different strains of Streptococcus pyogenes and unrelated Enterococcus faecalis [52, 53]. Roberts [54] reported that the discovery of tetO in conjugative transposons facilitated its wider transmission among various unrelated bacteria. Moreover, ARGs associated with conjugative transposons are more easily transmitted to other bacteria, even those that are not closely related, than non-conjugative plasmids [55]. tetO was rarely found in E. coli, but in this study, tetO was present at a high prevalence, especially in solid waste samples. This was attributable to the presence of tetO in conjugative transposons and plasmids, making it possible for a wider horizontal transmission to other unrelated bacteria, such as E. coli.

tetM genes have been detected in enterococci [56] and are related to transposons and conjugative plasmids [57, 58], facilitating the transmission of resistance genes to other bacteria. Although tetM has rarely been detected in Gram-negative coliforms such as E. coli, this study recorded a fairly high prevalence of 50% in solid waste and wastewater samples from pig farms. This was in line with previous findings in which tetM was detected in 13.1% of tetracycline-resistant E. coli isolates from ileal samples from healthy pigs [59]. The fairly high prevalence of tetM in this study was related to the horizontal transfer of genes from bacteria in the digestive tract of pigs, such as enterococci to E. coli to a process involving transposons and plasmid conjugation.

In this study, only tetX utilized the enzymatic inactivation resistance mechanism, and it was present in 100% of solid waste samples. This finding can be explained by the fact that tetX in E. coli can be located in plasmids, which are highly transferable and successfully mobilized in Enterobacteriaceae bacteria. The tetX variant tetX4 is most commonly found in mobile plasmids, enabling the sharing of genetic information among different bacteria [47]. Furthermore, this gene has been identified in E. coli, but the resistance mechanisms of enzymatic inactivation have rarely been described by Poirel et al. [20]. According to Zhang et al. [60], plasmid-mediated tetX (tetX4) was detected in isolates from various animals, including pigs, ducks, geese, chickens, cattle, freshwater fish, and shrimp, as well as migratory birds, with pigs being the predominant source. Li et al. [46] isolated 32 tetX4-positive strains from pig feces and anal swabs in Shanxi, China. Similarly, tetX4-positive E. coli was detected in the sewage and soil of pig farms. These isolates had different ST types, but their tetX4-carrying plasmids comprised the same replicon type. This indicated that the plasmids were transferred horizontally among different reservoirs, leading to tetX4 transmission in the surrounding environment. Several other studies have detected tetX in pig feces [61], farm wastewater [62], well water around farms [63], and river water [64].

The tet gene patterns formed in this study comprised at least two or four tet gene combinations. Specifically, eight tet gene patterns were found in pig farm samples at the same prevalence of 12.5%. The highest diversity was found in cluster 1 in solid waste samples, which featured a combination of four tet genes (tetC, tetO, tetM, and tetX), followed by three-type combinations in cluster 1 in solid waste (tetO, tetM, and tetX) and wastewater samples (tetA, tetM, and tetX) and in cluster 3 in solid waste (tetA, tetB, and tetX) and wastewater samples (tetA, tetB, and tetO). This high diversity indicated the spread of tet genes from pig farms to the environment due to the excessive and uncontrolled use of tetracycline antibiotics in farms. Tetracycline antibiotics such as oxytetracycline and tetracycline have been frequently used in Indonesian pig farms for both therapeutic and nontherapeutic purposes (prophylactic, metaphylactic) as well as for growth promotion [9, 65, 66]. According to Kallau et al. [9], 55.21% of antibiotics in pig farms were used for treatment, whereas 42.71% and 2.08% were used for disease prevention and production enhancement, respectively.

Pig feces and farm waste are important reservoirs of antibiotic-resistant bacteria and ARGs. Horizontal gene transfer involving MGEs plays a crucial role in the formation, dissemination, and assembly of various ARGs among different bacterial cells, resulting in the combination and diversity of these genes [13, 14]. Plasmids also play a significant role in transferring multidrug resistance genes between bacterial species and closely related different species [67]. Furthermore, integrons found in plasmids and/or transposons significantly contribute to the increasing transmission of ARGs. Class 1 integrons are mostly involved in the dissemination of ARGs in Gram-negative and-positive bacteria [68]. Moredo et al. [69] reported that approximately 17.5% of E. coli isolates in pig farms carried integrons as propagators of antibiotic resistance to the environment. Escherichia coli strains resistant to multiple tetracyclines can increase the possibility of combinations or new tet gene patterns. The occurrence of tet gene combinations is a serious problem with a significant impact on human health and the environment [70].

The occurrence of antibiotic-resistant E. coli in pigs poses a significant risk, as it can lead to the contamination of pork [66] and processed meat products [71], as well as aquatic [27] and terrestrial environments [72] through improper handling of waste generated. Based on the field survey, most pig farms in Banten province were close to community settlements, and the generated waste was not handled properly. This condition created a high risk of contaminating the environment and the wider ecosystem with antibiotic-resistant bacteria and ARGs, leading to serious effects on public health through the contaminated food chain.

Conclusion

tetX and tetO were the most dominant tetracycline resistance genes found in waste from pig farms in Banten province. The presence of eight tet gene patterns at the same prevalence suggested a high prevalence and diversity of tet genes in the waste sample. This indicated the transmission of tet from pigs to the environment had occurred, posing a serious threat to public health.

Authors’ Contributions

DFP: Conducted the study, sample and data collection, sample testing, data analysis, and drafted the manuscript. HL and IWTW: Conducted the study, interpretation of the data, and drafted and revised the manuscript. CB and PR: Conducted the study, data analysis, and manuscript preparation. All authors have read, reviewed, and approved the final manuscript.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published institutional affiliation.