Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2023 Sep 22;102(12):103136. doi: 10.1016/j.psj.2023.103136

Transcriptomics analysis unveils key potential genes associated with brain development and feeding behavior in the hypothalamus of L-citrulline-fed broiler chickens

Victoria Anthony Uyanga ⁎,†, Semiu Folaniyi Bello §, Xin Qian *, Ning Chao *, Haifang Li ‡, Jingpeng Zhao *, Xiaojuan Wang *, Hongchao Jiao *, Okanlawon M Onagbesan #, Hai Lin *,1
PMCID: PMC10585647  PMID: 37844531

Abstract

High ambient temperature is a major environmental stressor affecting poultry production, especially in the tropical and subtropical regions of the world. Nutritional interventions have been adopted to combat thermal stress in poultry, including the use of amino acids. L-citrulline is a nonessential amino acid that is involved in nitric oxide generation and thermoregulation, however, the molecular mechanisms behind L-citrulline's regulation of body temperature are still unascertained. This study investigated the global gene expression in the hypothalamus of chickens fed either basal diet or L-citrulline-supplemented diets under different housing temperatures. Ross 308 broilers were fed with basal diet (CON) or 1% L-citrulline diet (LCT) from day-old, and later subjected to 2 environmental temperatures in a 2 by 2 factorial arrangement as follows; basal diet-fed chickens housed at 24°C (CON-TN); L-citrulline diet-fed chickens housed at 24°C (LCT-TN); basal diet-fed chickens housed at 35°C (CON-HS), and L-citrulline diet-fed chickens housed at 35°C (LCT-HS) from 22 to 42 d of age. At 42-days old, hypothalamic tissues were collected for mRNA analyses and RNA sequencing. A total of 1,019 million raw reads were generated and about 82.59 to 82.96% were uniquely mapped to genes. The gene ontology (GO) term between the CON-TN and LCT-TN groups revealed significant enrichments of pathways such as central nervous system development, and Wnt signaling pathway. On the other hand, GO terms between the CON-HS and LCT-HS groups revealed enrichments in the regulation of corticosteroid release, regulation of feeding behavior, and regulation of inflammatory response. Several potential candidate genes were identified to be responsible for central nervous system development (EMX2, WFIKKN2, SLC6A4 Wnt10a, and PHOX2B), and regulation of feed intake (NPY, AgRP, GAL, POMC, and NMU) in chickens. Therefore, this study unveils that L-citrulline can influence transcripts associated with brain development, feeding behavior, energy metabolism, and thermoregulation in chickens raised under different ambient temperatures.

Key words: appetite, L-citrulline, gene expression, hypothalamus, thermoregulation

INTRODUCTION

Body temperature regulation is an integral homeostatic parameter that largely influences the cellular function and molecular responses of organisms (Nakamura, 2011). The hypothalamus is the most important organ in the central control of body temperature since it contains the primary integrative and efferent circuits necessary for thermoregulation (Morrison, 2016). More so, thermoregulation is an important physiological response that is largely affected by environmental conditions (Nakamura and Morrison, 2008). Extreme or sporadic changes in ambient temperature pose deleterious effects on animals (Park et al., 2019). Thus, the environmental temperature has a significant impact on the growth, development, productivity, immunity, reproduction, and survival of animals (Renaudeau et al., 2012).

In poultry production, high ambient temperature and relative humidity result in heat stress, which adversely affects the overall performance and welfare of birds (Ayo et al., 2011). Heat stress depresses the growth rate, production performance, and physiological variables in poultry. It directly affects the feed intake of chickens and alters nutrient supply to various tissues (Farag and Alagawany, 2018; Abdel-Moneim et al., 2021). Importantly, exposure to heat stress can increase or decrease the supply of certain amino acids to the blood, brain, and muscles of chickens (Ito et al., 2014; Uyanga et al., 2022a). Hence, along with other nutrients, the amino acid requirements during high-temperature conditions must be given attention (Daghir, 2009).

Transcriptomic studies revealed that during heat stress, several metabolic pathways are activated, and identification of these target genes may provide useful genetic strategies for developing thermotolerant chickens (Park et al., 2019). Studies have identified genes related to metabolic adaptations, apoptosis, stress response, cell proliferation, immune response, and oxidative stress during heat stress in laying chickens (Cheng et al., 2018; Wang et al., 2021), and meat-type chickens (Zhang et al., 2017; Monson et al., 2019). In the hypothalamus of heat-stressed chickens, Sun et al. (2015) reported that the differentially expressed genes were mainly associated with acute heat stress, meat quality, and growth category. Although candidate genes that are affected during heat stress in poultry have been largely studied (Rimoldi et al., 2015; Monson et al., 2018; Zhang et al., 2019), few studies have investigated how nutritional intervention interacts with the environment to influence these molecular mechanisms and their related signaling pathways, especially as it relates to thermoregulation (Flees et al., 2017; Rajaei-Sharifabadi et al., 2017).

L-citrulline is a nonessential amino acid that serves as a substrate for L-arginine synthesis and nitric oxide production (Allerton et al., 2018). L-citrulline's recycling into arginine promotes nitric oxide synthesis, which in turn would allow for its associated effects on vasodilation and thermoregulation (Uyanga et al., 2020). L-citrulline induces endothelial vasodilation and regulates vascular tone in blood vessels (Mori et al., 2015). In addition, L-citrulline supplementation is efficacious in potentiating hypothermia in chicks under different ambient temperature conditions (Chowdhury et al., 2017; Uyanga et al., 2021). However, the molecular responses associated with L-citrulline's effect on body temperature regulation remain to be elucidated. To identify the transcripts specifically associated with L-citrulline's actions on body temperature, a holistic view of the transcriptional changes in the hypothalamus under different temperature conditions was performed. The transcripts were examined to identify the potential candidate genes and functional pathways associated with L-citrulline's regulation of body temperature in broiler chickens and to provide insights into the molecular regulation of thermoregulation in chickens.

MATERIALS AND METHODS

The care and use of all animals in this study was reviewed and approved by the Institutional Animal Care and Use Committee at the College of Animal Science of Shandong Agriculture University (No. 2001002), and carried out following the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China).

Experimental Design

One-day-old Ross 308 broilers (n = 288) were procured from Dabao Breeding Technology Co., Tai’an, China. Chicks were raised in environmentally controlled chambers that had double-tiered battery cages, with cage dimensions of 47.5 × 37 × 36 cm. The room temperature was maintained at 32°C, 60% RH from day-old, and gradually adjusted until 24°C at 21-days old. Experimental diets were formulated to meet or exceed NRC requirements (NRC, 1994). The chicks were given basal diets (CON) (Table 1), or basal diets supplemented with 1% L-citrulline (LCT). L-citrulline was purchased from Shandong Fosun Biotechnology Co., Ltd., Shandong, China, and the dosage was selected based on previous studies (Uyanga et al., 2020; Uyanga et al., 2022a). At 22-days old, the broilers were housed under different environmental temperatures, that is, thermoneutral housing (24°C, 24 h/d; TN) or high-temperature housing (35°C, 08.00 h to 16.00 h (8 h/d); HS). The experimental setup was designed as a 2 × 2 factorial arrangement that had 4 treatments, 6 replicates of 12 chickens each, as follows; CON-TN, LCT-TN, CON-HS, and LCT-HS groups. Body weight and feed intake were measured per replicate. One chicken per replicate was selected at 42-days old for exsanguination and the hypothalamus was collected, snap-frozen, and kept at −80°C for molecular analysis.

Table 1.

Composition and nutrient levels of basal (CON) diet (as-fed basis) %.

Ingredients Starter phase Finisher phase
Corn (8.5% CP) 54.99 59.68
Soybean meal (43% CP) 37.02 31.65
Soybean oil 3.87 4.72
Limestone 1.19 1.27
CaHPO4 1.68 1.63
NaCl 0.30 0.28
L-Lys·HCl (99%) 0.21 0.18
DL-Met (99%) 0.21 0.14
L-Arg (99%) 0.02 -
Choline chloride (50%) 0.26 0.20
Vitamin premix1 0.05 0.05
Mineral premix2 0.20 0.20
Calculated nutrient levels (%)
 CP 21.0 19.0
 ME/(MJ/kg) 12.55 12.97
 Ca 0.90 0.90
 Nonphytate P 0.45 0.43
 Lys 1.24 1.11
 Met 0.54 0.45
 Met+Cys 0.89 0.78
 Thr 0.86 0.77
 Arg 1.39 1.22
Open in a new tab
1

Vitamin premix provided the following per kilogram of diet: VA (retinyl acetate) 10,000 IU, VD3 (cholecalciferol) 2,000 IU, VE (DL-α-tocopheryl acetate) 11.0 IU, VK 1.0 mg, VB1 1.2 mg, VB2 5.8 mg, VB6 2.6 mg, VB12 0.012 mg, niacin 66.0 mg, pantothenic acid (calcium pantothenate) 10.0 mg, biotin 0.20 mg, folic acid 0.70 mg.

2

Mineral premix provided the following per kilogram of diet: Mg 100 mg, Zn 75 mg, Fe 80 mg, I 0.65 mg, Cu 8.0 mg, Se 0.35 mg.

RNA Isolation and Sequencing

The hypothalamic samples were lysed using TRIzol reagent (Invitrogen, Carlsbad, CA) for RNA extraction. RNA concentration and purity were determined and the quality of the library was tested by Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). The mRNA was enriched with oligo magnetic beads and the cDNA was synthesized. After library construction, PCR amplification was performed and the library size was 450 bp. Following RNA extraction and library construction, the libraries were paired-end and sequenced using the Illumina sequencing platform at Personal Biotechnology Co., Ltd. (Personal Bio, Shanghai, China).

Library Construction, De Novo Assembly, and Annotation

The raw data provided by the sequencing platform (Fastq files) were filtered for quality check. Reads that contained adapters, poly-N, or low-quality reads with an accuracy rate of less than 99% (Q value ≤20) were removed to obtain the clean reads. Simultaneously, the Q30 (percentage of base identification accuracy above 99.9%), and GC content of the clean data were calculated. Cutadapt was used to remove the sequence of 3′ end band connector. Using an upgraded version of hisat2 with tophat, the filtered reads were aligned to the chicken reference genome (assembly Gallus gallus_4.0) and annotated transcripts of the Ensembl gene annotation.

Analysis for Differentially Expressed Genes

The htseq statistics was applied to assess the read count value of each gene. Fragments per kilobase of transcript per million mapped reads were used to standardize the transcript expression from different samples. RSeQC was used to analyze the expression saturation of the sequencing results. The Pearson correlation coefficient was used to express the correlation among samples. The DE-Seq R package was used to analyze and screen the differential expression of genes among groups (CON-TN vs. LCT-TN and CON-HS vs. LCT-HS). Genes with an expression difference multiple |log2foldchange| ≥1, and P ≤ 0.05 were identified as differentially expressed genes (DEGs).

Analysis for Functional Pathway Enrichment

Gene ontology (GO) enrichment analysis was done using TopGO to annotate the function of the DEGs, and the results were classified into molecular function (MF), biological process (BP), and cell component (CC). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was conducted to identify the biological pathways for the identified DEGs using the KEGG Automatic Annotation Server (KAAS) platform.

Determination of Protein-to-Protein Network Interaction

The STRING database was used to examine the association between candidate genes. Network visualization of candidate genes was determined with Cytoscape_v3.2.1 (Shannon et al., 2003).

Verification of RNA-Seq With qRT-PCR

Total RNA was extracted from the hypothalamic tissues using NcmZol reagent (NCM Biotech, Shanghai, China). RNA concentration was detected using the DS-11 spectrophotometer (DeNovix Incorporated, Delaware, United States). Reverse transcription into complementary DNA (cDNA) was done using the PrimeScriptTM reverse transcription kit with gDNA eraser (Takara Bio Inc., Beijing, China). Real-time PCR was carried out using ABI QuantStudio 5 Real-Time PCR Instrument (Applied Biosystems, ThermoFisher Scientific, Massachusetts, United States). Oligonucleotide primers used for qRT-PCR were designed by Sangon Biotechnology Company, Shanghai, China (Table 2). The primers were normalized against β-actin as an internal control, and the mRNA expression was analyzed using the 2−ΔΔCT method.

Table 2.

List of primers used for RT-PCR.

Gene Orientation Primer sequence (5′–3′) 1Accession number
WNT3 Forward TCCGAGATGGTGGTGGAGAAGC EF068233.1
Reverse CGCAGCACAGCAGGTCACAG
CXCR1 Forward CTGTATGGTGCGGTGAGGTTATGG AF227961.1
Reverse GTTGAGCAGGTAGACATCGGTGAC
FLT3 Forward GCCAGAGATGTCGTGAATGACTCC XM_003640612.4
Reverse CCCACAGCAGTATTCCGAAAGACC
MYLK2 Forward AGCAGGGAGCCAAGGACAAGG NM_205392.1
Reverse CTGGATGAGGTTGCGGTGGTTC
CHAT Forward ATTGGCTTGCTGACGACTGATGG NM_204610.1
Reverse CCAGGCACACCAGGCATATACATC
NPY Forward TGCTGACTTTCGCCTTGTCG M87294
Reverse GTGATGAGGTTGATGTAGTGCC
AgRP Forward GGAACCGCAGGCATTGTC NM_001031457
Reverse GTAGCAGAAGGCGTTGAAGAA
POMC Forward CGCTACGGCGGCTTCA NM_001031098
Reverse TCTTGTAGGCGCTTTTGACGAT
β-Actin Forward TGCGTGACATCAAGGAGAAG NM_205518
Reverse TGCCAGGGTACATTGTGGTA
Open in a new tab
1

Accession number refers to Gene bank (NCBI). Agouti-related protein (AgRP); Pro-opiomelanocortin (POMC); choline O-acetyltransferase (CHAT); myosin light chain kinase 2 (MYLK2); FMS-related tyrosine kinase 3 (FLT3); galanin and GMAP prepropeptide (GAL); Wnt family member 3 (WNT3); C-X-C motif chemokine receptor 1 (CXCR1).

Statistical Analysis

The production performance was analyzed using 1-way ANOVA to identify the effect of dietary treatment from d 1 to 21 of the experiment. Two-way ANOVA was used for data analysis to identify the main effects of diet (CON vs. LCT) and environment (TNZ vs. HS); and the interaction effect from d 22 to 42 of the experiment. Data were expressed as mean ± SEM using SAS version 8.1 (SAS Institute Inc., Cary, NC). Mean separation was done using Duncan's multiple range test. The linear regression and Pearson's correlation were done using GraphPad Prism, version 8.0.2 (GraphPad Software Inc., La Jolla, California, USA). Results were significantly different at P < 0.05.

RESULTS

Production Performance of Broiler Chickens

The production performance of broilers is given in Table 3. The dietary treatment did not significantly affect the body weight, body weight gain, and feed intake of broilers from d 1 to 21 of the experiment (P > 0.05). However, the feed conversion ratio was significantly decreased by LCT diet compared to the CON diet (P < 0.05).

Table 3.

Production performance of broiler chickens.

Experimental groups
 P value
Parameters CON-TN LCT-TN CON-HS LCT-HS Diet Envt Diet*Envt
1–21 d
Body weight (g/bird) 371.84 ± 2.98 360.60 ± 4.65 0.069
Body weight gain (g/bird) 329.47 ± 3.08 318.62 ± 4.63 0.080
Feed intake (g/bird) 561.05 ± 11.21 590.62 ± 19.30 0.215
Feed conversion ratio (g/g) 1.64 ± 0.04a 1.51 ± 0.03b 0.031
22–42 d
Body weight (g/bird) 1191.29 ± 24.90 1208.51 ± 15.07 1067.20 ± 20.14 1089.64 ± 13.61 0.320 <0.0001 0.894
Body weight gain (g/bird) 816.17 ± 25.77 862.05 ± 12.40 698.65 ± 16.78 717.42 ± 16.72 0.108 <0.0001 0.488
Feed intake (g/bird) 1813.26 ± 37.64a 1802.96 ± 40.18a 1461.78 ± 42.74b 1861.01 ± 76.87 a 0.002 0.013 0.001
Feed conversion ratio (g/g) 1.52 ± 0.03b 1.49 ± 0.02b 1.37 ± 0.02c 1.71 ± 0.06a 0.001 0.418 <.0001
Open in a new tab
a,b

Different letters indicate a significant effect of treatment at P < 0.05.

From d 22 to 42 of the experiment, the dietary treatment significantly affected the feed intake and feed conversion ratio of broilers (P < 0.05), showing that LCT diet increased both the feed intake and feed conversion ratio of broilers compared to the CON diet. Following HS exposure, it was observed that the body weight, body weight gain, and feed intake were significantly lowered in the HS broilers compared to the TN broilers (P < 0.05). Also, the feed intake and feed conversion ratio were significantly influenced by the interaction effect (P < 0.05), since the CON-HS group had decreased feed intake compared to the CON-TN, LCT-TN, and LCT-HS groups. Similarly, the feed conversion ratio was lowest in the CON-HS group compared to the CON-TN and LCT-TN groups which were similar, whereas, the LCT-HS group had the highest feed conversion ratio (P < 0.05).

RNA-Sequencing Analysis

To achieve a comprehensive view of the hypothalamic transcriptome and identify the transcripts affected by diet (CON vs. LCT) and environment (TNZ vs. HS), twelve (12) libraries were constructed and sequenced. The sequencing resulted in a total of 1, 091 million (M) raw reads, which produced 163.65 gigabases (Gb) of raw data, and an average of 45.5 M raw reads were obtained per library. From the raw reads, about 93.28% (1,017 M) passed initial quality thresholds to become the clean reads used for subsequent analyses. An average clean read was 42.4 M per library. The clean reads ranged from 92.81 to 93.58%, while the Q20 and Q30 bases ranged from 97.21 to 97.51% and 92.73 to 93.45%, respectively. The clean reads were mapped to Gallus gallus genome with total mapped reads of 36,672,182 (93.59%) to 43,334,148 (93.51%). The proportion of uniquely mapped reads was between 36,032,989 (98.26%) to 42,586,540 (98.27%), while the number of reads that were mapped to genes ranged from 29,761,024 (82.59%) to 35,328,459 (82.96%) (Table 4).

Table 4.

Summary of transcriptome sequencing and mapping.

Groups Raw reads no. Clean reads no. Clean reads (%) Q20 (%) Q30 (%) Total mapped Uniquely mapped Mapped to gene
CON-TN 48389088 44912074 92.81 97.45 93.29 42050348 (93.63%) 41322541 (98.27%) 34115060 (82.56%)
CON-TN 48994008 45564066 92.99 97.34 93.04 42596263 (93.49%) 41864608 (98.28%) 34520753 (82.46%)
CON-TN 43985710 40875964 92.93 97.42 93.20 38288316 (93.67%) 37627689 (98.27%) 31170810 (82.84%)
CON-TN 47366346 44193356 93.30 97.44 93.26 41389059 (93.65%) 40678972 (98.28%) 33656334 (82.74%)
CON-TN 42767316 39835024 93.14 97.47 93.32 37291875 (93.62%) 36646150 (98.27%) 30063504 (82.04%)
CON-TN 44564552 41646876 93.45 97.34 93.00 39044213 (93.75%) 38366011 (98.26%) 31528051 (82.18%)
LCT-TN 46079942 43108840 93.55 97.42 93.21 40353021 (93.61%) 39660727 (98.28%) 32737328 (82.54%)
LCT-TN 41886498 39184490 93.54 97.32 92.97 36672182 (93.59%) 36032989 (98.26%) 29761024 (82.59%)
LCT-TN 48837940 45473378 93.11 97.51 93.45 42543880 (93.56%) 41757086 (98.15%) 34392273 (82.36%)
LCT-TN 44534156 41523336 93.23 97.36 93.11 38772082 (93.37%) 38086003 (98.23%) 31311189 (82.21%)
LCT-TN 43137098 40197560 93.18 97.21 92.73 37554662 (93.43%) 36940190 (98.36%) 30418778 (82.35%)
LCT-TN 48323814 45149540 93.43 97.42 93.22 42230351 (93.53%) 41484284 (98.23%) 34239573 (82.54%)
CON-HS 46224984 43261798 93.58 97.41 93.20 40437874 (93.47%) 39717155 (98.22%) 32745307 (82.45%)
CON-HS 47140474 44069394 93.48 97.50 93.41 41280931 (93.67%) 40539904 (98.20%) 33240066 (81.99%)
CON-HS 43717128 40762814 93.24 97.46 93.30 38212338 (93.74%) 37568345 (98.31%) 30760020 (81.88%)
CON-HS 42854260 39883672 93.06 97.37 93.10 37313984 (93.56%) 36644658 (98.21%) 30167020 (82.32%)
CON-HS 43123352 40181010 93.17 97.43 93.25 37611789 (93.61%) 36952386 (98.25%) 30604117 (82.82%)
CON-HS 43289698 40334250 93.17 97.25 92.86 37670072 (93.39%) 37019973 (98.27%) 30492496 (82.37%)
LCT-HS 46124528 42923384 93.05 97.44 93.27 40153869 (93.55%) 39457948 (98.27%) 32824598 (83.19%)
LCT-HS 42848720 40096198 93.57 97.44 93.28 37433653 (93.36%) 36794646 (98.29%) 30279966 (82.29%)
LCT-HS 46452404 43396068 93.42 97.38 93.13 40608982 (93.58%) 39840696 (98.11%) 32489048 (81.55%)
LCT-HS 49630912 46344096 93.37 97.38 93.13 43334148 (93.51%) 42586540 (98.27%) 35328459 (82.96%)
LCT-HS 43752414 40883600 93.44 97.31 92.99 38187780 (93.41%) 37527391 (98.27%) 31037008 (82.70%)
LCT-HS 46996756 43894898 93.39 97.40 93.17 41109770 (93.66%) 40416804 (98.31%) 33093549 (81.88%)
Open in a new tab

Differentially Expressed Genes

In this study, a total of 246 DEGs were found in the hypothalamic tissues of broilers, which consisted of 123 upregulated and 123 downregulated genes. A comparison of the gene expression between CON-TN and LCT-TN groups showed that there were 57 DEGs, of which 42 were upregulated and 15 were downregulated (Figure 1). On the other hand, a comparison between CON-HS and LCT-HS groups showed 38 DEGS, in which 23 transcripts were upregulated while 15 were downregulated. Figure 2A and B shows the volcano plots of upregulated and downregulated DEG between the CON-TN and LCT-TN groups, and the CON-HS and LCT-HS groups respectively.

Figure 1.

Figure 1

Open in a new tab

Summary of RNA-Seq of differentially expressed genes.

Figure 2.

Figure 2

Open in a new tab

Volcano plot showing the differentially expressed genes (A) CON-TN vs. LCT-TN (B) CON-HS vs. LCT-HS. Red dots show the upregulated genes, and blue dots show the downregulated genes. Gray dots show indifferent genes.

Analysis of the GO and KEGG Enrichment for DEGs

The functional roles of DEGs were further assessed through GO and KEGG pathway enrichment analysis. The top 10 GO term entries in each main category of cell component, biological process, and molecular functions are presented in Figure 3A and B. Also, the top 20 most significantly enriched GO terms related to thermoregulation are presented in Figure 4A and B (P < 0.05 and FDR < 0.05). The CON-TN and LCT-TN had 1,404 GO terms comprising 1,066 BP, 126 CC, and 212 MF. The central nervous system development, Wnt signaling pathway, adult feeding behavior, and C-X-C chemokine receptor activity were identified in BP; extracellular region and plasma membrane-bounded cell projection were enriched in CC while serotonin transmembrane transporter activity and C-X-C chemokine receptor activity were of significant interest in MF. The CON-HS and LCT-HS had 1,335 GO terms comprising 1,097 BP, 74 CC, and 164 MF. The regulation of corticosteroid hormone secretion, Wnt signaling pathway involved in kidney development, regulation of feeding behavior; cytokine production, and regulation of inflammatory response were among the most significant terms in BF, while MF had neuropeptide receptor binding and G-protein-coupled receptor binding.

Figure 3.

Figure 3

Open in a new tab

Top 10 enriched GO terms for differentially expressed genes: (A) Bar graph of CON-TN vs. LCT-TN. (B) Bar graph of CON-HS vs. LCT-HS. The pink bar represents cellular components (CC); green bar represents molecular functions (MF); and blue bar represents biological processes (BP).

Figure 4.

Figure 4

Open in a new tab

GO-enriched terms for 20 differentially expressed genes. (A) GO scatter plot of CON-TN vs. LCT-TN. (B) GO scatter plot of CON-HS vs. LCT-HS. For the scatter plot, the y-axis shows the GO terms, and the x-axis shows the Rich factor.

KEGG enrichment was performed to understand the biological functions and gene interactions for the DEGs identified. The analysis identified 46 pathways in the hypothalamus of broilers and out of these, 17 pathways were significantly enriched at P < 0.05 and FDR < 0.25 (Figure 5A and B). The enriched pathways included the intestinal immune network for IgA production, adipocytokine signaling pathway, retinol metabolism, neuroactive ligand-receptor interaction, melanogenesis, Wnt signaling pathway, mTOR signaling pathway, calcium signaling pathway, cardiac muscle contraction, adrenergic signaling in cardiomyocytes, apelin signaling pathway, neuroactive ligand-receptor interaction, and p53 signaling pathway.

Figure 5.

Figure 5

Open in a new tab

KEGG enrichment bar plots of differentially expressed genes (A) CON-TN vs. LCT-TN (B) CON-HS vs. LCT-HS.

Identification of Candidate Genes

Using the GO and KEGG pathway analysis, and the degree of significance of the DEGs, several potential candidate genes were identified that may be involved in the body temperature regulation of broilers (Table 5). A protein-protein network was further visualized and the linkages between potential candidate genes were established (Figure 6).

Table 5.

List of potential candidate genes selected for thermoregulation and appetite regulation in the hypothalamus of L-citrulline-supplemented broilers under different ambient temperature.

Group Expression type Genes Description log2foldchange P value GO terms KEGG terms
CON-TN vs.
LCT-TN		 Upregulated EMX2 Empty spiracles homeobox 2 1.074704417 0.000303979 Brain development; central nervous system development
WFIKKN2 WAP, follistatin/kazal, immunoglobulin, kunitz, and netrin domain containing 2 1.322322762 0.018590212 Anatomical structure development
SLC6A4 Solute carrier family 6 member 4 1.025693279 0.020507041 Brain development; serotonin transmembrane transporter activity
Wnt10a Wnt family member 10A 1.717741241 0.024167691 Wnt signaling pathway; nervous system development; neurogenesis; G-protein-coupled receptor binding Melanogenesis; Wnt signaling pathway; mTOR signaling pathway
Downregulated Wnt2b Wnt family member 2B −1.089594259 0.000749724 Neurogenesis; central nervous system development; brain development; nervous system development; Wnt signaling pathway; regulation of anatomical structure morphogenesis; G-protein-coupled receptor binding Melanogenesis; Wnt signaling pathway; mTOR signaling pathway
Wnt3 Wnt family member 3 −1.109263381 0.001758548 Neurogenesis; central nervous system development; brain development; nervous system development; Wnt signaling pathway; regulation of anatomical structure morphogenesis; G-protein-coupled receptor binding Melanogenesis; Wnt signaling pathway; mTOR signaling pathway
DMBX1 Diencephalon/mesencephalon homeobox 1 −2.593003276 0.04809068 Adult feeding behavior; anatomical structure development; central nervous system development; brain development
FGF8 fibroblast growth factor 8 −1.573812015 0.011162614 Brain development; central nervous system development; cellular developmental process; nervous system development; epithelium development; regulation of anatomical structure morphogenesis
CON-HS vs.
LCT-HS		 Upregulated NPY Neuropeptide Y 1.016361255 0.002706662 Central nervous system neuron development; neuropeptide receptor binding; G-protein-coupled receptor binding; G-protein-coupled receptor signaling pathway; central nervous system neuron development Adipocytokine signaling pathway
AgRP Agouti-related neuropeptide 2.93468203 0.011206365 Receptor binding Adipocytokine signaling pathway
NLRC3 NLR family CARD domain containing 3 1.182937972 0.039463645 Cytokine production; regulation of inflammatory response; negative regulation of cytokine production; receptor binding; regulation of inflammatory response
GATA3 GATA binding protein 3 1.088128851 0.007661942 Positive regulation of thyroid hormone generation; cytokine production; regulation of inflammatory response; negative regulation of inflammatory response; sympathetic nervous system development
PHOX2B Paired like homeobox 2b 2.60742253 0.046426075 Brain development; central nervous system neuron development; autonomic nervous system development; sympathetic nervous system development
Downregulated GAL Galanin and GMAP prepropeptide −1.029428357 0.01022577 Neuropeptide receptor binding; G-protein-coupled receptor binding; regulation of corticosteroid hormone secretion; G-protein-coupled receptor signaling pathway Neuroactive ligand-receptor interaction
POMC Proopiomelanocortin −1.624110655 0.010433512 Regulation of appetite; cytokine production; negative regulation of cytokine production; neuropeptide receptor binding; G-protein-coupled receptor binding; regulation of corticosteroid hormone secretion Adipocytokine signaling pathway; Melanogenesis
NMU Neuromedin U −1.792968398 0.012513814 Regulation of feeding behavior; neuropeptide receptor binding; G-protein-coupled receptor binding; G-protein-coupled receptor signaling pathway Neuroactive ligand-receptor interaction
Open in a new tab

Abbreviations: GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 6.

Figure 6

Open in a new tab

Network diagram showing the protein-to-protein interaction between candidate genes. The yellow color shows upregulated genes, red color shows downregulated genes, and the blue color shows differentially expressed genes but not candidate genes that are predictably involved in the protein network.

Validation of RNA-Sequencing Results

To validate the expression levels of DEGs from the RNA-Seq analysis, some upregulated genes (CHAT, CXCR1, NPY, AgRP, FLT) and downregulated genes (WNT3, MYLK2, POMC) were selected for qRT-PCR validation as presented in Figure 7A. The qPCR results showed a similar regulatory trend in the expression of these genes. Pearson's correlation coefficient (r = 0.9419) and linear regression results revealed a strong relationship and association between the results obtained from qRT-PCR and RNA-Seq (Figure 7B).

Figure 7.

Figure 7

Open in a new tab

Validation of the mRNA expression levels for selected transcripts. (A) Comparison of the log2foldchange (n = 6). (B) Linear regression equation and correlation. RNA-Seq: RNA sequencing; qRT-PCR: real-time quantitative reverse transcription PCR.

DISCUSSION

An identification of the candidate genes and pathways involved in thermoregulation can provide targets for understanding and improving environmental management in poultry production. This study employed transcriptome analysis to examine the hypothalamic responses of broilers fed L-citrulline-supplemented diets under thermoneutral or high-temperature conditions. Broilers exposed to HS had decreased body weight, body weight gain, and feed intake. Also, the feed conversion ratio was lowered due to the interaction effect, especially in the CON-HS group. This corroborates with previous reports that heat stress negatively affects the growth performance of poultry (Flees et al., 2017; Rajaei-Sharifabadi et al., 2017). At the finishing phase, feeding broilers with LCT diet improved the feed intake and feed conversion ratio of broilers better than the CON diet. Additionally, LCT diet fed to HS broilers alleviated HS suppression on feed intake and feed conversion ratio of broilers, although no effects were found on the body weight and body weight gain of broilers. This suggests that LCT supplementation during HS may prove beneficial in sustaining the feed consumption of broilers, thus moderately supporting their performance. These findings align with the report that L-citrulline supplementation maintained the growth performance of heat-stressed broilers by minimizing protein catabolism and modulating protein synthesis (Uyanga et al., 2022b). The limitation of this study was that the growth performance of the experimental birds was lesser compared to the commercial guidelines for Ross broilers (Aviagen, 2018), throughout the experimental period. This affected all experimental groups regardless of treatment conditions, thus suggesting the influence of other inherent factors besides the experimental treatments which may have impacted the early growth and establishment of chickens. Therefore, further studies investigating the effects of L-citrulline on the growth performance and production indexes of chickens are highly encouraged.

From the molecular analysis, a large number of detected genes did not differ between the groups; however, some significant DEGs were identified between the CON and LCT-fed broilers at different housing temperatures, suggesting variability between the dietary groups. Based on the transcriptomic studies, 57 and 38 DEGs were identified between CON-TN vs. LCT-TN and CON-HS vs. LCT-HS groups, respectively. This reveals that a higher number of DEGs were found in the hypothalamus under thermoneutral temperatures than at high temperatures. Unexpectedly, HS did not induce a higher number of DEGs, probably due to physiological adaptations that occur during prolonged heat exposure (Renaudeau et al., 2012). In a similar study, more DEGs were found between the heat stress and control group compared to temperature recovery and control group in the hypothalamus of broiler chickens (Sun et al., 2015). To ascertain the reliability of the transcriptomic results, some DEGs were selected for qRT-PCR validation, and the mRNA expression levels of these genes suggest their coherence with the RNA-Seq. This suggests the reliability, consistency, and accuracy of the RNA-Seq for differential gene identification (Gao et al., 2019; Bello et al., 2021).

The GO annotation and KEGG analysis were conducted to further understand the biological roles of these DEGs. Several DEGs in the hypothalamus were assigned to biological processes and molecular functions, than the cellular components. The activated GO terms between the CON-TN and LCT-TN groups were those involved with central nervous system development, brain development, cellular development processes, Wnt signaling, epithelium development, neurogenesis, adult feeding behavior, and serotonin transmembrane transporter activity. Comparison between CON-HS and LCT-HS groups revealed that the activated GO terms were related to brain development, regulation of appetite, cytokine production, regulation of corticosteroid hormone secretion, neuropeptide receptor binding, and G-protein-coupled receptor binding. This agrees with the previous report that in the hypothalamus of 45-wk old cockerels, the activated GO biological processes and enriched pathways were primarily associated with brain structure development; and DEGs were related to neurogenesis, neurological signal transmission, and neurotransmitter secretion (Piorkowska et al., 2018).

The KEGG pathway enrichment analysis revealed that 11 pathways were identified between CON-TN and LCT-TN groups. The highest DEGs were found in Melanogenesis, the Wnt signaling pathway, and the mTOR signaling pathway. Under high-temperature conditions, the activated KEGG pathways identified between the CON-HS and LCT-HS groups were the adipocytokine signaling pathway, retinol metabolism, neuroactive ligand-receptor interaction, and melanogenesis. The melanogenesis pathway in chickens is important for feather pigmentation (Wang et al., 2019). The light-absorbing effect of melanin in the skin and hair affords photoprotection, thermoregulation, camouflage, and color display (D'Mello et al., 2016). In addition, Tian et al. (2020) found that the melanogenesis pathway and vascular smooth muscle contraction pathway were significantly enriched in chickens as a functional adaptation for survival during heat stress in tropical climates. Alongside this, Wnt signaling is known to play a major role in embryonic development, adult brain morphogenesis, cell proliferation, survival, and differentiation (Helfer and Tups, 2016). Thus, Wnt signaling is crucial in the neuroendocrine control of the hypothalamus and plays an important role in food intake and body weight regulation (Helfer and Tups, 2016). Another integral signaling pathway is the mTOR signaling, which is colocalized with hypothalamic neurons such as neuropeptide Y and proopiomelanocortin neurons (Cota et al., 2006). The hypothalamic mTOR signaling is directly related to the regulation of food intake and energy status; and its activation is an important anorexigenic signal in chickens (Hu et al., 2021).

Based on the transcriptomic analysis, the differential gene expressions related to the hypothalami responses of CON-TN vs. LCT-TN broilers showed upregulated expressions for EMX2, WFIKKN2, SLC6A4, and Wnt10a, whereas, Wnt2b, Wnt3, DMBX1, and FGF8 were downregulated under thermoneutral temperatures. On the other hand, the analysis revealed significant upregulation of GATA3, PHOX2B, NLRC3, NPY, and AgRP, whereas, GAL, POMC, and NMU were downregulated between the CON-HS and LCT-HS broilers. The following discussion is mainly focused on the differentially expressed genes related to thermoregulation, brain development, and feed consumption.

Among the DEGs identified, the empty spiracles homeobox 2 (EMX2) functions in cerebral cortex development and it is vital for the proper morphogenesis of the central nervous system (CNS) structures (Spigoni et al., 2010). EMX2 is also involved in diencephalon development, neuroblast proliferation, migration, and differentiation (Cecchi, 2002). Alongside this, the WAP, follistatin/kazal, immunoglobulin, kunitz, and netrin domain containing (WFIKKN) is a protein family that is expressed in the brain, muscle, and skeletal tissues (Kondás et al., 2008), and may act as a TGFβ family transporter to regulate the access of growth factors to the central nervous system (Monestier and Blanquet, 2016). Transcriptional profiles between a modern and a legacy broiler line (21 d of age) revealed that WFIKKN2 was significantly enriched among the genes responsible for myogenic growth and differentiation (Davis et al., 2015). Thus, the WFIKKN2 may function in LCT-fed birds to promote the transit of growth factors to the CNS. This coincides with the previous report that L-citrulline supplementation promoted the plasma concentration of growth hormone, insulin-like growth factor-1, and body growth of broiler chickens (Uyanga et al., 2022a). Contrarily, the present study showed that LCT feeding did not exert significant effects on the body weight and body weight gain of broilers. The reasons for this disparity in findings are yet to be ascertained and may require further investigations.

Solute carrier family 6, member 4 (SLC6A4) also known as serotonin transporter acts as a neurotransmitter in the central and peripheral nervous systems (Wang and Wang, 2016). Phi-van et al. (2014) demonstrated that polymorphism in the 5′-flanking region of the serotonin transporter resulted in a significant increase in body weight, higher body mass index, and increased physical activity in chickens. Thus, in line with the functional analysis results, the EMX2, WFIKKN2, and SLC6A4 genes are essential in various aspects of CNS development in chickens and they were upregulated between the CON-TN and LCT-TN groups.

The Wnt family members are lipid-modified glycoproteins that play functional roles in tissue development during embryogenesis (Katoh and Katoh, 2009). Previous report showed that heat and LPS treatment suppressed Wnt10a expression in the bursa of Fayoumi and broiler chickens, adversely affecting B cell proliferation and humoral immunity in chickens (Monson et al., 2018). Also, an alteration in Wnt2b affected normal neural development since its upregulation may cause excessive signaling and disordered neural development (Bai et al., 2016). In addition, Wnt3 is reportedly involved in the proliferation of neural crest lineages, and it influences melanogenesis in chickens (Dongkyun et al., 2010). Studies have also suggested the existence of possible crosstalk between the Wnt and mTOR signaling pathways which may function to regulate cellular proliferation, differentiation, and other significant processes of neurodevelopment (Prossomariti et al., 2020).

In addition, fibroblast growth factor 8 (FGF8) has been identified as an important signaling molecule in the normal development of the midbrain in chick embryo and chick limb development (Crossley et al., 1996). Also, DMBX1 is a paired-type homeobox gene that is expressed within the digestive system and CNS where it is involved in the development of neural tissues during embryogenesis (Gogoi et al., 2002). Importantly, DMBX1 is essential for AgRP actions and it also functions in the normal regulation of feeding behavior and energy homeostasis (Fujimoto et al., 2007; Hirono et al., 2016). Thus, the downregulation of both FGF8 and DMBX1 would have implications for brain development and feeding behavior, respectively. Altogether, these findings reveal significant differential effects of these DEGs in their response to L-citrulline diet under thermoneutrality, especially as it relates to CNS development, feed behavior, and thermal homeostasis.

In chickens, GATA3 binding protein (GATA3) plays vital functions during adipogenesis and inflammatory conditions (Sun et al., 2020). Also, NLRC3 is a member of the nucleotide-binding domain and leucine-rich repeat containing (NLR) family (Li et al., 2020), that functions to either positively or negatively control inflammatory responses via its regulation of inflammasome formation (Zhang et al., 2014). In line with the results of our functional analysis, both GATA3 and NLRC3 enrichment would prove vital in regulating metabolism, and inflammatory responses in broilers under high-temperature conditions. In addition, Paired-like homeodomain protein 2b (PHOX2B) enrichment suggests its role in CNS development and control of thermoregulation. PHOX2B is crucial in the synthesis of essential enzymes needed for catecholamine biosynthesis, as well as in the differentiation and determination of the fate of serotonin (5-HT) neurons, which play pivotal roles in the respiratory and thermoregulatory circuits (Alenina et al., 2006; Ramanantsoa et al., 2011). Therefore, the upregulation of these transcripts may be associated with the regulatory role of L-citrulline in alleviating heat stress effects via its direct mediation of both thermoregulatory mechanisms and inflammatory responses to restore thermal homeostasis.

Neuropeptide Y (NPY) is an amino acid peptide that functions as an important orexigenic agent in the central regulation of appetite, weight gain, and energy homeostasis in chickens (Chen et al., 2007). Within the arcuate nucleus of the hypothalamus, NPY and agouti-related peptide (AgRP) neuropeptides function to increase feed intake, whereas, proopiomelanocortin (POMC) decreases food intake (Yousefi et al., 2021). More so, coordinated changes occur in the activity of AgRP and POMC neurons which help to drive the homeostatic response for energy balance in birds (Boswell and Dunn, 2017). Thus, the AgRP/NPY neurons elicit anabolic effects on food intake and body mass whereas, the POMC/CART neurons exert catabolic effects (Boswell and Dunn, 2017). In the present study, the NPY, AgRP, and POMC were related to the adipocytokine signaling pathway which is crucial in regulating energy homeostasis and metabolic functions, thus confirming the role of these candidate genes in energy balance, food intake, and body metabolism. In line with these findings, the mRNA expressions of NPY and ASIP were increased in chickens raised under high temperatures in response to HS-induced suppression of food intake (Ito et al., 2015). Thus, L-citrulline's regulation of these genes may be crucial in restoring thermotolerance in heat-stressed chickens.

The NMU system is also implicated in several physiological roles including energy expenditure, feeding behavior, stress response, inflammation, and circadian rhythm (Teranishi and Hanada, 2021). In chickens, central administration of NMU reduced feed intake and upregulated hypothalamic neuropeptides such as corticotrophin-releasing factor (CRF), and arginine-vasotocin (Kamisoyama et al., 2007). In the present study, NMU was downregulated during HS probably due to its role as an anorexigenic peptide in the CNS of chickens. In addition, galanin administration is associated with several biological effects such as stimulation of feeding, increased pituitary hormone secretion, inhibition of memory and learning, decreased acetylcholine and glutamate secretion, and inhibition of insulin release (Crawley, 1995). In the chicken gut, galanin receptors may afford a possible linkage with the central nervous system to influence food consumption (DeGolier et al., 1999). Tachibana et al. (2008) also demonstrated that intracerebroventricular injection of galanin influenced feeding behavior in chickens by increasing the feed intake of both layer and broiler chicks. In this study, GAL expression was downregulated, which differed from the upregulated expressions of other orexigenic factors; NPY and AgRP.

Therefore, these findings may suggest the differential effects of LCT diet on these neuropeptides in order to promote thermal homeostasis, since they are largely involved in feed intake and energy balance. Additionally, it is probable that these neuropeptides responsible for feed intake may interact with other neurotransmitters to regulate appetite, energy homeostasis, and body temperature (Rahmani et al., 2021). The central expression of anabolic neuropeptides (such as NPY, AgRP, MCH, and orexins) promotes food intake but suppresses metabolic rate causing hypothermia, whereas, catabolic neuropeptides (such as POMC and NMU) act to reduce food intake and increase energy expenditure with the tendency to induce hyperthermia (Szekely et al., 2010). Therefore, L-citrulline's influence on hypothalamic neuropeptides may contribute to the central regulation of energy balance, directly influencing the body temperature of chickens. Altogether, this study revealed that LCT significantly enriched the gene expression and pathways concerned with central nervous system development in chickens raised under thermoneutral (TN) temperatures. In contrast, LCT significantly enriched hypothalamic transcripts and functional pathways associated with feed intake and energy balance in broilers raised under high (HS) temperatures. Therefore, this study unveils the functional effects of L-citrulline on CNS development, feed regulation, immune response, and thermoregulation in broilers raised either at thermoneutrality or high-temperature conditions.

ACKNOWLEDGMENTS

Funding: This work was funded by the Key Technologies Research and Development Program of China (2021YFD1300405), the Earmarked Fund for China Agriculture Research System (CARS-40-K09), and Key Technology Research and Development Program of Shandong Province (2019JZZY020602).

Data Availability Statement: The dataset generated and/or analyzed in this study has been submitted to Gene Expression Omnibus (GEO) under the accession number GSE202003.

Author Contributions: Conceptualization: V. A. U. and H. L. Data curation: V. A. U., S. F. B., N. C., and H. L. Formal analysis: V. A. U., S. F. B., Q. X., and N. C. Funding acquisition: H. L. Supervision: N. C. and H. L. Project administration: H. L., J. Z., X. W., H. J., O. M. O., and H. L. Writing-original draft: V. A. U. Writing review & editing: V. A. U. and H. L.

DISCLOSURES

The authors declare that they have no conflicts of interest.

REFERENCES

  1. Abdel-Moneim A.-M.E., Shehata A.M., Khidr R.E., Paswan V.K., Ibrahim N.S., El-Ghoul A.A., Aldhumri S.A., Gabr S.A., Mesalam N.M., Elbaz A.M., Elsayed M.A., Wakwak M.M., Ebeid T.A. Nutritional manipulation to combat heat stress in poultry – a comprehensive review. J. Therm. Biol. 2021;98 doi: 10.1016/j.jtherbio.2021.102915. [DOI] [PubMed] [Google Scholar]
  2. Alenina N., Bashammakh S., Bader M. Specification and differentiation of serotonergic neurons. Stem Cell Rev. 2006;2:5–10. doi: 10.1007/s12015-006-0002-2. [DOI] [PubMed] [Google Scholar]
  3. Allerton T.D., Proctor D.N., Stephens J.M., Dugas T.R., Spielmann G., Irving B.A. L-citrulline supplementation: impact on cardiometabolic health. Nutrients. 2018;10:921. doi: 10.3390/nu10070921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Aviagen . Aviagen Incorporated; USA: 2018. Pages 1–148 in Ross Broiler Management Handbook.http://en.aviagen.com/assets/Tech_Center/Ross_Broiler/Ross-BroilerHandbook2018-EN.pdf Accessed Sept. 2023. [Google Scholar]
  5. Ayo J.O., Obidi J.A., Rekwot P.I. Effects of heat stress on the well-being, fertility, and hatchability of chickens in the northern Guinea savannah zone of Nigeria: a review. ISRN Vet. Sci. 2011;2011 doi: 10.5402/2011/838606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bai B., Chen S., Zhang Q., Jiang Q., Li H. Abnormal epigenetic regulation of the gene expression levels of Wnt2b and Wnt7b: implications for neural tube defects. Mol. Med. Rep. 2016;13:99–106. doi: 10.3892/mmr.2015.4514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bello S.F., Xu H., Guo L., Li K., Zheng M., Xu Y., Zhang S., Bekele E.J., Bahareldin A.A., Zhu W., Zhang D., Zhang X., Ji C., Nie Q. Hypothalamic and ovarian transcriptome profiling reveals potential candidate genes in low and high egg production of white Muscovy ducks (Cairina moschata) Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Boswell T., Dunn I.C. Regulation of agouti-related protein and pro-opiomelanocortin gene expression in the avian arcuate nucleus. Front. Endocrinol. (Lausanne) 2017;8:75. doi: 10.3389/fendo.2017.00075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cecchi C. Emx2: a gene responsible for cortical development, regionalization and area specification. Gene. 2002;291:1–9. doi: 10.1016/s0378-1119(02)00623-6. [DOI] [PubMed] [Google Scholar]
  10. Chen G.Q., Hu X.F., Sugahara K., Chen J.S., Song X.M., Zheng H.C., Jiang Y.Q., Huang X., Jiang J.F., Zhou W.D. Type-dependent differential expression of neuropeptide Y in chicken hypothalamus (Gallus domesticus) J. Zhejiang Univ. Sci. B. 2007;8:839–844. doi: 10.1631/jzus.2007.B0839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cheng C.Y., Tu W.L., Chen C.J., Chan H.L., Chen C.F., Chen H.H., Tang P.C., Lee Y.P., Chen S.E., Huang S.Y. Functional genomics study of acute heat stress response in the small yellow follicles of layer-type chickens. Sci. Rep. 2018;8:1320. doi: 10.1038/s41598-017-18335-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chowdhury V.S., Han G., Bahry M.A., Tran P.V., Do P.H., Yang H., Furuse M. L-citrulline acts as potential hypothermic agent to afford thermotolerance in chicks. J. Therm. Biol. 2017;69:163–170. doi: 10.1016/j.jtherbio.2017.07.007. [DOI] [PubMed] [Google Scholar]
  13. Cota D., Proulx K., Smith Kathi A.B., Kozma Sara C., Thomas G., Woods Stephen C., Seeley Randy J. Hypothalamic mTOR signaling regulates food intake. Science. 2006;312:927–930. doi: 10.1126/science.1124147. [DOI] [PubMed] [Google Scholar]
  14. Crawley J.N. Biological actions of galanin. Regul. Pept. 1995;59:1–16. doi: 10.1016/0167-0115(95)00083-n. [DOI] [PubMed] [Google Scholar]
  15. Crossley P.H., Minowada G., MacArthur C.A., Martin G.R. Roles for FGF8 in the induction, initiation, and maintenance of chick limb development. Cell. 1996;84:127–136. doi: 10.1016/s0092-8674(00)80999-x. [DOI] [PubMed] [Google Scholar]
  16. Daghir N.J. Nutritional strategies to reduce heat stress in broilers and broiler breeders. Lohmann Inf. 2009;44:6–14. [Google Scholar]
  17. Davis R.V.N., Lamont S.J., Rothschild M.F., Persia M.E., Ashwell C.M., Schmidt C.J. Transcriptome analysis of post-hatch breast muscle in legacy and modern broiler chickens reveals enrichment of several regulators of myogenic growth. PLoS One. 2015;10 doi: 10.1371/journal.pone.0122525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. DeGolier T.F., Nordell J.N., Pust M.H., Duke G.E. Effect of galanin on isolated strips of smooth muscle from the gastrointestinal tract of chickens. J. Exp. Zool. 1999;283:463–468. doi: 10.1002/(sici)1097-010x(19990301/01)283:4/5<463::aid-jez16>3.0.co;2-s. [DOI] [PubMed] [Google Scholar]
  19. D'Mello S.-A., Finlay G., Baguley B., Askarian-Amiri M. Signaling pathways in melanogenesis. Int. J. Mol. Sci. 2016;17:1144. doi: 10.3390/ijms17071144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dongkyun K., Jinsoo S., Jin E.J. Wnt-3 and Wnt-3a play different region-specific roles in neural crest development in avians. Cell Biol. Int. 2010;34:763–768. doi: 10.1042/CBI20090133. [DOI] [PubMed] [Google Scholar]
  21. Farag M.R., Alagawany M. Physiological alterations of poultry to the high environmental temperature. J. Therm. Biol. 2018;76:101–106. doi: 10.1016/j.jtherbio.2018.07.012. [DOI] [PubMed] [Google Scholar]
  22. Flees J., Rajaei-Sharifabadi H., Greene E., Beer L., Hargis B.M., Ellestad L., Porter T., Donoghue A., Bottje W.G., Dridi S. Effect of Morinda citrifolia (noni)-enriched diet on hepatic heat shock protein and lipid metabolism-related genes in heat stressed broiler chickens. Front. Physiol. 2017;8:919. doi: 10.3389/fphys.2017.00919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fujimoto W., Shiuchi T., Miki T., Minokoshi Y., Takahashi Y., Takeuchi A., Kimura K., Saito M., Iwanaga T., Seino S. Dmbx1 is essential in agouti-related protein action. Proc. Natl. Acad. Sci. U. S. A. 2007;104:15514–15519. doi: 10.1073/pnas.0707328104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gao S., Jiang H., Sun J., Diao Y., Tang Y., Hu J. Integrated analysis of miRNA and mRNA expression profiles in spleen of specific pathogen-free chicken infected with avian reticuloendotheliosis virus strain SNV. Int. J. Mol. Sci. 2019;20:1041. doi: 10.3390/ijms20051041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gogoi R., Schubert F., Martínez-Barberá J.P., Acampora D., Simeone A., Lumsden A. The paired-type homeobox gene Dmbx1 marks the midbrain and pretectum. Mech. Dev. 2002;114:213–217. doi: 10.1016/s0925-4773(02)00067-9. [DOI] [PubMed] [Google Scholar]
  26. Helfer G., Tups A. Hypothalamic wnt signalling and its role in energy balance regulation. J. Neuroendocrinol. 2016;28:12368. doi: 10.1111/jne.12368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hirono S., Lee E.Y., Kuribayashi S., Fukuda T., Saeki N., Minokoshi Y., Iwanaga T., Miki T. Importance of adult dmbx1 in long-lasting orexigenic effect of agouti-related peptide. Endocrinology. 2016;157:245–257. doi: 10.1210/en.2015-1560. [DOI] [PubMed] [Google Scholar]
  28. Hu X., Kong L., Xiao C., Zhu Q., Song Z. The AMPK-mTOR signaling pathway is involved in regulation of food intake in the hypothalamus of stressed chickens. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2021;258 doi: 10.1016/j.cbpa.2021.110979. [DOI] [PubMed] [Google Scholar]
  29. Ito K., Bahry M.A., Hui Y., Furuse M., Chowdhury V.S. Acute heat stress up-regulates neuropeptide Y precursor mRNA expression and alters brain and plasma concentrations of free amino acids in chicks. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2015;187:13–19. doi: 10.1016/j.cbpa.2015.04.010. [DOI] [PubMed] [Google Scholar]
  30. Ito K., Erwan E., Nagasawa M., Furuse M., Chowdhury V.S. Changes in free amino acid concentrations in the blood, brain and muscle of heat-exposed chicks. Br. Poult. Sci. 2014;55:644–652. doi: 10.1080/00071668.2014.957653. [DOI] [PubMed] [Google Scholar]
  31. Kamisoyama H., Honda K., Saneyasu T., Sugahara K., Hasegawa S. Central administration of neuromedin U suppresses food intake in chicks. Neurosci. Lett. 2007;420:1–5. doi: 10.1016/j.neulet.2007.03.062. [DOI] [PubMed] [Google Scholar]
  32. Katoh M., Katoh M. Transcriptional regulation of WNT2B based on the balance of Hedgehog, notch, BMP and WNT signals. Int. J. Oncol. 2009;34:1411–1415. [PubMed] [Google Scholar]
  33. Kondás K., Szláma G., Trexler M., Patthy L. Both WFIKKN1 and WFIKKN2 have high affinity for growth and differentiation factors 8 and 11. J. Biol. Chem. 2008;283:23677–23684. doi: 10.1074/jbc.M803025200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Li W., Zhang Y., Hu Z., Xu Y. Overexpression of NLRC3 enhanced inhibition effect of sevoflurane on inflammation in an ischaemia reperfusion cell model. Folia Neuropathol. 2020;58:213–222. doi: 10.5114/fn.2020.100064. [DOI] [PubMed] [Google Scholar]
  35. Monestier O., Blanquet V. WFIKKN1 and WFIKKN2: "companion" proteins regulating TGFβ activity. Cytokine Growth Factor Rev. 2016;32:75–84. doi: 10.1016/j.cytogfr.2016.06.003. [DOI] [PubMed] [Google Scholar]
  36. Monson M.S., Van Goor A.G., Ashwell C.M., Persia M.E., Rothschild M.F., Schmidt C.J., Lamont S.J. Immunomodulatory effects of heat stress and lipopolysaccharide on the bursal transcriptome in two distinct chicken lines. BMC Genom. 2018;19:643. doi: 10.1186/s12864-018-5033-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Monson M.S., Van Goor A.G., Persia M.E., Rothschild M.F., Schmidt C.J., Lamont S.J. Genetic lines respond uniquely within the chicken thymic transcriptome to acute heat stress and low dose lipopolysaccharide. Sci. Rep. 2019;9:13649. doi: 10.1038/s41598-019-50051-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Mori A., Morita M., Morishita K., Sakamoto K., Nakahara T., Ishii K. L-citrulline dilates rat retinal arterioles via nitric oxide- and prostaglandin-dependent pathways in vivo. J. Pharmacol. Sci. 2015;127:419–423. doi: 10.1016/j.jphs.2015.02.012. [DOI] [PubMed] [Google Scholar]
  39. Morrison S.F. Central control of body temperature. F1000 Res. 2016;5:F1000. doi: 10.12688/f1000research.7958.1. Faculty Rev-880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Nakamura K. Central circuitries for body temperature regulation and fever. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011;301:R1207–R1228. doi: 10.1152/ajpregu.00109.2011. [DOI] [PubMed] [Google Scholar]
  41. Nakamura K., Morrison S.F. A thermosensory pathway that controls body temperature. Nat. Neurosci. 2008;11:62–71. doi: 10.1038/nn2027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. NRC . Nutrient Requirements of Poultry. 9th revised ed. National Academy Press; Washington D.C., USA: 1994. pp. 1–173. [Google Scholar]
  43. Park W., Srikanth K., Lim D., Park M., Hur T., Kemp S., Dessie T., Kim M.S., Lee S.R., Te Pas M.F.W., Kim J.M., Park J.E. Comparative transcriptome analysis of Ethiopian indigenous chickens from low and high altitudes under heat stress condition reveals differential immune response. Anim. Genet. 2019;50:42–53. doi: 10.1111/age.12740. [DOI] [PubMed] [Google Scholar]
  44. Phi-van L., Holtz M., Kjaer J.B., van Phi V.D., Zimmermann K. A functional variant in the 5′-flanking region of the chicken serotonin transporter gene is associated with increased body weight and locomotor activity. J. Neurochem. 2014;131:12–20. doi: 10.1111/jnc.12799. [DOI] [PubMed] [Google Scholar]
  45. Piorkowska K., Zukowski K., Poltowicz K., Nowak J., Wojtysiak D., Derebecka N., Wesoly J., Ropka-Molik K. Transcriptomic changes in broiler chicken hypothalamus during growth and development. Int. J. Genom. 2018;2018 doi: 10.1155/2018/6049469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Prossomariti A., Piazzi G., Alquati C., Ricciardiello L. Are Wnt/β-Catenin and PI3K/AKT/mTORC1 distinct pathways in colorectal cancer? Cell Mol. Gastroenterol. Hepatol. 2020;10:491–506. doi: 10.1016/j.jcmgh.2020.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rahmani B., Ghashghayi E., Zendehdel M., Khodadadi M., Hamidi B. The crosstalk between brain mediators regulating food intake behavior in birds: a review. Int. J. Pept. Res. Ther. 2021;27:2349–2370. [Google Scholar]
  48. Rajaei-Sharifabadi H., Ellestad L., Porter T., Donoghue A., Bottje W.G., Dridi S. Noni (Morinda citrifolia) modulates the hypothalamic expression of stress- and metabolic-related genes in broilers exposed to acute heat stress. Front. Genet. 2017;8:192. doi: 10.3389/fgene.2017.00192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Ramanantsoa N., Matrot B., Vardon G., Lajard A.-M., Voituron N., Dauger S., Denjean A., Hilaire G., Gallego J. Impaired ventilatory and thermoregulatory responses to hypoxic stress in newborn phox2b heterozygous knock-out mice. Front. Physiol. 2011;2:61. doi: 10.3389/fphys.2011.00061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Renaudeau D., Collin A., Yahav S., de Basilio V., Gourdine J.L., Collier R.J. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal. 2012;6:707–728. doi: 10.1017/S1751731111002448. [DOI] [PubMed] [Google Scholar]
  51. Rimoldi S., Lasagna E., Sarti F.M., Marelli S.P., Cozzi M.C., Bernardini G., Terova G. Expression profile of six stress-related genes and productive performances of fast and slow growing broiler strains reared under heat stress conditions. Meta Gene. 2015;6:17–25. doi: 10.1016/j.mgene.2015.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Shannon P., Markiel A., Ozier O., Baliga N.S., Wang J.T., Ramage D., Amin N., Schwikowski B., Ideker T. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–2504. doi: 10.1101/gr.1239303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Spigoni G., Gedressi C., Mallamaci A. Regulation of Emx2 expression by antisense transcripts in murine cortico-cerebral precursors. PLoS One. 2010;5:e8658. doi: 10.1371/journal.pone.0008658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sun H., Jiang R., Xu S., Zhang Z., Xu G., Zheng J., Qu L. Transcriptome responses to heat stress in hypothalamus of a meat-type chicken. J. Anim. Sci. Biotechnol. 2015;6:6. doi: 10.1186/s40104-015-0003-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sun Y., Jin Z., Zhang X., Cui T., Zhang W., Shao S., Li H., Wang N. GATA binding protein 3 is a direct target of kruppel-like transcription factor 7 and inhibits chicken adipogenesis. Front. Physiol. 2020;11:610. doi: 10.3389/fphys.2020.00610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Szekely M., Petervari E., Balasko M. Thermoregulation, energy balance, regulatory peptides: recent developments. Front. Biosci. (Schol. Ed.) 2010;2:1009–1046. doi: 10.2741/s116. [DOI] [PubMed] [Google Scholar]
  57. Tachibana T., Mori M., Khan M.S., Ueda H., Sugahara K., Hiramatsu K. Central administration of galanin stimulates feeding behavior in chicks. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2008;151:637–640. doi: 10.1016/j.cbpa.2008.08.001. [DOI] [PubMed] [Google Scholar]
  58. Teranishi H., Hanada R. Neuromedin U, a key molecule in metabolic disorders. Int. J. Mol. Sci. 2021;22:4238. doi: 10.3390/ijms22084238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tian S., Zhou X., Phuntsok T., Zhao N., Zhang D., Ning C., Li D., Zhao H. Genomic analyses reveal genetic adaptations to tropical climates in chickens. iScience. 2020;23 doi: 10.1016/j.isci.2020.101644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Uyanga V.A., Jiao H., Zhao J., Wang X., Lin H. Dietary L-citrulline supplementation modulates nitric oxide synthesis and anti-oxidant status of laying hens during summer season. J. Anim. Sci. Biotechnol. 2020;11:103. doi: 10.1186/s40104-020-00507-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Uyanga V.A., Wang M., Tong T., Zhao J., Wang X., Jiao H., Onagbesan O.M., Lin H. L-citrulline influences the body temperature, heat shock response and nitric oxide regeneration of broilers under thermoneutral and heat stress condition. Front. Physiol. 2021;12 doi: 10.3389/fphys.2021.671691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Uyanga V.A., Zhao J., Wang X., Jiao H., Onagbesan O.M., Lin H. Dietary L-citrulline modulates the growth performance, amino acid profile, and the growth hormone/insulin-like growth factor axis in broilers exposed to high temperature. Front. Physiol. 2022;13 doi: 10.3389/fphys.2022.937443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Uyanga V.A., Zhao J., Wang X., Jiao H., Onagbesan O.M., Lin H. Effects of dietary L-citrulline supplementation on nitric oxide synthesis, immune responses and mitochondrial energetics of broilers during heat stress. J. Therm. Biol. 2022;105 doi: 10.1016/j.jtherbio.2022.103227. [DOI] [PubMed] [Google Scholar]
  64. Wang Y., Jia X., Hsieh J., Monson M., Zhang J., Shu D., Nie Q., Persia M., Rothschild M., Lamont S. Transcriptome response of liver and muscle in heat-stressed laying hens. Genes. 2021;12:255. doi: 10.3390/genes12020255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wang X., Li D., Song S., Zhang Y., Li Y., Wang X., Liu D., Zhang C., Cao Y., Fu Y., Han R., Li W., Liu X., Sun G., Li G., Tian Y., Li Z., Kang X. Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens. PLoS One. 2019;14 doi: 10.1371/journal.pone.0210850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Wang K., Wang L. In: Pages 247–259 in Molecular Aspects of Alcohol and Nutrition. Patel V.B., editor. Academic Press; San Diego, CA: 2016. Chapter 20 – Genes associated with alcohol withdrawal. [Google Scholar]
  67. Yousefi M., Jonaidi H., Sadeghi B. Influence of peripheral lipopolysaccharide (LPS) on feed intake, body temperature and hypothalamic expression of neuropeptides involved in appetite regulation in broilers and layer chicks. Br. Poult. Sci. 2021;62:110–117. doi: 10.1080/00071668.2020.1813254. [DOI] [PubMed] [Google Scholar]
  68. Zhang L., Mo J., Swanson K., Wen H., Petrucelli A., Gregory S., Zhang Z., Schneider M., Jiang Y., Fitzgerald K., Ouyang S., Liu Z-J., Damania B., Shu H.-B., Duncan J., Ting J. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING. Immunity. 2014;40:329–341. doi: 10.1016/j.immuni.2014.01.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Zhang J., Schmidt C., Lamont S. Transcriptome analysis reveals potential mechanisms underlying differential heart development in fast-and slow-growing broilers under heat stress. BMC Genom. 2017;18:295. doi: 10.1186/s12864-017-3675-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Zhang Q., Zhang B., Luo Y. Cardiac transcriptome study of the effect of heat stress in yellow-feather broilers. Ital. J. Anim. Sci. 2019;18:971–975. [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES