Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2023 Sep 6;102(12):103091. doi: 10.1016/j.psj.2023.103091

Current status of β-lactam antibiotic use and characterization of β-lactam-resistant Escherichia coli from commercial farms by integrated broiler chicken operations in Korea

Hye-Ri Jung *, Yu Jin Lee *, Serim Hong *, Sunghyun Yoon †, Suk-Kyung Lim ‡, Young Ju Lee *,1
PMCID: PMC10587523  PMID: 37839166

Abstract

β-Lactam antibiotics are one of the most clinical importance in human and veterinary medicine because they are used for both preventive and therapeutic purposes against several gram-positive, gram-negative, and anaerobic organisms. In this study, it was confirmed that β-lactams (81.1%) were found to be significantly prescribed the most among 74 farms in 5 integrated broiler operations, and single prescription (84.6%), 2-day (41.5%) or 3-day (40.0%) administration, and 15 to 22 d of age (67.7%) administration was significantly higher in the farms (P < 0.05). Among the E. coli isolated from 74 farms in 5 integrated broiler operations, β-lactam-resistant E. coli isolates were detected more frequently in fecal sample (94.6%) than in dust sample (60.8%) (P < 0.05). The prevalence of MDR in β-lactam-resistant isolates, ranging from 88.1 to 96.5%, was significantly higher than that in non–β-lactam-resistant isolates (P < 0.05), without significant differences among operations. Of 466 β-lactam-resistant isolates, 432 (92.7%) isolates harbored β-lactamase genes. The non–extended-spectrum β-lactamase (ESBL) gene blaTEM-1 (81.8%) showed the highest prevalence among isolates, followed by the non-ESBL gene blaTEM-135 (6.4%) (P < 0.05). Five ESBL genes, SHV-12, OXA-1, CTX-M-27, CTX-M-55, and CTX-M-65, were found in 0.9 to 6.0% of the isolates. The pAmpC gene blaCMY-2 was detected in 17 isolates (3.6%). These results suggest that feces and dust are important reservoirs of antimicrobial-resistant bacteria, highlighting the need to strengthen farm management regulations, such as cleaning, disinfection, and litter disposal and to reduce the use of antibiotics in broiler operations.

Key words: β-lactam antibiotic, β-lactam-resistant Escherichia coli, integrated broiler operation

INTRODUCTION

Antimicrobial resistance (AMR) is a major public health concern worldwide ( WHO, 2021). Annual AMR-related deaths are expected to reach approximately 10 million by 2050 (O'Neill, 2016). In particular, β-lactam antibiotics are one of the most clinically important in human and veterinary medicine because they are extensively used for the treatment and prevention of bacterial infections. Therefore, bacterial resistance to β-lactam antibiotics has become a worldwide health concern (Bush, 2018; AbdelRahman et al., 2020; Khalifa et al., 2021).

β-Lactam antibiotics, such as penicillins, cephalosporins, monobactams, and carbapenems, are a group of antibiotics that contain a β-lactam ring in their structure and inhibit bacteria growth by inactivating penicillin-binding proteins (PBPs), which are involved in cell wall biosynthesis (Waxman and Strominger, 1983; De Angelis et al., 2020). β-Lactamase provides antibiotic resistance by breaking the β-lactam ring through hydrolysis (Bush, 2018). In particular, extended-spectrum β-lactamase (ESBL), which confers resistance to extended-spectrum penicillins and cephalosporins, has been continuously detected in Enterobacteriaceae, including Escherichia coli (Seo et al., 2018; Song et al., 2020b; Clemente et al., 2021). Moreover, E. coli, which encodes for antimicrobial resistance, can spread these AMR genes to humans via horizontal gene transfer mediated by various mobile DNA elements, such as plasmids, transposons, integrons, and genomic islands (von Wintersdorff et al., 2016; Partridge et al., 2018).

In Korea, the broiler chicken integrated operation system, owns breeder farms, hatcheries, feed mills, and processing plants, produces 94.8% of chicken meat, 51.4% of which is produced by 5 large operation systems (KAMIS, 2018). According to the report on National Antibiotic Use and Resistance Monitoring in Korea (MFDS, 2021), the sale of antibiotics for chickens has been continuously increasing since 2012, with ampicillin (AM) showing the highest sale. Therefore, resistance to AM has persistently increased in pathogens associated with chickens and their products. But Kim et al. (2007) reported that each broiler operation implements its own distinct biosecurity and sanitation practices, vaccine programs, and antibiotic regimens, and differences in these factors might be associated with antimicrobial usage patterns among integrated operations. Therefore, this study was conducted to analyze the current status of β-lactam antibiotic use and characterization of β-lactam-resistant E. coli among the 5 major integrated broiler chicken operations in Korea.

MATERIALS AND METHODS

Data Source

A situational analysis of 74 farms of 5 integrated broiler chicken operations was conducted using a questionnaire that represented patterns of β-lactam antibiotic use during the broiler grow-out period. The questions included: the class of antibiotics used for the treatment or prevention of disease, and frequency, duration, and age of administration of β-lactam antibiotics.

Sample Collection

Fecal and dust samples were collected from a total of 74 farms, with at least 10 farms selected from each operation during 2021. According to the standard set of by the National Poultry Improvement Plan (NPIP) (USDA, 2019, 10 g of dust was collected using a sterile surgical gauze moistened with sterile double-strength skim milk. Feces were also sampled from 5 different sites within each flock. Each sample was placed in a sterile bag and transported to the laboratory under 4°C conditions.

Bacterial Isolation

The isolation and identification of E. coli were performed following the standard microbiological protocols published by the Ministry of Food and Drug Safety (MFDS, 2018). Briefly, 10 g of each fecal and dust sample was inoculated into 90 mL of buffered peptone water (BPW; BD Biosciences, San Jose, CA). After incubation for 18 to 24 h at 37°C, 1 mL of pre-enriched BPW was inoculated into 9 mL of mEC broth (Merck, Darmstadt, Germany), and the cultured mEC broth was streaked onto MacConkey agar (BD Biosciences, Sparks, MD). At least 3 presumptive E. coli colonies were selected from each sample and confirmed using PCR, as described previously (Sobur et al., 2019). If the isolates from the same origin showed the same antimicrobial susceptibility patterns, only 1 isolate was randomly selected.

Antimicrobial Susceptibility Testing

According to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2021), the antimicrobial susceptibility of E. coli was examined using antimicrobial disk (BD Biosciences) as follows: AM (10 μg), amoxicillin-clavulanate (20 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), cefotaxime (30 μg), cefazolin (30 μg), cefepime (30 μg), cefoxitin (30 μg), gentamicin (5 μg), imipenem (10 μg), nalidixic acid (30 μg), trimethoprim-sulfamethoxazole (1.25/23.75 μg), and tetracycline (30 μg). E. coli ATCC 25922 was included for quality control. Multidrug resistance (MDR) was defined as resistance to at least 1 agent of 3 or more antimicrobial classes (Magiorakos et al., 2012).

Detection of β-Lactamase Encoding Genes

The presence of β-lactamase genes, blaTEM, blaSHV, blaOXA, blaCTX-M, and plasmid-mediated AmpC (pAmpC), was confirmed by PCR using primers listed in Table 1 (Pérez-Pérez and Hanson, 2002; Pitout et al., 2004; Dallenne et al., 2010). The PCR products were also sequenced using an automatic sequencer (Cosmogenetech, Daejeon, South Korea), and the obtained sequences were compared with those in the GenBank nucleotide database using the Basic Local Alignment Search Tool (BLAST) program available at the National Center for Biotechnology Information website (www.ncbi.nlm. nih.gov/BLAST).

Table 1.

Primers used in this study.

Group Target Primer Sequences Size (bp) Reference
ESBL genes TEM TEM-F CATTTCCGTGTCGCCCTTATTC 800 Dallenne et al. (2010)
TEM-R CGTTCATCCATAGTTGCCTGAC
SHV SHV-F AGCCGCTTGAGCAAATTAAAC 713 Dallenne et al. (2010)
SHV-R ATCCCGCAGATAAATCACCAC
OXA OXA-F GGCACCAGATTCAACTTTCAAG 564 Dallenne et al. (2010)
OXA-R GACCCCAAGTTTCCTGTAAGTG
CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 Pitout et al. (2004)
CTXM1-R2 AGCCGCCGACGCTAATACA
CTX-M group II TOHO1-2F GCGACCTGGTTAACTACAATCC 351 Pitout et al. (2004)
TOHO1-1R CGGTAGTATTGCCCTTAAGCC
CTX-M group III CTXM825F CGCTTTGCCATGTGCAGCACC 307 Pitout et al. (2004)
CTXM825R GCTCAGTACGATCGAGCC
CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 Pitout et al. (2004)
CTXM914R GTAAGCTGACGCAACGTCTG
pAmpC genes MOXM MOXM-F GCTGCTCAAGGAGCACAGGAT 520 Pérez-Pérez and Hanson (2002)
MOXM-R CACATTGACATAGGTGTGGTGC
CITM CITM-F TGGCCAGAACTGACAGGCAAA 462 Pérez-Pérez and Hanson (2002)
CITM-R TTTCTCCTGAACGTGGCTGGC
DHAM DHAM-F AACTTTCACAGGTGTGCTGGGT 405 Pérez-Pérez and Hanson (2002)
DHAM-R CCGTACGCATACTGGCTTTGC
ACCM ACCM-F AACAGCCTCAGCAGCCGGTTA 346 Pérez-Pérez and Hanson (2002)
ACCM-R TTCGCCGCAATCATCCCTAGC
EBCM EBCM-F TCGGTAAAGCCGATGTTGCGG 302 Pérez-Pérez and Hanson (2002)
EBCM-R CTTCCACTGCGGCTGCCAGTT
FOXM FOXM-F AACATGGGGTATCAGGGAGATG 190 Pérez-Pérez and Hanson (2002)
FOXM-R CAAAGCGCGTAACCGGATTGG
Open in a new tab

Statistical Analysis

Statistical Package for the Social Sciences (SPSS) v.25 (IBM Corp., Armonk, NY) was used for statistical analyses. Pearson's chi-squared and Fisher's exact test with Bonferroni correction were also performed. Differences were considered significant at P < 0.05.

RESULTS

Analysis of Antibiotics Prescribed in Integrated Broiler Chicken Operations

The antibiotic prescription status analysis in the farms of 5 integrated broiler chicken operations is shown in Table 2. Of the 6 antibiotic classes, β-lactams (81.1%) showed the significantly highest prescribed in all farms tested in this study (P < 0.05), followed by phenicols (43.3%), fluoroquinolones (31.1%), macrolides (17.6%), tetracyclines (2.7%), and sulfonamides (1.4%). However, phenicols were significantly highly prescribed in the farms of operation A, whereas fluoroquinolones were significantly highly prescribed in the farms of operations D and E (P < 0.05).

Table 2.

Analysis of the prescription status of β-lactam antibiotics in 5 integrated broiler chicken operations.

Subgroup No. of farms included/no. of farms by integrated broiler operations (%)
 Total
A B C D E
Antibiotics class administrated for treatment or prevention of disease during broiler production
 β-Lactams 14/15 (93.3) 16/20 (80.0) 11/15 (73.3) 12/14 (85.7) 7/10 (70.0) 60/74 (81.1)A
 Phenicols 11/15 (73.3)a 10/20 (50.0)a,b 8/15 (53.3)a,b 2/14 (14.3)b 1/10 (10.0)b 32/74 (43.3)B
 Fluoroquinolones 0/15 (0.0)b 8/20 (40.0)a,b 0/15 (0.0)b 10/14 (71.4)a 5/10 (50.0)a 23/74 (31.1)B,C
 Macrolides 1/15 (6.7) 3/20 (15.0) 2/15 (13.3) 6/14 (42.8) 1/10 (10.0) 13/74 (17.6)C
 Tetracyclines 2/15 (13.3) 0/20 (0.0) 0/15 (0.0) 0/14 (0.0) 0/10 (0.0) 2/74 (2.7)C
 Sulfonamides 0/15 (0.0) 0/20 (0.0) 0/15 (0.0) 0/14 (0.0) 1/10 (10.0) 1/74 (1.4)D
Trends in prescribing of β-lactam antibiotics Number of β-lactam antibiotics prescribed
 Single 13/15 (86.6) 14/18 (77.8) 10/12 (83.3) 11/13 (84.6) 7/7 (100.0) 55/65 (84.6)A
 Consecutive 1/15 (6.7) 2/18 (11.1) 1/12 (8.3) 1/13 (7.7) 0/7 (0.0) 5/65 (7.7)B
Period of administration (d)
 1 1/15 (6.7) 2/18 (11.1) 1/12 (8.3) 2/13 (15.4) 0/7 (0.0) 6/65 (9.2)B
 2 5/15 (33.3)b 11/18 (61.1)a 3/12 (25.0)b 5/13 (38.5)b 3/7 (42.9)a,b 27/65 (41.5)A
 3 7/15 (46.7)a 4/18 (22.2)b 6/12 (50.0)a 5/13 (38.5)a,b 4/7 (57.1)a 26/65 (40.0)A
 4 1/15 (6.7) 0/18 (0.0) 1/12 (8.3) 1/13 (7.7) 0/7 (0.0) 3/65 (4.6)B
 5 1/15 (6.7) 1/18 (5.6) 0/12 (0.0) 0/13 (0.0) 0/7 (0.0) 2/65 (3.1)B
 6 0/15 (0.0) 0/18 (0.0) 1/12 (8.3) 0/13 (0.0) 0/7 (0.0) 1/65 (1.5)B
Age of administration (d)
 1≤ ≤6 1/15 (6.7) 1/18 (5.6) 1/12 (8.3) 1/13 (7.7) 1/7 (14.3) 5/65 (7.7)B
 7≤ ≤14 4/15 (26.7)b 2/18 (11.1)c 1/12 (8.3)c 2/13 (15.4)b,c 3/7 (42.9)a 12/65 (18.5)B
 15≤ ≤22 10/15 (66.7)a,b 14/18 (77.8)a 10/12 (83.3)a 7/13 (53.8)b 3/7 (42.9)b 44/65 (67.7)A
 ≥23 0/15 (0.0) 1/18 (5.6) 0/12 (0.0) 3/13 (23.1) 0/7 (0.0) 4/65 (6.2)B
Open in a new tab

Values with different lowercase superscript letters represent significant difference among farms, while different uppercase superscript letters represent significant difference in total (P < 0.05).

Regarding the use of β-lactam antibiotics, the frequency of single prescription (84.6%) and 2-day (41.5%) or 3-day (40.0%) administration was significantly higher in farms (P < 0.05). In particular, the frequency of 2-day administration was significantly higher in operation B (61.1%), whereas that of 3-day administration was significantly higher in operations A (46.7%), C (50.0%), and E (57.1%) (P < 0.05). In addition, all farms of operation E received β-lactam antibiotics for only 2 to 3 d, 1 farm each of operations A and B for up to 5 d, and 1 farm of operation C for up to 6 d. Also, β-lactam antibiotics were significantly highly prescribed at 15 to 22 d of age (67.7%), followed by 7 to 14 d (18.5%), 1 to 6 d (7.7%), and after 23 d (6.2%) (P < 0.05). One and 3 farms of operations B and D, respectively, were prescribed β-lactam antibiotics after 23 d of age.

Prevalence of β-Lactam-Resistant E. Coli

The distribution of β-lactam-resistant E. coli isolates in the 5 integrated broiler chicken operations is shown in Table 3. Among the E. coli isolated from 74 farms of 5 operations, β-lactam-resistant E. coli isolates were detected more frequently in fecal samples (94.6%) than in dust samples (60.8%). In particular, the distribution of β-lactam-resistant E. coli isolates in fecal samples did not differ significantly among operations, but the distribution of β-lactam-resistant isolates in dust samples was significantly higher in the farms of operation B than in those of other operations (P < 0.05).

Table 3.

Distribution of β-lactam resistant E. coli in 5 integrated broiler chicken operations.

Integrated broiler chicken operation (no. of farms) No. (%) of farms with β-lactam resistant E. coli
Dust Feces
A (15) 6 (40.0)bB 15 (100.0)A
B (20) 18 (90.0)a 19 (95.0)
C (15) 11 (73.3)a,b 13 (86.7)
D (14) 7 (50.0)a,bB 14 (100.0)A
E (10) 3 (30.0)bB 9 (90.0)A
Total (74) 45 (60.8)B 70 (94.6)A
Open in a new tab

Values with different lowercase superscript letters (ab) represent significant difference among operations, while different uppercase subscript letters (AB) represent significant difference in the row (P < 0.05).

Distribution of MDR Prevalence

The distribution of MDR prevalence in β-lactam-resistant and non–β-lactam-resistant E. coli isolated from 5 integrated broiler chicken operations is shown in Figure 1. The prevalence of MDR in β-lactam-resistant isolates ranged from 88.1 to 96.5% without significant difference among operations, but it was significantly higher than non–β-lactam-resistant isolates (P < 0.05). In addition, β-lactam-resistant isolates showed MDR against up to 7 classes of antibiotics, whereas non–β-lactam-resistant isolates showed against up to 5 classes. Moreover, the prevalence of MDR in non–β-lactam-resistant isolates showed significant difference among operations, and the highest MDR prevalence was noted in the farms of operation D (50.0%) (P < 0.05).

Figure 1.

Figure 1

Open in a new tab

Distribution of multidrug-resistant isolates between β-lactam resistant (A) and non–β-lactam resistant (B) E. coli isolated from 5 integrated broiler chicken operations. Values with different lowercase letters (abc) represent significant difference between each operation, while different uppercase letters (AB) represent significant difference between β-lactam resistant (A) and non–β-lactam resistant (B) isolates (P < 0.05).

Distribution of β-Lactamase Genes

The distribution of β-lactamase gene in β-lactam-resistant E. coli isolates from 5 integrated broiler chicken operations is shown in Table 4. Four hundred and thirty-two (92.7%) among 466 β-lactam-resistant isolates harbored β-lactamase genes. The non-ESBL gene blaTEM-1 (81.8%) was significantly highest prevalence among isolates, followed by the non-ESBL gene blaTEM-135 (6.4%) (P < 0.05). In addition, 5 ESBL genes, SHV-12, OXA-1, CTX-M-27, CTX-M-55, and CTX-M-65, were found in 0.9 to 6.0% of isolates. Also, the pAmpC gene blaCMY-2 was detected in 17 isolates (3.6%).

Table 4.

Distribution of β-lactamase gene-carrying β-lactam-resistant E. coli in 5 integrated broiler chicken operations.

Enzyme β-Lactamase gene No. of isolates carrying each gene (%)
A
(n = 79)		 B
(n = 156)		 C
(n = 102)		 D
(n = 87)		 E
(n = 42)		 Total
(n = 466)
Narrow-spectrum β-lactamase blaTEM-1 62 (78.5) 127 (81.4) 82 (80.4) 71 (81.6) 39 (92.9) 381 (81.8)A
blaTEM-135 3 (3.8) 6 (3.8) 9 (8.8) 12 (13.8) 0 (0.0) 30 (6.4)B
Extended-spectrum β-lactamase blaSHV-12 2 (2.5) 4 (2.6) 0 (0.0) 0 (0.0) 0 (0.0) 6 (1.3)C,D
blaOXA-1 0 (0.0) 3 (1.9) 0 (0.0) 0 (0.0) 0 (0.0) 3 (0.6)D
blaCTX-M-27 1 (1.3) 5 (3.2) 3 (2.9) 0 (0.0) 0 (0.0) 9 (1.9)C,D
blaCTX-M-55 7 (8.9) 12 (7.7) 6 (5.9) 2 (2.3) 1 (2.4) 28 (6.0)B
blaCTX-M-65 0 (0.0) 1 (0.6) 2 (2.0) 0 (0.0) 1 (2.4) 4 (0.9)C,D
Plasmidic class C β-lactamase blaCMY-2 6 (7.6) 4 (2.6) 4 (3.9) 3 (3.4) 0 (0.0) 17 (3.6)B,C
No. of isolates carrying 1 or more
β-Lactamase gene (%)		 71 (89.9) 143 (91.7) 95 (93.1) 83 (95.4) 40 (95.2) 432 (92.7)
Open in a new tab

Values with different uppercase superscript letters represent significant difference among β-lactamase gene (P < 0.05).

DISCUSSION

In the poultry industry, antibiotics are used for both preventive and therapeutic purposes (Roth et al., 2019). However, the indiscriminate use of antibiotics has resulted in the emergence of AMR even in commensal bacteria such as E. coli, which can easily transfer AMR determinants to other bacteria (Rasheed et al., 2014; Das et al., 2020). In this study, it was confirmed that β-lactam antibiotics were administrated the most in all farms, and β-lactam-resistant E. coli isolates were detected more frequently in fecal samples (94.6%) than in dust samples (60.8%). In particular, the distribution of β-lactam-resistant E. coli isolates in fecal samples showed high prevalence without significant differences among operations. Musa et al. (2020) reported that compared with conventional chickens raised only indoor, the lowest proportion of ESBL E. coli isolates was found in skin samples from organic chickens raised in a housing system with relatively less contact with litter. Feces are prominent reservoir of antibiotic-resistant bacteria (Fletcher, 2015; Chuppava et al., 2019); therefore, the reuse of broiler litter mixed with poultry excreta, spilled feed, and feathers can significantly affect the persistence of resistant bacteria on farms, irrespective of antibiotic use. In this study, the distribution of β-lactam-resistant E. coli isolates in dust samples showed significantly higher prevalence in the farms of operation B than in the other operations. Just as feces are reservoir with high concentrations of antimicrobial-resistant bacteria, dust can also form bioaerosols containing antimicrobial-resistant bacteria so cleaning and disinfecting the farm environments after all-out of broiler is absolutely necessary (Gazal et al., 2021; Lopes et al., 2022).

In this study, β-lactam-resistant isolates showed a significantly higher MDR prevalence and were resistant to more antibiotic classes than non–β-lactam-resistant isolates. Moreover, although MDR prevalence did not differ significantly among operations, the highest MDR prevalence in both β-lactam and non–β-lactam-resistant isolates was found on the farms of operation D. Most farms in 5 operations tested in this study were administrated various antibiotics, including phenicols, fluoroquinolones, and macrolides as well as β-lactams, during the broiler grow-out period. Of them, fluoroquinolones and macrolides were the most highly administrated on farms in operation D among the 5 integrated operations, and their administration may have induced MDR even in non–β-lactam-resistant isolates.

Gambi et al. (2022) reported that antimicrobial-resistant E. coli isolates were identified even in broiler farms where antibiotics were not used, and AMR genes were detected in feces/manure, water, and soil. In particular, genes that confer resistance to antibiotics are often located in the same mobile genetic element and can spread and persist between bacteria and the environment, irrespective of antibiotic use (Olaitan et al., 2016). β-Lactamase production is the most important factor contributing to β-lactam resistance in gram-negative pathogens (Pitout and Laupland, 2008). In particular, ESBL and pAmpC hydrolyze the β-lactam ring, conferring resistance to several β-lactam antibiotics, including clinically important extended-spectrum cephalosporins (Bush, 2018). In this study, among the β-lactamase genes, blaTEM-1 (81.8%), which encodes a narrow-spectrum β-lactamase, were the significantly highest detected in farms. Bradford (2001) reported that TEM-1 is the most common β-lactamase in gram-negative bacteria and is responsible for up to 90% of AM resistance in E. coli. Fadare and Okoh (2021) also reported that initially, TEM-1 was the most common β-lactamase enzyme, but soon after, blaTEM rapidly spread to other species and produced a blaSHV enzyme that hydrolyzes cephalosporins due to changes in their amino acid composition. TEM-1 hydrolyzes the β-lactam ring, conferring resistance to penicillin and early generation cephalosporins, but some mutations, such as amino acid substitutions that increase hydrolysis, can lead to the emergence of dangerous pathogens that are resistant to even more important antibiotics (Palzkill, 2018). In addition, 6.4% among β-lactam-resistant isolates harbored blaTEM-135, which is a gene that is not frequently detected in poultry in Korea and other countries (Kameyama et al., 2013; Liu et al., 2015; Alfifi et al., 2022; Kim et al., 2022). But, TEM-135 could be also an intermediate precursor in the evolution of TEM-1 into ESBL, which would induce high-level resistance to all extended-spectrum cephalosporins (Zhao et al., 2022), therefore, the possible evolution of blaTEM-135 must be further investigated in the future.

In this study, the prevalence of ESBL/pAmpC genes among β-lactam-resistant isolates was low, ranging from 0.6 to 6.0%. Previously, blaCTX-M-15 was considered as the dominant ESBL gene (Chon et al., 2015; Jo and Woo, 2015); however, blaCTX-M-55 has recently been reported as the dominant ESBL gene in the Korean poultry industry (Park et al., 2019; Song et al., 2020a; Kim et al., 2021). The prevalence of blaCTX-M-55 was 6.0% in this study, whereas blaCTX-M-15 was not detected. The blaCTX-M-55 is a variant of blaCTX-M-15 with only 1 amino acid substitution, A77V, resulting in better substrate recognition and higher catalytic activity of cephalosporins due to better structural stability (He et al., 2015). In addition, since CTX-M-55 is found in various plasmid types of E. coli isolated from food animals, the influx of antimicrobial resistance genes increases and rapid spread through horizontal transfer can occur (Song et al., 2020a; Zeng et al., 2021). Therefore, genetic analysis of CTX-M types should be continuously performed to monitor the transfer and mutation of the ESBL gene.

The persistent presence of antimicrobial-resistant bacteria in poultry not only enhances antimicrobial resistance, but also increases the threat of antimicrobial resistance to animals, humans the environment. Our results also support that it is necessary to establish a strategies to strengthen farm management regulation such as cleaning, disinfection, and litter disposal, while reducing the use of antibiotics for each broiler operation.

ACKNOWLEDGMENTS

This work was supported by the Animal and Plant Quarantine Agency, Ministry of Agriculture, Food and Rural affairs, Republic of Korea (Grant Number Z-1543061-2021-23-02).

DISCLOSURES

The authors declare that they have no competing interest.

REFERENCES

  1. AbdelRahman M.A.A., Roshdy H., Samir A.H., Hamed E.A. Antibiotic resistance and extended-spectrum β-lactamase in Escherichia coli isolates from imported 1-day-old chicks, ducklings, and turkey poults. Vet. World. 2020;13:1037–1044. doi: 10.14202/vetworld.2020.1037-1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alfifi A., Christensen J.P., Hounmanou Y.M.G., Sandberg M., Dalsgaard A. Characterization of Escherichia coli and other bacteria isolated from condemned broilers at a Danish abattoir. Front. Microbiol. 2022;13:1–13. doi: 10.3389/fmicb.2022.1020586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bradford P.A. Extended-spectrum β-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 2001;14:933–951. doi: 10.1128/CMR.14.4.933-951.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bush K. Past and present perspectives on β-Lactamases. Antimicrob. Agents Chemother. 2018;62:1–20. doi: 10.1128/AAC.01076-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chon J.W., Jung H.I., Kuk M., Kim Y.J., Seo K.H., Kim S.K. High occurrence of extended-spectrum β-lactamase-producing Salmonella in broiler carcasses from poultry slaughterhouses in South Korea. Foodborne Pathog. Dis. 2015;12:190–196. doi: 10.1089/fpd.2014.1847. [DOI] [PubMed] [Google Scholar]
  6. Chuppava B., Keller B., Abd El-Wahab A., Sürie C., Visscher C. Resistance reservoirs and multi-drug resistance of commensal Escherichia coli from excreta and manure isolated in broiler houses with different flooring designs. Front. Microbiol. 2019;10:1–11. doi: 10.3389/fmicb.2019.02633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Clemente L., Leão C., Moura L., Albuquerque T., Amaro A. Prevalence and characterization of ESBL/AmpC producing Escherichia coli from fresh meat in portugal. Antibiotics. 2021;10:1333. doi: 10.3390/antibiotics10111333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Clinical and Laboratory Standards Institute (CLSI) 31st ed. Clinical and Laboratory Standards Institute (CLSI); Wayne, PA: 2021. Performance Standards for Antimicrobial Susceptibility Testing. [Google Scholar]
  9. Dallenne C., da Costa A., Decré D., Favier C., Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010;65:490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  10. Das A., Dhar P.K., Dutta A., Jalal M.S., Ghosh P., Das T., Barua H., Biswas P.K. Circulation of oxytetracycline- and ciprofloxacin-resistant commensal Escherichia coli strains in broiler chickens and farm environments, Bangladesh. Vet. World. 2020;13:2395–2400. doi: 10.14202/vetworld.2020.2395-2400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De Angelis G., Del Giacomo P., Posteraro B., Sanguinetti M., Tumbarello M. Molecular mechanisms, epidemiology, and clinical importance of β-lactam resistance in enterobacteriaceae. Int. J. Mol. Sci. 2020;21:5090. doi: 10.3390/ijms21145090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fadare F.T., Okoh A.I. The abundance of genes encoding ESBL, pAmpC and non-β-lactam resistance in multidrug-resistant enterobacteriaceae recovered from wastewater effluents. Front. Environ. Sci. 2021;9:1–12. [Google Scholar]
  13. Fletcher S. Understanding the contribution of environmental factors in the spread of antimicrobial resistance. Environ. Health Prev. Med. 2015;20:243–252. doi: 10.1007/s12199-015-0468-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gambi L., Crippa C., Lucchi A., De Cesare A., Parisi A., Manfreda G., Pasquali F. The resistome of commensal Escherichia coli isolated from broiler carcasses “produced without the use of antibiotics”. Poult. Sci. 2022;101:1–7. doi: 10.1016/j.psj.2022.101770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gazal L.E.de S., Medeiros L.P., Dibo M., Nishio E.K., Koga V.L., Gonçalves B.C., Grassotti T.T., de Camargo T.C.L., Pinheiro J.J., Vespero E.C., de Brito K.C.T., de Brito B.G., Nakazato G., Kobayashi R.K.T. Detection of ESBL/AmpC-producing and fosfomycin-resistant Escherichia coli from different sources in poultry production in Southern Brazil. Front. Microbiol. 2021;11:1–11. doi: 10.3389/fmicb.2020.604544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. He D., Chiou J., Zeng Z., Liu L., Chen X., Zeng L., Chan E.W.C., Liu J.-H., Chen S. Residues distal to the active site contribute to enhanced catalytic activity of variant and hybrid β-lactamases derived from CTX-M-14 and CTX-M-15. Antimicrob. Agents Chemother. 2015;59:5976–5983. doi: 10.1128/AAC.04920-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jo S.J., Woo G.J. Molecular characterization of plasmids encoding CTX-M β-lactamases and their associated addiction systems circulating among escherichia coli from retail chickens, chicken farms, and slaughterhouses in Korea. J. Microbiol. Biotechnol. 2015;26:270–276. doi: 10.4014/jmb.1507.07048. [DOI] [PubMed] [Google Scholar]
  18. Kameyama M., Chuma T., Yabata U., Tominaga K., Iwata H., Okamoto K. Prevalence and epidemiological relationship of CMY-2 ampC β-lactamase and CTX-M extended-spectrum β-lactamase-producing Escherichia coli isolates from broiler farms in Japan. J. Vet. Med. Sci. 2013;75:1009–1015. doi: 10.1292/jvms.12-0453. [DOI] [PubMed] [Google Scholar]
  19. Khalifa S.M., Abd El-Aziz A.M., Hassan R., Abdelmegeed E.S. β-Lactam resistance associated with β-lactamase production and porin alteration in clinical isolates of E. coli and K. pneumoniae. PLoS One. 2021;16:1–22. doi: 10.1371/journal.pone.0251594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim S.W., Kim K., Lee Y.J. Comparative analysis of antimicrobial resistance and genetic characteristics of Escherichia coli from broiler breeder farms in Korea. Can. J. Anim. Sci. 2022;102:342–351. [Google Scholar]
  21. Kim H., Kim Y.A., Seo Y.H., Lee H., Lee K. Prevalence and molecular epidemiology of extended-spectrum-β-lactamase (ESBL)-producing Escherichia coli from multiple sectors of poultry industry in Korea. Antibiotics. 2021;10:1050. doi: 10.3390/antibiotics10091050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kim A., Lee Y.J., Kang M.S., Kwag S.I., Cho J.K. Dissemination and tracking of Salmonella spp. in integrated broiler operation. J. Vet. Sci. 2007;8:155. doi: 10.4142/jvs.2007.8.2.155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Korea Agricultural Marketing Information Service (KAMIS) Korea Agricultural Marketing Information Service (KAMIS); Naju, South Korea: 2018. Report of domestic distribution. [Google Scholar]
  24. Liu H., Wang Y., Wang G., Xing Q., Shao L., Dong X., Sai L., Liu Y., Ma L. The prevalence of Escherichia coli strains with extended spectrum beta-lactamases isolated in China. Front. Microbiol. 2015;6:1–5. doi: 10.3389/fmicb.2015.00335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lopes E.S., Parente C.E.T., Picão R.C., Seldin L. Irrigation ponds as sources of antimicrobial-resistant bacteria in agricultural areas with intensive use of poultry litter. Antibiotics. 2022;11:1650. doi: 10.3390/antibiotics11111650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Magiorakos A.-P., Srinivasan A., Carey R.B., Carmeli Y., Falagas M.E., Giske C.G., Harbarth S., Hindler J.F., Kahlmeter G., Olsson-Liljequist B., Paterson D.L., Rice L.B., Stelling J., Struelens M.J., Vatopoulos A., Weber J.T., Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  27. Ministry of Food and Drug Safety (MFDS) Ministry of Food and Drug Safety (MFDS); Cheongju, South Korea: 2018. Processing Standards and Ingredient Specifications for Livestock Products. [Google Scholar]
  28. Ministry of Food and Drug Safety (MFDS) Ministry of Food and Drug Safety (MFDS); Cheongju, South Korea: 2021. National Antibiotic Use and Resistance Monitoring in Korea. [Google Scholar]
  29. Musa L., Proietti P.C., Branciari R., Menchetti L., Bellucci S., Ranucci D., Marenzoni M.L., Franciosini M.P. Antimicrobial susceptibility of Escherichia coli and ESBL-producing Escherichia coli diffusion in conventional, organic and antibiotic-free meat chickens at slaughter. Animals. 2020;10:1–12. doi: 10.3390/ani10071215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Olaitan A.O., Morand S., Rolain J.M. Emergence of colistin-resistant bacteria in humans without colistin usage: a new worry and cause for vigilance. Int. J. Antimicrob. Agents. 2016;47:1–3. doi: 10.1016/j.ijantimicag.2015.11.009. [DOI] [PubMed] [Google Scholar]
  31. O'Neill, J. 2016. Tackling drug-resistant infections globally: final report and recommendations.
  32. Palzkill T. Structural and mechanistic basis for extended-spectrum drug-resistance mutations in altering the specificity of TEM, CTX-M, and KPC β-lactamases. Front. Mol. Biosci. 2018;5:1–19. doi: 10.3389/fmolb.2018.00016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Park H., Kim J., Ryu S., Jeon B. Predominance of blaCTX-M-65 and blaCTX-M-55 in extended-spectrum β-lactamase-producing Escherichia coli from raw retail chicken in South Korea. J. Glob. Antimicrob. Resist. 2019;17:216–220. doi: 10.1016/j.jgar.2019.01.005. [DOI] [PubMed] [Google Scholar]
  34. Partridge S.R., Kwong S.M., Firth N., Jensen S.O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 2018;31:1–61. doi: 10.1128/CMR.00088-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pérez-Pérez F.J., Hanson N.D. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002;40:2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Pitout J.D.D., Hossain A., Hanson N.D. Phenotypic and molecular detection of CTX-M-β-lactamases produced by Escherichia coli and Klebsiella spp. J. Clin. Microbiol. 2004;42:5715–5721. doi: 10.1128/JCM.42.12.5715-5721.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Pitout J.D., Laupland K.B. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect. Dis. 2008;8:159–166. doi: 10.1016/S1473-3099(08)70041-0. [DOI] [PubMed] [Google Scholar]
  38. Rasheed M.U., Thajuddin N., Ahamed P., Teklemariam Z., Jamil K. Resistência microbiana a drogas em linhagens de Escherichia coli isoladas de fontes alimentares. Rev. Inst. Med. Trop. Sao Paulo. 2014;56:341–346. doi: 10.1590/S0036-46652014000400012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Roth N., Käsbohrer A., Mayrhofer S., Zitz U., Hofacre C., Domig K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: a global overview. Poult. Sci. 2019;98:1791–1804. doi: 10.3382/ps/pey539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Seo K.W., Bin Kim Y., Jeon H.Y., Lim S.K., Lee Y.J. Comparative genetic characterization of third-generation cephalosporin-resistant Escherichia coli from chicken meat produced by integrated broiler operations in South Korea. Poult. Sci. 2018;97:2871–2879. doi: 10.3382/ps/pey127. [DOI] [PubMed] [Google Scholar]
  41. Sobur M.A., Sabuj A.A.M., Sarker R., Rahman A.M.M.T., Kabir S.M.L., Rahman M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World. 2019;12:984–993. doi: 10.14202/vetworld.2019.984-993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Song H.-J., Moon D.C., Mechesso A.F., Kang H.Y., Kim M.H., Choi J.-H., Kim S.-J., Yoon S.-S., Lim S.-K. Resistance profiling and molecular characterization of extended-spectrum/plasmid-mediated AmpC β-lactamase-producing Escherichia coli isolated from healthy broiler chickens in South Korea. Microorganisms. 2020;8:1434. doi: 10.3390/microorganisms8091434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Song J., Oh S.-S., Kim J., Park S., Shin J. Clinically relevant extended-spectrum β-lactamase–producing Escherichia coli isolates from food animals in South Korea. Front. Microbiol. 2020;11:1–9. doi: 10.3389/fmicb.2020.00604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. von Wintersdorff C.J.H., Penders J., van Niekerk J.M., Mills N.D., Majumder S., van Alphen L.B., Savelkoul P.H.M., Wolffs P.F.G. Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Front. Microbiol. 2016;7:1–10. doi: 10.3389/fmicb.2016.00173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. United States Department of Agriculture (USDA) United States Department of Agriculture (USDA); Washington DC: 2019. National Poultry Improvement Plan Program Standards. [Google Scholar]
  46. Waxman D.J., Strominger J.L. Penicillin-binding proteins and the mechanism of action of beta-lactam antibiotics. Annu. Rev. Biochem. 1983;52:825–869. doi: 10.1146/annurev.bi.52.070183.004141. [DOI] [PubMed] [Google Scholar]
  47. Zeng S., Luo J., Chen X., Huang L., Wu A., Zhuo C., Li X. Molecular epidemiology and characteristics of CTX-M-55 extended-spectrum β-lactamase-producing Escherichia coli from Guangzhou, China. Front. Microbiol. 2021;12:1–11. doi: 10.3389/fmicb.2021.730012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhao L., Liu A., Li R., Zhang Z., Jia Y., Zhao S. High prevalence of bla TEM-135 and genetic epidemiology of bla TEM-135-carrying Neisseria gonorrhoeae isolates in Shandong, China, 2017–19. J. Antimicrob. Chemother. 2022;77:2406–2413. doi: 10.1093/jac/dkac192. [DOI] [PubMed] [Google Scholar]
  49. World Health Organization (WHO). 2021. World Health Organization. Accessed June 2023. https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance.

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES