Evaluation of an antibacterial peptide‐loaded amniotic membrane/silk fibroin electrospun nanofiber in wound healing

Abstract

Antimicrobial peptides (AMPs) are among the compounds that have significant potential to deal with infectious skin wounds. Using wound dressings or skin scaffolds containing AMPs can be an effective way to overcome infections caused by antibiotic‐resistant strains. In this study, we developed an amniotic membrane‐based skin scaffold using silk fibroin to improve mechanical properties and CM11 peptide as an antimicrobial peptide. The peptide was coated on the scaffold using the soaking method. The fabricated scaffold was characterised by SEM and FTIR, and their mechanical strength, biodegradation, peptide release, and cell cytotoxicity analyses were performed. Then, their antimicrobial activity was measured against antibiotic‐resistant strains of Pseudomonas aeruginosa and Staphylococcus aureus. The in vivo biocompatibility of this scaffold was evaluated by subcutaneously implanting it under the skin of the mouse and counting lymphocytes and macrophages in the implanted area. Finally, the regenerative ability of the scaffold was analyzed in the mouse full‐thickness wound model by measuring the wound diameter, H&E staining, and examining the expression rate of genes involved in the wound healing process. The developed scaffolds exerted an inhibiting effect on the bacteria growth, indicating their proper antimicrobial property. In vivo biocompatibility results showed no significant count of macrophages and lymphocytes between the test and control groups. The wound closure rate was significantly higher in the wound covered with fibroin electrospun‐amniotic membrane loaded with 32 μg/mL CM11, where the relative expression rates of collagen I, collagen III, TGF‐β1 and TGF‐β3 were higher compared with the other groups.

1. INTRODUCTION

Skin wounds are caused by various reasons, such as accidents, cancer, diabetes, electric shock, radiation, friction, infection, and burns. Any factor that destroys the connection between tissue cells will cause a wound. ¹ As infectious wounds are of paramount importance among different types of tissue damage, medical care is most needed to avoid catastrophic consequences after severe wound infections. ² For instance, postburn infections are one of the most important causes of death from these injuries. In recent years, the indiscriminate use of many antibiotics has led to the emergence of new antibiotic‐resistant strains. ³ , ⁴ In addition, using several antibacterial substances, such as silver sulfadiazine, slows down the healing process in burn patients due to damage to the cells involved in the healing process. ⁵ Therefore, new strategies should be intended to both prevent infection and accelerate the wound‐healing process. Tissue engineering is a vast and important part of modern medicine. Every day, researchers introduce new approaches to appropriately restore the function of damaged tissues or even completely reconstruct them. In this light, using different biomaterials is considered as a promising strategy. The human amniotic membrane (AM) is the innermost layer of the three layers that forms the membrane surrounding the fetus, which itself consists of five layers: (1) Cuboidal epithelium layer, (2) Thick basement membrane, (3) Compact layer, (4) Fibroblastic layer and (5) Spongy layer. This tissue was first used in skin grafting in 1910. Since then, there have been numerous reports of the outstanding impact of this membrane in different fields of tissue engineering. ⁶ It is not fully understood how exactly AM accelerates the healing process of the damaged tissue, but what is certain is that the structural and biochemical effects of the membrane, due to the great similarity between natural skin and AM as well as the presence of numerous growth factors, cytokines, anti‐inflammatory factors, angiogenic factors, anti‐scar factors, antimicrobial peptides, etc., are the main reasons for its unique properties. ⁶ Despite all the remarkable features of AM as a suitable skin substitute, its poor mechanical properties and high biodegradability have limited its application as a skin graft. Considering this issue, it is suggested that the AM can be used in combination with some materials that have stronger mechanical properties. Hence, its combination with silk fibroin (SF) can be one of the strategies. ⁷ Previously, the successful electrospinning of the SF on the decellularized amniotic membrane surface has been reported to improve its mechanical properties. ⁸ Silks are fibrous proteins that are produced in the special epithelial cells of Bombyx mori silkworm and spider's glands. SF polymers, which are composed of repeating sequences of amino acids, play a structural role in forming cocoons, building nests, traps, spider webs, etc. Silk, a material whose biocompatibility has been approved by the FDA, not only has a very high specific strength of about 600 times that of collagen but is also able to maintain this strength for an acceptable period of time to completely repair the desired tissue. ⁹ Silk loses its strength in the body after 1 year and disappears completely two years post‐grafting. On the other hand, the presence of arginine and glycine in the structure of silk fibroin (SF) largely mimics natural human proteins with RJD motifs, promoting cell adhesion and proliferation in the grafted area. These properties have made SF a suitable material for tissue engineering. Pure SF is biocompatible and is slowly destroyed in the body, so it supports the adhesion and proliferation of various cells. ¹⁰ As mentioned, with the emergence of antibiotic‐resistant strains, dealing with wound infections is one of the most important challenges in wound treatment. Different strategies have been studied to deal with infections caused by resistant strains. One of these strategies that has received much attention in recent years is the use of antimicrobial peptides (AMPs). ¹¹ , ¹² AMPs are ancient evolutionary weapons. Their widespread distribution throughout the animal and insect kingdoms suggests that AMPs play a pivotal role in the successful evolution of multicellular organisms. ¹³ AMPs are still effective anti‐microbial substances, disproving the common belief that bacteria, fungi, and viruses can become resistant to any imaginable substance. ¹³ , ¹⁴ , ¹⁵ AMPs mostly target the microorganism's membranes, forming various pores on the cell surface, which leads to the microorganism's death. ¹³ CM11, as an antimicrobial peptide, is a hybrid peptide made from cecropin A (2‐8 residues) and melittin (6‐9 residues) with sequence WKLFKKILKVL‐NH_2. ¹⁶ Until now, many studies have been conducted on this combined peptide, which suggests its strong antimicrobial properties against the multidrug‐resistant bacteria. ³ , ¹⁶ , ¹⁷ , ¹⁸

In the current study, an antibacterial AM/SF electrospun nanofiber containing different concentrations of CM11 peptide as a skin scaffold was fabricated, and its effects were evaluated in vitro and in vivo. For this purpose, the mechanical properties, biocompatibility, characterizations, and drug release profile of CM11‐loaded AM/SF were examined. The antibacterial activity of CM11‐loaded AM/SF was investigated against multidrug‐resistant (MDR) strains of S. aureus and P. aeruginosa isolated from burn patients in vitro. In the following, the CM11‐loaded AM/SF was evaluated in mice as a skin scaffold.

2. MATERIALS AND METHODS

2.1. AM isolation and preparation

After providing a consent form, the AM was obtained from mothers without sexually transmitted diseases, including syphilis, hepatitis B, C, and HIV, who underwent cesarean delivery. The tissues were washed several times with normal saline containing gentamicin and under sterile conditions, the chorionic membrane was separated from the amnion and decellularized according to the method described by Gholipourmalekabadi et al. ¹⁹

2.2. DNA content measurement

To confirm the decellularization process, DNA was extracted from fresh and decellularized AM using the DNA Extraction Kit (Sinaclon, Iran), and then DNA concentration was measured by spectrophotometer.

2.3. Fibroin extraction

To extract SF, Bombyx mori silk fibres were degummed. Bombyx mori cocoons and their contents (pupa killed by hot steam) were removed, then the cocoons were boiled in 750 mL of 0.02 M Na₂CO₃ for 1 hour. The obtained fibres were washed three times with 1 L of cold and hot deionised water and dried under a laminar hood overnight. The degummed silk fibres (10% by weight) were dissolved in 3.9 M LiBr solution for 5 hours at 55°C. The concentrated solution of salt and fibroin was dialyzed against UPW for 36 hours (MWCO of 12 000 Da), where fresh UPW was replaced five times at regular intervals. Finally, the final solution was freeze‐dried for 24 hours to obtain a lyophilized SF powder that could be stored at room temperature.

2.4. Fourier‐transform infrared spectroscopy (FTIR)

To identify the functional groups of the isolated SF protein, a pellet was formed using SF and KBr and analysed by FTIR (Bruker IFS 48, Germany) in the range of 500 to 14 000 cm according to ASTM E1252‐07 standard. ²⁰

2.5. SF electrospinning

In order to determine the optimum concentration of electrospun fibroin, three different percentages of water‐soluble fibroin (9, 12, and 15 v/v) were prepared. After testing different conditions, beads‐free fibroin proteins formed fibres with a diameter of nanometres. The resulting nanofibers were immersed in 70% ethanol for 1 hour and then allowed to dry under sterile conditions. The electrospinning conditions included a voltage of 18 kv/cm with a flow rate of 0.3, and a distance of 15 cm.

2.6. SF electrospinning on AM

The AM was placed on the aluminium foil and connected to the electric spinning machine. The optimal percentage of fibroin that gives the most suitable nanofiber (12% solution) was selected and electrospun on AM to form the nano‐diameter fibres. The AM covered with fibroin nanofibres was immersed in 70% ethanol to induce the secondary structure of fibroin. Then it was dried under sterile conditions. Electrospinning conditions were considered as described before.

2.7. Scanning electron microscopy (SEM)

Following the fabrication of AM/SF scaffolds, their surfaces were treated with gold and observed by scanning electron microscope (SEM, Philips XL30, Netherlands) at an accelerated voltage of 15 Kv.

2.8. Peptide loading on the scaffold

Based on the results obtained from the Khosravi Melal et al. study, ²¹ 16, 32, and 64 μg/mL of CM11 peptide were loaded on the synthesised scaffold by the soaking method. Then, the samples were kept at 4°C.

2.9. MTT assay

Six groups, including scaffolds without peptide and loaded with different concentrations of the peptides (AM, AM/SF, AM/SF/P16, AM/SF/P32, AM/SF/P64 and Sham [fibroblast group alone]), were considered for the evaluation. In each group, 10 000 fibroblast cells were cultured in each well, and the plates were incubated for 24, 48, and 72 hours in an incubator at 37°C and 5% CO₂. After each time interval, the MTT solution was added to the wells, where it was incubated for 4 hours at 37°C to form tetrazolium crystals. ²² Afterwards, dimethyl sulfoxide (DMSO) was added to each well to dissolve the formed tetrazolium crystals. At the end, the colour intensity was measured at a wavelength of 570 nm by an ELISA reader (DANA, DA3200). The survival rate of cells in the Sham group was considered 100%, and the rest of the groups were compared with the Sham group (equation 1).

$$\text{Cell\hspace{0.17em}viability}\left(\%\right)=\frac{\mathrm{OD}\text{of\hspace{0.17em}Test\hspace{0.17em}group}-\text{Average}\mathrm{OD}\text{of\hspace{0.17em}negative\hspace{0.17em}group}}{\text{Average}\mathrm{OD}\text{of\hspace{0.17em}Sham\hspace{0.17em}group}}\times 100$$ (1)

2.10. In vitro pH‐dependent accumulative release test

To determine the release of CM11 from fabricated scaffolds at three different pHs, including 5, 7.4, and 9.4, they were placed in a dialysis membrane (MWCO of 12 000 Da) and immersed in PBS with adjusted pHs at 37°C for 4 days. Then, the amount of released peptide was measured cumulatively using a nanodrop (Thermo Fisher Scientific, United States) at 6, 12, 24 hours, 2, 3, and 4 days time intervals.

2.11. Mechanical evaluations

The suture retention strength and strain deflection at break were measured to find the mechanical properties of the developed scaffolds. In this light, the scaffolds were cut into rectangular pieces (2 cm × 1 cm) and tested by a universal tensile strength testing machine with a strain rate of 10 mm/min (n = 5).

2.12. Biodegradation

Biodegradation test was carried out to evaluate the degradation properties of the fabricated scaffolds in the presence of lysozyme. Briefly, after weighing the scaffolds (W1), they were immersed in PBS alone (control group) or PBS containing 10 000 U/L lysozyme (experimental groups) and incubated at 37°C for 1 week. Then, the scaffolds were freeze‐dried and reweighed (W2). The percent of weight loss was measured according to (equation 2):

$$\mathrm{WL}\left(\%\right)=\frac{w1-w2}{w1}\times 100$$ (2)

2.13. Antibacterial evaluations

According to the MTT results, the disk diffusion assay was performed to determine the antimicrobial activity of AM/SF/P16 and AM/SF/P32 scaffolds against MDR strains of P. aeruginosa and S. aureus (as Gram‐negative and Gram‐positive bacteria, respectively) isolated from burn patients based on the protocol described in our previous study. ²¹

2.14. In vivo biocompatibility

To evaluate the biocompatibility of developed scaffolds, they were subcutaneously implanted (the implanted areas were marked) in the dorsal area of male Balb/c mice models using the protocol described in Gholipourmalekabadi's study. ¹⁹ In brief, the mice were anaesthetised with ketamine and xylazine (Sigma, USA) and kept in the animal house for 1 week. Then, the mice were sacrificed, and the tissue samples were removed and processed for H&E staining. Finally, the number of lymphocytes (LC) and macrophages (MQ) were measured in the samples.

2.15. Wound closure analysis

Twelve male Balb/c mice (three mice in each experimental group, including sham, AM, AM/SF, AM/SF/P32) were randomly selected and kept in the animal lab for 1 week before surgery. On the surgery day, the mice were anaesthetised using ketamine and xylazine, and a full‐thickness wound with 1 cm diameter ²³ was created using the punch biopsy method on the dorsal area of animals. The wound closure rate (WCR) was measured a week post‐surgery (the 7th day). To this end, photos of the wound areas were taken with a digital camera. To analyse the wound area, the wound margins were identified using Digimizer software version 4. 1. 1. 0 and the WCR was calculated according to (equation 3) ²² :

$$\mathrm{WCR}\%=\frac{\left(\text{wound area}\mathrm{at}\mathrm{day}\text{of surgery}-\text{wound area after}\mathrm{a}\text{week}\right)}{\text{wound area}\mathrm{at}\mathrm{day}\text{of surgery}}\times 100$$ (3)

2.16. H&E staining

After one‐week post‐surgery, the mice were sacrificed and tissue samples, including the wound bed and normal skin around them were removed, fixed, sectioned, and stained according to the method described earlier. Three slide sections were selected from the sample, where 10 nonoverlapping microscopic field‐of‐views were analysed for the histological analysis. The wound healing scoring was analysed in each stained section. ²⁴

2.17. Gene expression analysis

After harvesting samples from the wound sites and normal tissues, total RNA extraction followed by cDNA synthesis was performed using the RNeasy Mini kit (Sinaclon, Iran) and cDNA Synthesis Kit (Sinaclon, Iran), respectively. Then, the relative expression levels of COL1A1, COL3A1, TGFβ1 and TGFβ3, as effective factors in wound healing, were measured by ABI Step one System (Applied Biosciences, USA) using RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) and specific primers (Sinaclon, Iran) (Table 1). Beta‐2 microglobulin housekeeping gene was selected to normalise data. The relative expression level fold was measured using 2^−ΔΔCT formula.

TABLE 1.

Gene‐specific primer sequences used for quantitative real‐time PCR.

Gene	Forward primer	Reverse primer
TGFβ1	ATCCTGTCCAAACTAAGGCTCG	ACCTCTTTAGCATAGTAGTCCGC
TGFβ3	GGACTTCGGCCACATCAAGAA	TAGGGGACGTGGGTCATCAC
Col1A1	CGAAGGCAACAGTCGCTTCA	GGTCTTGGTGGTTTTGTATTCGAT
Col3A1	GCCCACAGCCTTCTACAC	CCAGGGTCACCATTTCTC
B2M	ACAGTTCCACCCGCCTCACATT	TAGAAAGACCAGTCCTTGCTGAAG

2.18. Statistical analysis

The Kolmogorov–Smirnov normality test was considered to evaluate the normal distribution of all variables. According to the normality test results, the parametric ANOVA tests with Tukey's posttest and unpaired T‐test were utilised to compare the experimental group means by GraphPad Prism 8. All P ≤ 0.05 was considered statistically significant.

3. RESULTS

3.1. Decellularization process

As mentioned before, the tissue DNA content was isolated and measured in both treated and fresh tissues. Our results showed a significant difference in the DNA content between the decellularized and fresh AM (3.8 ± 2.6 μg/mL and 149 ± 3.8 μg/mL, respectively), indicating about 97% DNA removal in the treated AM (Figure 1).

FIGURE 1.

Measurement DNA content of decellularized AM. The differences between the DNA content of fresh and decellularized AM were found to be statistically significant (P < .001).

3.2. FTIR

As shown in Figure 2, several vibration peaks at the ranges of 1650 to 1620 cm⁻¹, 1530 to 1510 cm⁻¹ and 1270 to 1220 cm⁻¹ are clearly observed, which respectively represent amide I, amide II and amide III. It confirms the presence of the main chemical functional groups of the extracted silk before electrospinning process (Figure 2).

FIGURE 2.

FTIR results of the extracted silk fibroin.

3.3. Scanning electron microscope analysis

After 20 minutes electrospinning of SF, the samples were prepared for further analysis. Based on the SEM results, the average diameter of the SF nanofibers was measured at 145 ± 21 nm (Figure 3A). The cross‐sectional observation of the SF/AM scaffold showed an acceptable connection between the fibroin and the amniotic membrane (Figure 3B).

FIGURE 3.

SEM analysis of fabricated AM/SF scaffold. A, SF electrospun nanofibers showed an appropriate diameter and orientation. B, Cross‐sectional analysis of the developed scaffold. C, Fabricated AM/SF scaffold.

3.4. Cell viability analysis

The results showed that the cell survival rate in the AM/SF/P64 group was significantly lower than that in the Sham group. Furthermore, no significant difference was observed in the other groups at 3‐time intervals. Accordingly, AM/SF/P64 scaffold was excluded from the study due to the negative effect on the fibroblasts (Figure 4).

FIGURE 4.

Cytotoxic effect of the scaffolds against fibroblast cells. MTT assay showed the negative effect of CM11 at concentration of 64 μg/mL on the fibroblast viability.

3.5. Peptide release analysis

The results of in vitro accumulative release test in a pH‐independent condition (Physiological pH) showed a slower pattern of peptide release in the AM/SF/P32 group compared with the AM/SF/P16 (Figure 5A; pH 7.4). In addition, examining the release pattern at different pH showed that the peptide release in both groups shows a slower pattern in the environment with higher pH (Figure 5B,C).

FIGURE 5.

Analysis of peptide release from scaffolds at different pH. pH‐independent cumulative peptide release graph showed a slower release pattern in the AM/SF/P32 group (A). The peptide release pattern in the different pH was slower in the higher pH in both AM/SF/P32 and AM/SF/P16 (B and C). In each graph, the results of three repetitions are shown.

3.6. Mechanical analysis

We surveyed the mechanical properties of fabricated scaffolds by analysing strain deflection at break and suture retention strength. Mechanical analysis revealed a significant difference between the non‐electrospun and the electrospun scaffolds with fibroin, which indicates the positive effect of fibroin in increasing the mechanical characteristics of the developed scaffolds. However, our results did not show a significant difference between the mechanical properties of electrospun scaffolds with fibroin in the presence or absence of the peptide. It implies the lack of significant effects of the CM11 peptide on the mechanical properties of scaffolds (Figure 6).

FIGURE 6.

The mechanical properties of the scaffolds by analyzing of strain deflection at break and suture retention strength. A, Fibroin electrospinning remarkably increased the strain deflection at the break of the AM/SF scaffold (8.74 ± 0.62 mm) compared with the AM scaffold (7.52 ± 0.17 mm). However, we found no significant differences in the strain deflection at the break of AM/SF scaffolds with or without CM11 peptide. B, As shown in the picture, the suture retention strength difference between AM/SF and AM scaffolds is statistically significant, while this parameter did not show a significant change in the presence or absence of CM11 (P ≤ .05).

3.7. Biodegradation

Based on the results obtained from biodegradation analysis, the weight loss percentage in the AM group was statistically higher than that of the AMs covered with silk fibroin. Although no significant differences were observed in the weight loss of AM/SF and AM/SF/CM11 after treatment with lysozyme (Figure 7).

FIGURE 7.

Biodegradation analysis of fabricated scaffolds. As shown in the graph, the AM/SF scaffold has a slower pattern of degradation compared with the AM. However, no differences were found in the degradation rate in the presence or absence of CM11.

3.8. Disk diffusion assay

The AM/SF indicated no growth inhibitory effect on the antibiotic‐resistant isolates of P. aeruginosa, while it showed a slight impact on the growth of S. aureus. As shown in Figure 8A, the clear halo around the scaffolds containing CM11 (AM/SF/P16 and AM/SF/P32) indicates the inhibitory effect of these fabricated scaffolds, although it shows the greater effect of the peptide against S. aureus compared to P. aeruginosa. In addition, a comparison between diameters of the halos around the disks revealed that the scaffold with a higher concentration of CM11 exerts a greater growth inhibitory effect (Figure 8B), which indicates the antibacterial activity of the peptide in a dose‐dependent manner.

FIGURE 8.

The growth inhibitory effect of fabricated scaffolds on bacteria. A, The results of the disk diffusion assay, which shows the inhibition zones. B, Statistical analysis revealed significant differences between the inhibitory zones in all experimental groups (P < .05).

3.9. In vivo biocompatibility

Following implantation, the lymphocyte and macrophage cells involved in the inflammatory response in the wound area were counted to find any signs of rejection. As shown in Figure 9, no significant differences were observed in the count of LC and MQ in all groups.

FIGURE 9.

In vivo biocompatibility of fabricated scaffolds. Statistical analysis showed no difference between the lymphocyte (LC) and macrophage (MQ) counts in the experimental groups.

3.10. Wound healing

As shown in Figure 10A, the wound margin in those covered by AM/SF/P32 was lower than in the other groups at the postulated time. As expected, the WCR analysis showed a higher percentage of wound closure in wounds covered with AM/SF/P32 (Figure 10B). According to the microscopic observations, the epithelialization process was completed in all the groups covered with the fabricated scaffold on day 7 post‐wounding. However, the epidermis thickness in the AM/SF/P32 group was lower than the rest of the experimental groups (data is not shown).

FIGURE 10.

The wound healing process and evaluation of the expression of some effective genes. A, Macroscopic observation and H&E staining analysis of the experimental groups. D: Dermis; F: Follicle; E: Epidermis. B, The wound closure rate in the experimental groups, as shown in the graph, the WCR in the AM/SF/P32 group was higher than the other groups (70.6 ± 1.4; P ≤ .05). C, The relative expression rates of TGF‐β1, TGF‐β3, Col1A1, and Col3A1 against normal tissue. * represents the significant difference with the AM group (P ≤ .05).

3.11. Gene expression

On day 7 post‐surgery, the expression rates of TGF‐β1 and TGF‐β3 in the all‐experimental groups were significantly higher than the expression rates in the normal skin. Furthermore, the wounds covered by the AM/SF and AM/SF/P32 scaffolds showed a higher expression of the aforementioned genes compared with those covered with AM. Similar to the TGF‐ β genes, the expression of collagens was statistically higher in all groups compared with the normal tissue. However, this increase was significant in the wounds covered with scaffolds compared to the sham group. Moreover, the wounds in the AM/SF and AM/SF/P32 groups showed a higher expression level of Col1A1 and Col3A1 when compared with the AM group (Figure 10C).

4. DISCUSSION

In many studies, AM in fresh or decellularized types is frequently used in the field of tissue engineering, especially in wound healing. It is well established that factors such as EGF, HGF, and KGF play a role in stimulating re‐epithelialization by AM. ²⁵ , ²⁶ Furthermore, AM could be considered as a suitable extracellular matrix (ECM) due to being rich with different types of collagen (such as type I, III, IV, V, and VI), hyaluronic acid, laminin, elastin, fibronectin, proteoglycans, etc. ²⁷ , ²⁸ The antimicrobial effects of AM come from the present antimicrobial agents, such as Cystatin E, or even from its function as a biological barrier when it covers the damaged site. ²⁹ However, these antimicrobial effects may not be efficient against some multidrug‐resistant bacteria. According to our findings, the unarmed scaffolds (the scaffolds with no AMPs) showed a negligible negative effect on the growth of P. aeruginosa and S. aureus (Figure 8A). A similar study confirmed that the AM had a growth inhibitory effect on the standard bacteria. Nevertheless, the AM was only able to prevent the pigment formation of antibiotic‐resistant P. aeruginosa isolated from burn wounds. ³⁰

It has been demonstrated that using fresh AM can trigger immunological reactions and increase the risk of transmitting infections, especially intracellular pathogens. ²⁵ The decellularization process, by removing all cells in AM, significantly prevents unwanted immunological responses in the grafted site. Moreover, the basic structure of membrane and the main components of ECM will be preserved through decellularization process, which improves cell attachment and proliferation. Therefore, decellularized AM can be used as a potential biomaterial and scaffold in tissue engineering. In this study, we performed the decellularization of the AM, and the results of the DNA content analysis showed that the decellularization was almost completely done (Figure 1).

However, the low mechanical properties of AM are the major problem in using it as a scaffold for skin regeneration, so it is very difficult to work with AM in a wet state, and its grafting requires a lot of patience and skill. ³¹ In this study, in order to increase the mechanical properties of the AM, its surface was covered with fibroin nanofibers. Mechanical analyses performed on the AM/SF confirmed that covering the surface of the AM with fibroin nanofibers had a great effect on the resulting scaffolds compared with the non‐covered AM. Accordingly, the mechanical properties of AM/SF scaffolds were improved compared with the AM group (Figure 6).

In general, the mechanical behaviors of tissue engineering scaffolds remarkably influence their biological function and efficiency. ⁸ , ³² Our results confirmed this, as our findings showed that cells in wounds covered with AM/SF scaffolds had higher expression of TGF‐β1 and TGF‐β3 at 7 days post‐grafting in comparison with the control group, resulting in better angiogenesis and epithelialization (Figure 10C). ⁸ In general, TGF‐β with its three isoforms (TGF‐β1, −β2, −β3) is involved in a number of processes in wound healing, including fibroblast proliferation, inflammation, collagen synthesis, stimulating angiogenesis and deposition and remodeling of the new extracellular matrix. Fibroblasts, macrophages, keratinocytes, and platelets are the main sources of synthesis and production of these factors. The release of TGF‐β1 during the early stages of wound healing stimulates the recruitment of inflammatory cells to the injured area, which later contributes to a negative feedback through the release of superoxide from macrophages. ³³ During this phase, granulation tissues are gradually formed, and TGF‐β1 stimulates the expression of key components of ECM proteins, such as collagen types I and III and fibronectin. So, TGF‐β1 is one of the main collagen‐stimulating factors, especially type I in fibroblasts. In addition, this factor improves the angiogenic properties of endothelial progenitor cells to facilitate blood supply to the injured area and stimulates the contraction of fibroblasts to enable wound closure. ³³ , ³⁴ TGF‐β1 also promoted keratinocyte migration through the regulation of integrins associated with cell migration. It also inhibits various matrix metalloproteinases (MMPs), which further increase the accumulation of collagen fibres. ³⁵ Based on many studies, TGF‐β3 plays a role in scarless healing. ³⁶ In addition, collagen is one of the most abundant proteins in tissues and constitutes 70%–80% of the dry weight of the dermis. Collagen types I and III are key components of ECM proteins as collagen types I and III comprise approximately 70% and 10% of the collagen in the skin, respectively. ³⁷ The main function of collagen is to act as a scaffold in connective tissue, mainly in types I, II, and III forms. In this study, the wounds in the AM/SF and AM/SF/P32 groups showed a higher expression level of Col1A1 and Col3A1 compared to the AM group. During the wound healing process, type III is laid down first, and the proportion of type I increases with the progress of regeneration. Studies have shown that collagen deposition helps to increase the tensile strength of the wound. About 3 weeks after the injury, the amount of collagen is approximately 20% of the normal level, but from the third week, the process of collagen production accelerates and reaches a maximum of 70% in the skin. The evaluation of the expression level of these two types of collagen also shows this, as can be seen in Figure 10C, the expression level of Col3A1 is somewhat higher than Col1A1.

In addition to the non‐immunogenicity and mechanical properties, biocompatibility is particularly important for a scaffold, so that those with high biocompatibility are able to prepare a suitable environment for the migration and proliferation of cells involved in the wound‐healing process. ⁷ Our results showed that the fibroblasts in the vicinity of the AM/SF had a survival rate similar to the control group. In addition, based on the MTT results, CM11 peptide at concentration of 64 μg/mL significantly reduced the viability of fibroblasts compared with the other concentrations and control (Figure 4). These findings were consistent with those obtained from our previous studies, which were conducted on the chitosan/SF/CM11 and silk fibroin/gelatin scaffolds reported by Khosravimela et al. and Chizart et al., respectively. ²¹ , ³⁸ Moreover, the in vivo biocompatibility test showed no significant differences between the count of lymphocytes and macrophages on the grafted scaffolds in the groups containing CM11 and the control group (Figure 9). Evaluation of the host response of implants or delivery systems is critical to determine the safety and biocompatibility. Studies have shown that lymphocytes and lymphocyte/macrophage interactions play a very important role in pro‐inflammatory and inflammatory reactions to implants, which can also affect the healing process of the wound. Therefore, for the development of tissue engineering structures and bioactive agent delivery systems, lymphocyte/macrophage‐dependent safety assessment plays an important role in determining the safety of these systems. ³⁹ Our results showed that the peptide and the scaffold do not significantly act as stimulators of these cells.

Infections following severe wounds, especially burns, are one of the main factors that threaten the health of patients. On the other hand, infection causes inflammation in the damaged area, which, in cases of chronic inflammation, can lead to hypertrophic scars. ⁴⁰ In many developing countries, silver sulfadiazine is used to control infection in burn patients. Silver possesses very strong and broad‐spectrum antimicrobial activity. Silver and even other ions such as fluoride have concentration‐dependent antimicrobial properties that are toxic to human cells at higher concentrations. Therefore, adjusting the optimal concentration of these materials in a scaffold to reach an effective and nontoxic dose is very delicate. However, these ions may have an undetectable and long‐term effect on human cells, which has made the use of these ions somewhat controversial. ⁵ As mentioned, AM has antimicrobial properties due to the presence of substances such as bactericidin, beta lysin, lysozyme, transferrin, immunoglobulin S7, and hormones, such as progesterone. However, it seems that the natural antimicrobial properties of this membrane are not enough to prevent infection in wounds, especially burn wounds (Figure 8). In the studies conducted by Gholipourmalekabadi and colleagues, they reported that AM cannot be used as an antimicrobial agent against antibiotic‐resistant strains, which are commonly isolated from burn patients. ³⁰ The scaffold developed in the present study showed that the peptide has a significant antibacterial effect on resistant strains of S. aureus compared to P. aeruginosa at nontoxic concentrations (Figure 8). This suggests that by increasing the antimicrobial effect of AM using CM11 peptide, the fabricated scaffolds can be a suitable alternative to amniotic membrane for the treatment of patients infected with antibiotic‐resistant strains.

In general, skin and soft tissue infections are the most common type of infection, affecting a large number of people every year. Depending on the type and severity of the wound, these infections can vary from superficial infections to severe life‐threatening ones. ⁴¹ Normally, the immune system controls potential infection by attacking pathogens that enter the wound bed via macrophages, neutrophils, and lymphocytes. In cases where the immune system cannot control the infection, the proliferation of pathogenic agents in the wound area can slow down the granulation process and the production of matrix proteins such as collagen and laminin and destroy the growth factors involved in the wound, which leads to disruption of the wound healing process. ⁴² In these circumstances, using antibacterial dressings can be very fruitful by preventing the negative impact of infection on the healing process. In this study, our results showed that the WCR in the wounds covered with AM/SF/CM11 was significantly higher than WCR in the sham and other groups. Based on the gene expression analysis data, the wounds covered by AM/SF/CM11 showed a higher expression level of collages and TGF‐βs, which indicates the positive effect of the developed scaffold on the ECM synthesis within the wound bed (Figure 10). This finding was comparable with those in Wu's study, ⁴³ where they reported that the full‐thickness wounds treated with the tylotoin AMP had higher expression rate of TGF‐β1, which resulted in better wound healing compared to the group without AMP. However, more studies are needed to investigate the effect of the developed scaffold on reducing scar formation and its healing quality.

5. CONCLUSION

Our results showed that the AM/SF/CM11 scaffold at an optimised concentration of AMP has a remarkable antimicrobial effect against antibiotic‐resistance strains of S. aureus and P. aeruginosa isolated from burn infection. The scaffold, with its high antimicrobial properties, can be considered as a suitable substitute for antimicrobial substances that are routinely used to treat wounds susceptible to infection, such as burns. However, more clinical studies on burn patients can determine the effectiveness of the developed scaffold in the clinic.

AUTHOR CONTRIBUTIONS

Study concept and design by MMM and BF; analysis and interpretation of data by MMM, BF, RM, and HK. Drafting of the manuscript and critical revision of the manuscript for important intellectual content by MMM and BF.

FUNDING INFORMATION

The authors received no financial support for the research, authorship and/or publication of this article.

CONFLICT OF INTEREST STATEMENT

The authors declare no conflict of interest.

ETHICS APPROVAL

The study was confirmed by the Ethics Committee of the Baqiyatullah University of Medical Sciences (Reference Number: IR.BMSU.BLC.1401.017).

Moosazadeh Moghaddam M, Farhadie B, Mirnejad R, Kooshki H. Evaluation of an antibacterial peptide‐loaded amniotic membrane/silk fibroin electrospun nanofiber in wound healing. Int Wound J. 2023;20(9):3443‐3456. doi: 10.1111/iwj.14215

DATA AVAILABILITY STATEMENT

All data generated or analyzed during this study are included in this manuscript.