Skip to main content
NCBI home page
Journal of Animal Science logoLink to Journal of Animal Science
. 2023 Oct 16;101:skad308. doi: 10.1093/jas/skad308

Effects and potential mechanism of dietary vitamin C supplementation on hepatic lipid metabolism in growing laying hens under chronic heat stress

Chao Yin 1,#, Changming Zhou 2,#, Yun Shi 3, Yangqin Ge 4, Xiaona Gao 5, Cong Wu 6, Zheng Xu 7, Cheng Huang 8, Guoliang Hu 9, Ping Liu 10, Xiaoquan Guo 11,✉
PMCID: PMC10588821  PMID: 37843035

Abstract

The adverse effects of chronic heat stress (CHS)-induced fatty liver syndrome on laying hens during the egg-producing stages have been wildly documented. However, until nowadays, the CHS responses of growing laying hens as well as its alleviating effects of vitamin C are rarely reported. In this study, 12-wk-old laying hens were subjected to CHS at 36 °C for 10 h/d for 3 wk with or without dietary supplementation of 300 mg/kg vitamin C. Results showed that CHS significantly impaired the growth performances and the liver functions of birds, as characterized by reduced feed intake and body weight, increased hepatic lipid accumulation and serum concentrations of TG, ALT, and AST, as well as the abnormal expression patterns of the lipid metabolism-related genes. Vitamin C supplementation successfully mitigated the lipid accumulation, while showing no alleviating effect on the serum contents of ALT or AST, which are two key indicators of liver functions. Metabolomic analysis based on UPLC-Q-TOF/MS identified 173 differential metabolites from the HS and HSV group samples, and they are mainly enriched in the pathways related to the cellular components, vitamin and amino acid metabolism and energy substance metabolism. The results indicate that CHS-induced hepatic lipid deposition in growing laying hens is effectively alleviated by dietary supplementation of vitamin C, which is probably resulted from the alterations of hepatocellular metabolic patterns.

Keywords: chronic heat stress, growing laying hens, liver, metabolomics, vitamin C

The findings in this study not only extend our understandings about the CHS responses of growing laying hens, but also provide new clues and experimental basis for the salvaging of CHS and FLS disease in the poultry industry.

Introduction

High-ambient temperature-induced chronic heat stress (CHS) is one of the major environmental stressors which causes substantial economic loss to the poultry industry. Because of the high metabolic heat production, intensive farming conditions, and excellent insulation of feathers, the birds are singularly susceptible to heat stress (Wolfenson et al., 2001; Goo et al., 2019). Fatty liver syndrome (FLS) that is characterized by the main features of lipid deposition and histological injury in the liver, is one of the adverse consequences of CHS in high-yield laying hens except for the adverse physiological changes such as acid-base imbalance, oxidative stress and suppressed immunocompetence (Gonzalez-Rivas et al., 2020; Wasti et al., 2020). CHS-induced FLS has become one primary factor responsible for the noninfectious cause of mortality and the sharp drop in growth performances and egg production rate (Shini et al., 2019; Meng et al., 2021) in laying hens. However, until nowadays, neither the underlying pathogenesis nor effective mitigation measure of FLS has been well elucidated.

During the past decades, FLS is generally considered to be one metabolic disease occurring at the later phases of the laying hens production cycle, which is strongly correlated with numerous complicated factors including genetics, nutrition, hormones, management, environment, and so on (Squires et al., 1988; Hansen et al., 1993). Nevertheless, from the perspective of pathogenesis, disorders of hepatic lipid metabolism are the major cause of the FLS disease (Guo et al., 2021). In avian species, more than 90% of the fatty acids de novo synthesis takes place in the liver (Goodridge et al., 1967; Laliotis et al., 2010). Afterwards, the fatty acids are partially burned as fuel in hepatocytes to generate adenosine triphosphate (ATP) via tricarboxylic acid (TCA) cycle, or transported to multiple tissues including fat, muscle and egg yolk for storage through the blood cycle (Griffin et al., 1992). Under stress conditions, the balance between the intake and synthesis of fatty acids and their transportation and oxidation utilization is disturbed, as a result, the fat deposits in liver tissues and even causes FLS disease (Wang et al., 2017), companying with the abnormal expressions of lipid metabolism regulatory factors such as acyl-CoA carboxylase (ACC), sterol regulatory element-binding protein, carnitine palmitoyltransferase1 (CPT1), peroxisome proliferator-activated receptor (PPAR), AMP-activated protein kinase (AMPK), and so on (Nguyen et al., 2008). Multifarious approaches including feed restriction, fat addition in diets, and supplementation of vitamins, minerals and phytochemicals were proven to play critical roles in mitigating the CHS-induced FLS symptoms in poultry industry (Wasti et al., 2020; Abdel-Moneim et al., 2021). For example, vitamin C, which is also named as ascorbic acid, is one of the most widely used nutrients applied in lightening the detrimental heat stress effects in poultry, with its main advantages in antioxidant and enhancing immunity (Traber et al., 2011; Carr et al., 2017). Meanwhile, previous studies also revealed a potential effect of growth and development status of growing laying hens on their egg production performance during the mid to late phases of production cycle, because during this period the birds will reach more than 80% of their adult body weight and basically complete the sexual maturity (Dunnington et al., 1984; Connie et al., 1985; Kwakkel et al., 1993). Additionally, our previous research further demonstrated that chronic heat exposure can cause significant changes in the serum fatty substances of growing laying hens, such as the total cholesterol (TC), triglycerides (TG), high-density lipoprotein, and low-density lipoprotein (Zhou et al., 2022). However, whether and how CHS induces FLS in growing laying hens is still unknown until nowadays.

Metabolomics based on ultra-high-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS) technique is one commonly-used method with the high resolution and detection sensitivity, which has the capacity to identify and quantify the global changes of endogenous small-molecule metabolites in biological samples (Bujak et al., 2015; Bhatia et al., 2019). For example, with the application of UPLC-QTOF/MS-based metabolomics approach, Meng et al. (Meng et al., 2021) found that the disturbances of liver metabolites and arachidonic acid derivatives were strongly associated with the pathological progression of the fatty liver hemorrhagic syndrome of laying hens. In the same way, with the help of metabolomics analysis, we are also able to characterize the metabolic profiling of the growing laying hen’s biosystem at the molecular and cellular levels, and comprehensively reveal the change rule and potential mechanisms of vitamin C in alleviating the hepatic fat deposition under CHS.

Therefore, the aim of the present study is to investigate the effects of CHS on the histological and metabolic alterations of livers in growing laying hens, and to analyze the alleviating effect as well as the potential pathways of vitamin C in hepatic metabolism based on UHPLC-QTOF/MS technique. The results will provide new clues and experimental basis for the salvaging of CHS and FLS disease in laying hens in the poultry industry.

Materials and Methods

Animals and experimental design

The experimental protocol was approved by Animal Ethics Committee of Jiangxi Agricultural University (permit No. JXAULL-2020-28). All sampling procedures are in compliance with the “Guidelines on Ethical Treatment of Experimental Animals” (2006) No. 398 set by the Ministry of Science and Technology, China.

One hundred and eighty Hy-Line Brown laying hens were purchased from a local commercial hatchery (Guohua Co. Ltd, Nanchang, China) at 10 wk of age and raised in the cage-based rearing systems throughout the entire experimental process. After 2 wk of acclimation, 180 hens weighed on average 1,103 ± 27 g and were randomly assigned into three treatment groups. There were 6 replicate groups (n = 6) per treatment group and 10 birds per replicate group. The three experimental treatments were thermoneutral (TN) control, heat stress with basal diet (HS) and heat stress with vitamin C supplementation (HSV). In the following 3-wk experiment, the birds in the TN group were reared at 22 ± 1 °C with 55 ± 5% relative humidity for 24 h/d and provided with feed and water ad libitum. The birds in the HS and HSV groups suffered from a cyclic heat stress with a stress period of 10 h (0800 to 1800 hours) at 36 ± 1 °C and a recovery period of 14 h (1800 to 0800 hours) at 22 ± 1 °C with 55 ± 5% relative humidity and provided with feed and water ad libitum, as previously reported by Zhou et al. (2022). All birds from the TN and HS groups were fed with the basal diets according to the formulation presented in Supplementary Table S1, while birds from the HSV group were supplemented with 300 mg/kg vitamin C on the basis of HS group diet. The energy and protein requirements of the diet followed the National Research Council (NRC) (1994), and a regular 12:12 (L:D) h cycle was executed throughout the experimental session.

The time course of the experimental treatments and sample collection is shown in Figure 1A. Six hens from each treatment group were randomly sacrificed and euthanized at days 7, 14, and 21, at the end of the recovery period. Blood samples collected from the external jugular vein was transferred into the Eppendorf tubes (2 mL) immediately and then centrifuged at 2,500 rpm 4 °C for 15 min for serum separation. Sample tissues were obtained from the same region on the liver of each hen. A small square of liver tissue was fixed with 10% phosphate-buffered formalin acetate for histopathological analysis, and another cube was simultaneously snapped into liquid nitrogen immediately. All frozen serum and tissue samples were finally stored at −80 °C until further analysis.

Figure 1.

Figure 1.

Open in a new tab

Experimental design and the growth performance of growing laying hens under CHS. (A) Schematic diagram of the experimental design. Birds were acclimated from day −14 before heat exposure for 2 wk and randomly assign these birds into three experimental groups, and samples were taken at days 7, 14, and during the days 1 to 21 CHS period; (B) Alterations of average food intake and body weight of growing hens during CHS period. Data are expressed as mean (food intake, n = 6) or mean ± SEM (body weight, n = 8). TN, birds were reared at 22 ± 1 °C with 55 ± 5% relative humidity for 24 h/d and provided with feed and water ad libitum; HS, birds were maintained at 22 ± 1 °C for 14 h/d (1800 to 0800 hours) and then exposed to heat at 36 ± 1 °C for 10 h/d (08:00 to 18:00) with 55 ± 5% relative humidity and ad libitum to feed and water; HSV, birds were raised under the same conditions as the HS group individuals and fed with 300 mg/kg vitamin C on the basis of the basal diets. # 0.05 < P < 0.10 and *P < 0.05, compared with the TN group.

Histopathological analysis

Hematoxylin–eosin (H&E) staining was performed to detect histopathological alterations in liver tissues of laying hens after the prolonged heat exposure. When animals were sacrificed, freshly harvested liver tissues were rapidly fixed in 10% phosphate-buffered formalin acetate at 4 °C overnight, followed by dehydration in a series of graded ethanol from 70% to 100% for 5 min and cleared with ultra-pure acetone for 5 min during each stage. Then, the tissues were transparented by xylene, and embedded in paraffin (BMJ-III embedding machine, Jiangsu, China) by waxing at 56 °C for 1 h. Next, the wax blocks were cut into 5-µm-thick sections and adhered to the glass slides. Finally, the sections (n = 6) were the sections were dewaxed with xylene, hydrated with gradient concentration alcohol and stained with H&E dyes for histopathological observation under the light microscope (Olympus, Tokyo, Japan).

Serum parameters measurement

The serum content of TG, alanine transaminase (ALT) and aspartate transaminase (AST) was evaluated (n = 6) using the automatic analyzer (Hitachi7060, Hitachi, Tokyo, Japan). All experimental procedures were performed according to the manufacturer’s protocols.

Hepatic metabolomics analysis

Hepatic samples (n = 6) were prepared according to our previous protocol with modifications (Guo et al., 2021), and then submitted to the company (Biotree Biotech Co., Ltd, Shanghai, China) for further metabolite concentration detection through the metabonomics analysis platform based on UPLC-Q-TOF/MS. The bioinformatics analysis was performed according to the standard protocols of Biotree Biotech Co., Ltd, as reported previously by Zhou et al. (2022). The quality control (QC) samples were used in the metabolomic analysis to evaluate and adjust the signal drift of the mass spectrum data, to ensure the repeatability and the accuracy of the omics data.

RNA isolation and quantitative real-time PCR

To investigate the abundance of mRNA in liver, total RNA was extracted from 30 to 50 mg frozen liver samples (n = 6) using the TRIzol reagent (15596026, Invitrogen, CA, USA). The isolated RNA was quantified using the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA), and the ratios of 260/280 nm and 260/230 nm of all samples between 1.8 and 2.0 were considered pure and adequate for further analysis. Two micrograms of total RNA were used to generate cDNA by PrimeScript 1st Strand cDNA Synthesis Kit (D6110A, Takara, Dalian, China). The resulting cDNA was then diluted 1:25 with sterile water, and 2 μL of diluted cDNA was used as a template to perform the quantitative real-time polymerase chain reaction (PCR) on Mx3000P system (Mx3000P, Stratagene, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was chosen as the internal control and the primer sequences are shown in Table 1. The 2−∆∆Ct method was used to analyze the real-time PCR data.

Table 1.

Primers sequences for real-time PCR

Target genes Gene Bank No. Primer sequence (5ʹ→3ʹ)
GAPDH NM_204305 F: TGGCATCCAAGGAGTGAGC
R: GGGGAGACAGAAGGGAACAG
AMPKα1 NM_ 001039603 F: ATCTGTCTCGCCCTCATCCT
R: CCACTTCGCTCTTCTTACACCTT
AMPKα2 NM_204305 F: GGGACCTGAAACCAGAGAACG
R: ACAGAGGAGGGCATAGAGGATG
ACC NM_205505.1 F: TGGACTGGAAAACGTCTCGG
R: CACAGGTACGCCTTTACCGT
GPAT EU049888.1 F: TGTGGAAGGGCTTGTATCGT
R: TTCCAACACGCGATTTCTGG
HMGCR AB109635 F: CTGGGTTTGGTTCTTGTTCA
R: ATTCGGTCTCTGCTTGTTCA
PPARα NM_001001464 F: ACGGAGTTCCAATCGC
R: AACCCTTACAACCTTCACAA
PPARγ AF163811 F: CCAGCGACATCGACCAGTT
R: GGTGATTTGTCTGTCGTCTTTCC
CPT1 AY675193 F: GGAGAACCCAAGTGAAAGTAATGAA
R: TGGAAACGACATAAAGGCAGAA
SREBP1 NM_204126.3 F: AAGGGGTCTGACACATGGAG
R: GGGGAGGTCTTGTGAATGGA
Open in a new tab

Statistical analysis

All data were presented in the format of mean ± SEM and were analyzed using independent samples t-test and one-way analysis of variance (ANOVA) with statistical product and service solutions (SPSS) 18.0 for Windows. ANOVA followed by post hoc Dunnett test was used to determine the statistical differences of the average feed intake between two groups. The 2−ΔΔCt method was used to analyze the real-time PCR data. The differences with P < 0.05 were considered to be statistically significant.

Results

Growth performance of laying hens during CHS

During the 21-d experimental period, CHS significantly (P < 0.05) reduced the average feed intake from days 7 to 21, and the body weight at days 14 and 21 of growing laying hens. Dietary supplementary of 300 mg/kg vitamin C obviously (P < 0.05) ameliorated the adverse effects of CHS on both of the feed intake and body weight loss, as shown in Figure 1.

Histological and physiological alterations of livers

As shown in Figure 2, CHS significantly impaired the liver functions of growing laying hens. On one hand, exceeded fat deposition was found in the livers of heat-stressed birds, which is characterized by the remarkably (P < 0.05) elevated serum-free TG concentration, increased intercellular lipid droplets, and the abnormal expressions of lipid metabolism-related genes in the liver, including the fatty acid de novo synthesis-related genes ACC, HMGCR, GPAT, and SREBP1, fatty acid oxidation and utilization-related genes CPT1, PPARα, and AMPKα1/2, as well as PPARγ which is partially involved in the fatty acid transportation. On the other hand, CHS significantly (P < 0.05) increased the serum contents of ALT and AST, which are two essential indicators of the liver function impairment. Dietary supplementary of vitamin C played essential roles in the alleviation of lipid accumulation in livers, as revealed by obvious (P < 0.05) reversions in serum TG content, hepatic lipid droplet number and lipid metabolism-related genes’ transcription levels in HSV group, when compared with the HS group. Nevertheless, there was no difference observed in the serum contents of ALT or AST between the HS and HSV group samples.

Figure 2.

Figure 2.

Open in a new tab

Histological and physiological alterations of livers after CHS. (A) Hematoxylin-eosin (H&E) staining of the liver tissues from the three experimental groups. Black arrows indicate the locations of lipid accumulation. (B) Serum contents of ALT, AST, and TG. (C) Expression levels of lipid metabolism-related genes in livers. Data are expressed as mean ± SEM (n = 8). TN, birds were reared at 22 ± 1 °C with 55 ± 5% relative humidity for 24 h/d and provided with feed and water ad libitum. HS, birds were maintained at 22 ± 1 °C for 14 h/d (1800 to 0800 hours) and then exposed to heat at 36 ± 1 °C for 10 h/d (0800 to 1800 hours) with 55 ± 5% relative humidity and ad libitum to feed and water. HSV, birds were raised under the same conditions as the HS group individuals and fed with 300 mg/kg vitamin C on the basis of the basal diets. Different letters represent the significant difference between two experimental groups, small and capital letters mean P < 0.05 and P < 0.01, respectively, compared with TN group.

Metabolomics profiling of liver samples

Representative UPLC-Q-TOF/MS ion chromatograms of samples from the HSV group are shown in Figure 3A. A total of 4,011 valid peaks (2,251 positive (POS) peaks and 1,760 negative (NEG) peaks) corresponding to 789 metabolites were identified in the liver samples. Principal component analysis (PCA) (Figure 3B) showed that there was an obvious separation between the QC samples and the HS and HSV group samples. Orthogonal projections to latent structures discriminant analyses (OPLS-DA) also revealed a clear separation between the HS and QC as well as the HS and HSV groups (Figure 3C). The parameters of the HS versus HSV POS model, R2 (cum) = 0.987 and Q2 (cum) = 0.85, indicated that 98.7% of variance of the POS data records of samples was explained by the established discriminant mathematic model and that the prediction accuracy of the model was 85.0%. Similarly, the parameters of the HS vs HSV NEG model, R2 (cum) = 0.939 and Q2 (cum) = 0.635, indicated that 93.9% of variance of the NEG data records of samples was explained by the established discriminant mathematic model and that the prediction accuracy of the model was 63.5%. The OPLS-DA model explained a very significant part of the total variance in the metabolomic data and it was a good fit for these data as shown by the above-mentioned R2 values.

Figure 3.

Figure 3.

Open in a new tab

PCA and OPLS-DA analysis based on the untargeted UPLC-Q-TOF/MS metabolomics. (A) Representative UPLC-Q-TOF/MS ion chromatograms of samples from the HSV group. (B) The PCA score plots display the variance of positive (left) and negative (right) ions between HS and HSV groups. (C) The OPLS-DA score chart of liver metabolomics analyzes the variance of positive (left) and negative (right) ions between HS and HSV groups. QC, quality control samples; HS, birds were maintained at 22 ± 1 °C for 14 h/d (1800 to 0800 hours) and then exposed to heat at 36 ± 1 °C for 10 h/d (0800 to 1800 hours) with 55 ± 5% relative humidity and ad libitum to feed and water; HSV, birds were raised under the same conditions as the HS group individuals and fed with 300 mg/kg vitamin C on the basis of the basal diets.

Differential metabolites analysis of liver samples

In total, there were 173 differential metabolites (VIP > 1 and P < 0.05) identified between the HS and HSV groups, of which 106 metabolites were significantly (P < 0.05) greater in HSV group when compared with HS group (Supplementary Table S2). The scatterplot representing the differential metabolites expression patterns between the HS group and HSV group is shown in Figure 4A.

Figure 4.

Figure 4.

Open in a new tab

Differential metabolites and their set enrichment analysis. (A) Scatterplot comparing the liver metabolites expression pattern between HS and HSV groups, the significantly changed (variable importance in the projection values > 1 and P < 0.01) metabolites were labeled in colors. (B) The bubble plots of differential metabolites enriched pathways between HS and HSV groups. The abscissa and the size of bubbles represent the importance of the metabolic pathways in the topology analysis, and the ordinate and bubble color denote the significant level of the metabolic pathway through enrichment analysis.

The top metabolic pathways from the KEGG enrichment analysis are shown in Figure 4B. The most significant as well as numerous metabolites mainly enriched in the pathways are the amino sugar and nucleotide sugar metabolism, pyrimidine metabolism and ascorbate and aldarate metabolism, followed by glycerolipid metabolism, pentose and glucuronate interconversions, porphyrin and chlorophyl metabolism, glycerophospholipid metabolism and arginine and proline metabolism pathways as secondly. Many of the pathways are related to the intracellular components (including amino sugar, pyrimidine and porphyrin), vitamin and amino acid metabolism (including ascorbate, arginine and proline), and the energy substance metabolism (including nucleotide sugar, glycerolipid, pentose, glucose and glycerophospholipid).

Discussion

High-ambient temperature exposure-induced CHS in summer is one of the major problems faced by both scientists and farming technicians, which causes substantial economic losses to the poultry industry. Especially for the commercial broilers and laying hens, to satisfy the huge demands of meat and eggs from human beings, the birds are designed to be fast-growing and high-producing through genetic selections, which makes them have an exorbitant feed intake and metabolic heat production relative to their body size and thus they are prone to HS (Gonzalez-Rivas et al., 2020; Wasti et al., 2020). Moreover, this impairment in thermoregulation is further aggravated by the high stocking density in the poultry industry and the avian-specific characteristics including the excellent insulation of feathers and lacking of sweat glands (Wolfenson et al., 2001; Anders, 2015). Previous studies have shown that CHS not only affects the health and welfare of broilers and laying hens, but also significantly reduces their feed intake, daily gain and egg production or even leads to death (Abo et al., 2020; Saleh et al., 2020; Abdel-Moneim et al., 2021). However, most of these studies were focused on the broilers or the finishing laying hens during the egg-producing stage, little attention has been paid to the growing laying hens, during which period they will reach more than 80% of their adult body weight and basically complete the sexual maturity and therefore has a profound effect on the following egg production performance (Dunnington et al., 1984; Connie et al., 1985; Kwakkel et al., 1993). Hence, we used 12 to 15 wk-old laying hens in this study to investigate their organic responses under the CHS condition. In consistent with previous reports, our results showed that CHS remarkably decreased the average feed intake from days 7 to 21 and the daily gain in days 14 and 21 during the experimental treatment period, when compared with the TN groups.

Liver is the largest metabolic organ of the animal body. Unlike rodents, ruminants and most mammals, the avian liver plays a more prominent role in the lipid metabolism (Emami et al., 2020), which contributes to over 90% of the fatty acids de novo synthesis in organism (Goodridge et al., 1967; Flees et al., 2017). The fatty acids are afterwards transformed into ATP via TCA cycle within the local hepatocytes, or delivered to the extrahepatic tissues such as muscle, fat and yolk for storage by being integrated into TG and packaged with apolipoprotein (Ipsen et al., 2018). However, under CHS condition, the balance between the fatty acid synthesis and their decomposition or transportation is disrupted, and the fat will promptly accumulate in the liver tissues, leading to various diseases such as FLS (Lu et al., 2007). For example, Lu et al. (2019) stated that the excessive lipid accumulation in the liver of broilers under heat exposure is probably linked to the limited apolipoprotein B, which is responsible for transporting the synthesized TG from liver to the extrahepatic tissues. In accordance with the previous researches, increased hepatic lipid deposition was validated in our study in growing laying hens under the CHS condition, as characterized by significantly increased serum TG concentration and the intercellular lipid droplets contents. At the same time, the expression level of the lipid metabolism-related genes in the birds’ livers was also broadly changed by CHS, including the genes ACC, HMGCR, GPAT, and SREBP1 involved in the hepatic fatty acid de novo synthesis, the genes CPT1, PPARα, and AMPKα1/2 responsible for the fatty acid oxidation and utilization, as well as the gene PPARγ which is partially included in the fatty acid transportation process (Nguyen et al., 2008). These results suggested us that the balance between the intake and synthesis of fatty acids and their transportation and oxidation utilization in the birds’ livers is disturbed, which could become the major reason of the fat deposition in the growing laying hens (Wang et al., 2017). Simultaneously, as reported by Li et al. (2020) and Zhou et al. (2022), CHS also induced multiple organ dysfunctions in these birds after the heat exposure, manifested as the notable increase of ALT content and the sharply elevated AST concentration in serum (Figure 2), which are two essential parameters used in monitoring the liver and heart functions, respectively.

Numerous feeding strategies including feed restriction, wet feeding, fat addition in the diet, and supplementation of vitamins, minerals and phytochemicals have been proven to be effective in mitigating the detrimental effects of CHS in poultry during the past decades (Wasti et al., 2020; Abdel-Moneim et al., 2021). Vitamin C, also named ascorbic acid, is one of the most widely used nutrients applied in alleviating the harmful effects of HS in poultry, with its main advantages in antioxidant and enhancing immunity (Traber et al., 2011; Carr et al., 2017). For instance, according to previous studies, vitamin C can not only improve the growth rate, nutrient utilization, egg production and antioxidant status of broilers and laying hens in the egg-producing stage, but also prevent them from damaging the liver (Puthpongsiriporn et al., 2001; Torki et al., 2014; Attia et al., 2016). However, even though the birds can endogenously synthesized ascorbic acid, its synthesis and utilization are remarkably reduced under the HS conditions (Wasti et al., 2020). Hence, it would also be an effective way to attenuate the harmful effects of CHS in growing laying hens through dietary supplementation of vitamin C. In fact, we showed that dietary supplementation of 300 mg/kg vitamin C could effectively reduce the hepatic lipid deposition and the FLS disease occurrence in growing laying hens, whereas the potential mechanism involved in these processes remains unknown.

Considering that FLS is a nutritional and metabolic disease (Shini et al., 2019), we subsequently adopted the metabolomic method based on UPLC-Q-TOF/MS to analyze the change rule of the metabolites between HS and HSV group samples, with the main purpose to further explore the potential pathways of vitamin C in alleviating the hepatic fat deposition under CHS. A total of 173 differential metabolites were identified in our experiment, and they enriched mainly in three pathways including the cellular components, energy substance metabolism, and the vitamin and amino acid metabolism. It is not strange for us to find vitamin (including ascorbate), cellular components (including amino sugar, pyrimidine and porphyrin) and the energy substances (including nucleotide sugar, glycerolipid, pentose, glucose, and glycerophospholipid) in our analysis, when considering about the experimental treatment and the hepatic histological impairments. What interested us is the concurrence of the identification of amino acids (such as arginine and proline) in metabolomics analysis and the mitigative effect of vitamin C on hepatic lipid metabolic disorder under CHS, which the latter is characterized by notable reversions of serum TG content, hepatic lipid droplet number and the expression patterns of lipid metabolism-related genes mentioned above. Although regulatory relationship between amino acids and lipid metabolism in poultry is uncharted, evidences from other species can still be found. For example, Yi et al. (2020) demonstrated that during adipogenesis in vitro, the phosphatidylinositol 3ʹ kinase-serine/threonine kinase (PI3K-Akt) signaling pathway is stimulated and then directly regulates cellular metabolism by priming arginine and proline metabolism via targeting the potential key genes. Whereas another study by Tan et al. (2011) reported that dietary l-arginine supplementation can differentially regulate the expression of fat-metabolic genes in skeletal muscle and white adipose tissue, and therefore favoring lipogenesis in muscle but lipolysis in adipose tissue. Additionally, the alteration of amino acids is also verified in lots of previous researches to be strongly associated with the negative energy balance (NEB) state in finishing laying hens under heat exposure conditions (Azad et al., 2010; Lu et al., 2018). Studies from Zuo et al. (2015) and Temim et al. (2000) both demonstrated that under the NEB state caused by CHS, the muscle protein synthesis in broilers will be inhibited and the muscle-derived proteins and amino acids in avian are abundantly mobilized as fuel to meet the energy demands during the stress defense. Instead, lipid, which has a higher energetic storage effciency than proteins, will deposit in the organs. This might be an adaptive response to reduce the metabolic heat production in birds under the CHS conditions (Geraert et al., 1996; Renaudeau et al., 2012). These theories from another perspective helped us explain the phenomena why CHS promoted but vitamin C alleviated the hepatic lipid accumulation in the growing laying hens in our study. However, the underlying molecular mechanisms of CHS-induced fat deposition in growing chickens still need to be further studied.

In conclusion, CHS-induced animal model was implicated in this experiment to investigate the effects of prolonged high-ambient temperature exposure as well as the dietary supplementation of vitamin C on growing layer hens. Histological and molecular biological detections demonstrated that vitamin C played critical roles in the alleviation of hepatic lipid deposition and the histological and functional impairments caused by CHS. The potential pathways involved in these processes were further illuminated using the metabolomic method based on UPLC-Q-TOF/MS. Despite the limitations such as the undiscovered molecular mechanisms of CHS-induced fat deposition in growing laying hens, our findings provide a better understanding of the metabolic rules under the energy metabolism imbalance caused by CHS and provide new clues and experimental basis for solving the CHS and its induced FLS disease in the poultry industry.

Supplementary Material

skad308_suppl_Supplementary_Tables_S1
Click here for additional data file. (12.5KB, docx)
skad308_suppl_Supplementary_Tables_S2
Click here for additional data file. (39.3KB, xlsx)

Acknowledgments

This work was supported by the Key Programs of the Natural Science Foundation of Jiangxi Province of China (Grant 2017ACB20012) and the National Natural Science Foundation of China (Grant 32060760 and Grant 31860723). Part of this work was also supported by the Technology System of Modern Agricultural Poultry Industry of Jiangxi Province (JXARS) and the Technology R&D Program of Jiangxi Province (Grant GJJ210415).

Glossary

Abbreviations

ACC

acyl-CoA carboxylase

ALT

alanine transaminase

AMPK

AMP-activated protein kinase

AST

aspartate transaminase

CHS

chronic heat stress

CPT1

carnitine palmitoyltransferase1

FLS

fatty liver syndrome

GAPDH

glyceraldehyde-3-phosphate dehydrogenase

HS

heat stress with basal diet

HSV

heat stress with vitamin C supplementation

NEB

negative energy balance

OPLS-DA

orthogonal projections to latent structures discriminant analyses

PCA

principal component analysis

PPAR

proliferator-activated receptor

QC

quality control

TC

total cholesterol

TCA

tricarboxylic acid

TG

triglycerides

TN

thermoneutral

UPLC-Q-TOF/MS

ultra-high-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry

Contributor Information

Chao Yin, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Changming Zhou, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Yun Shi, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Yangqin Ge, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Xiaona Gao, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Cong Wu, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Zheng Xu, Department of Mathematics and Statistics, Wright State University, Dayton, OH 45435, USA.

Cheng Huang, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Guoliang Hu, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Ping Liu, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Xiaoquan Guo, Jiangxi Provincial Key Laboratory for Animal Health, Institute of Animal Population Health, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang, Jiangxi, China.

Author’s Contributions

Chao Yin, Yangqin Ge, and Xiaoquan Guo conceived and designed the experiments, and prepared the draft of the manuscript; Yun Shi and Changming Zhou performed the experiments; Xiaona Gao, Cong Wu, Zheng Xu, Cheng Huang, Guoliang Hu, and Ping Liu helped prepare the samples and provided comments and technical support. All authors have read and approved the final manuscript.

Data Availability

The datasets used in the study are available from the corresponding author on reasonable request.

Conflict of interest statement

The authors declare that they have no competing interests.

Literature Cited

  1. Abdel-Moneim, A. E., Shehata A. M., Khidr R. E., Paswan V. K., Ibrahim N. S., El-Ghoul A. A., Aldhumri S. A., Gabr S. A., Mesalam N. M., Elbaz A. M.,. et al. 2021. Nutritional manipulation to combat heat stress in poultry: a comprehensive review. J. Therm. Biol. 98:102915. doi: 10.1016/j.jtherbio.2021.102915 [DOI] [PubMed] [Google Scholar]
  2. Abo, G. M., Abd E. M., Othman S. I., Taha A. E., Allam A. A., and Eid A. A... 2020. Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress. Poult. Sci. 99:3070–3078. doi: 10.1016/j.psj.2020.03.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Anders, P. M. 2015. The allometry of number of feathers in birds changes seasonally. Avian Res. 6:2. doi: 10.1186/s40657-015-0012-3 [DOI] [Google Scholar]
  4. Attia, Y. A., Abd E. A., Abedalla A. A., Berika M. A., Al-Harthi M. A., Kucuk O., Sahin K., and Abou-Shehema B. M... 2016. Laying performance, digestibility and plasma hormones in laying hens exposed to chronic heat stress as affected by betaine, vitamin c, and/or vitamin e supplementation. Springerplus. 5:1619. doi: 10.1186/s40064-016-3304-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Azad, M. A., Kikusato M., Maekawa T., Shirakawa H., and Toyomizu M... 2010. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Physiol. A: Mol. Integr. Physiol. 155:401–406. doi: 10.1016/j.cbpa.2009.12.011 [DOI] [PubMed] [Google Scholar]
  6. Bhatia, A., Sarma S. J., Lei Z., and Sumner L. W... 2019. Uhplc-qtof-ms/ms-spe-nmr: a solution to the metabolomics grand challenge of higher-throughput, confident metabolite identifications. Methods Mol. Biol. 2037:113–133. doi: 10.1007/978-1-4939-9690-2_7 [DOI] [PubMed] [Google Scholar]
  7. Bujak, R., Struck-Lewicka W., Markuszewski M. J., and Kaliszan R... 2015. Metabolomics for laboratory diagnostics. J. Pharm. Biomed. Anal. 113:108–120. doi: 10.1016/j.jpba.2014.12.017 [DOI] [PubMed] [Google Scholar]
  8. Carr, A. C., and Maggini S... 2017. Vitamin C and immune function. Nutrients. 9:11. doi: 10.3390/nu9111211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Connie, L., Beane W. L., Ruszler P. L., and Cherry J. A... 1985. Body weight influence on egg production. Poult. Sci. 12:2259–2262. doi: 10.3382/ps.0642259. [DOI] [Google Scholar]
  10. Dunnington, E. A., and Siegel P. B... 1984. Age and body weight at sexual maturity in female white leghorn chickens. Poult. Sci. 63:828–830. doi: 10.3382/ps.0630828 [DOI] [PubMed] [Google Scholar]
  11. Emami, N. K., Jung U., Voy B., and Dridi S... 2020. Radical response: effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver. Antioxidants (Basel). 10:35. doi: 10.3390/antiox10010035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Flees, J., Rajaei-Sharifabadi H., Greene E., Beer L., Hargis B. M., Ellestad L., Porter T., Donoghue A., Bottje W. G., and Dridi S... 2017. Effect of morinda citrifolia (noni)-enriched diet on hepatic heat shock protein and lipid metabolism-related genes in heat stressed broiler chickens. Front. Physiol. 8:919. doi: 10.3389/fphys.2017.00919 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Geraert, P. A., Padilha J. C., and Guillaumin S... 1996. Metabolic and endocrine changes induced by chronic heat exposure in broiler chickens: growth performance, body composition and energy retention. Br. J. Nutr. 75:195–204. doi: 10.1079/bjn19960124 [DOI] [PubMed] [Google Scholar]
  14. Gonzalez-Rivas, P. A., Chauhan S. S., Ha M., Fegan N., Dunshea F. R., and Warner R. D... 2020. Effects of heat stress on animal physiology, metabolism, and meat quality: a review. Meat Sci. 162:108025. doi: 10.1016/j.meatsci.2019.108025 [DOI] [PubMed] [Google Scholar]
  15. Goo, D., Kim J. H., Park G. H., Delos Reyes J. B., and Kil D. Y.. 2019. Effect of heat stress and stocking density on growth performance, breast meat quality, and intestinal barrier function in broiler chickens. Animals (Basel). 9:107. doi: 10.3390/ani9030107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Goodridge, A. G., and Ball E. G... 1967. Lipogenesis in the pigeon: in vivo studies. Am. J. Physiol. 213:245–249. doi: 10.1152/ajplegacy.1967.213.1.245 [DOI] [PubMed] [Google Scholar]
  17. Griffin, H. D., Guo K., Windsor D., and Butterwith S. C... 1992. Adipose tissue lipogenesis and fat deposition in leaner broiler chickens. J. Nutr. 122:363–368. doi: 10.1093/jn/122.2.363 [DOI] [PubMed] [Google Scholar]
  18. Guo, L., Kuang J., Zhuang Y., Jiang J., Shi Y., Huang C., Zhou C., Xu P., Liu P., Wu C.,. et al. 2021. Serum metabolomic profiling to reveal potential biomarkers for the diagnosis of fatty liver hemorrhagic syndrome in laying hens. Front. Physiol. 12:590638. doi: 10.3389/fphys.2021.590638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hansen, R. J., and Walzem R. L... 1993. Avian fatty liver hemorrhagic syndrome: a comparative review. Adv. Vet. Sci. Comp. Med. 37:451–468 [PubMed] [Google Scholar]
  20. Ipsen, D. H., Lykkesfeldt J., and Tveden-Nyborg P... 2018. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell. Mol. Life Sci. 75:3313–3327. doi: 10.1007/s00018-018-2860-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kwakkel, R. P., Ducro B. J., and Koops W. J... 1993. Multiphasic analysis of growth of the body and its chemical components in white leghorn pullets. Poult. Sci. 72:1421–1432. doi: 10.3382/ps.0721421 [DOI] [PubMed] [Google Scholar]
  22. Laliotis, G. P., Bizelis I., and Rogdakis E... 2010. Comparative approach of the de novo fatty acid synthesis (lipogenesis) between ruminant and non ruminant mammalian species: from biochemical level to the main regulatory lipogenic genes. Curr. Genomics. 11:168–183. doi: 10.2174/138920210791110960 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li, Q., Wan G., Peng C., Xu L., Yu Y., Li L., and Li G... 2020. Effect of probiotic supplementation on growth performance, intestinal morphology, barrier integrity, and inflammatory response in broilers subjected to cyclic heat stress. Anim. Sci. J. 91:e13433. doi: 10.1111/asj.13433 [DOI] [PubMed] [Google Scholar]
  24. Lu, Q., Wen J., and Zhang H... 2007. Effect of chronic heat exposure on fat deposition and meat quality in two genetic types of chicken. Poult. Sci. 86:1059–1064. doi: 10.1093/ps/86.6.1059 [DOI] [PubMed] [Google Scholar]
  25. Lu, Z., He X. F., Ma B. B., Zhang L., Li J. L., Jiang Y., Zhou G., and Gao F... 2018. Serum metabolomics study of nutrient metabolic variations in chronic heat-stressed broilers. Poult. Sci. 119:771–781. doi: 10.1017/S0007114518000247 [DOI] [PubMed] [Google Scholar]
  26. Lu, Z., He X. F., Ma B. B., Zhang L., Li J. L., Jiang Y., Zhao G. H., and Gao F... 2019. Increased fat synthesis and limited apolipoprotein b cause lipid accumulation in the liver of broiler chickens exposed to chronic heat stress. Poult. Sci. 98:3695–3704. doi: 10.3382/ps/pez056 [DOI] [PubMed] [Google Scholar]
  27. Meng, J., Ma N., Liu H., Liu J., Liu J., Wang J., He X., and Zhao X... 2021. Untargeted and targeted metabolomics profiling reveals the underlying pathogenesis and abnormal arachidonic acid metabolism in laying hens with fatty liver hemorrhagic syndrome. Poult. Sci. 100:101320. doi: 10.1016/j.psj.2021.101320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nguyen, P., Leray V., Diez M., Serisier S., Le Bloc’H J., Siliart B., and Dumon H... 2008. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. (Berl). 92:272–283. doi: 10.1111/j.1439-0396.2007.00752.x [DOI] [PubMed] [Google Scholar]
  29. NRC. 1994. Nutrient requirements of poultry. 9th rev. ed.Washington, DC.: National Academy Press. [Google Scholar]
  30. Puthpongsiriporn, U., Scheideler S. E., Sell J. L., and Beck M. M... 2001. Effects of vitamin e and c supplementation on performance, in vitro lymphocyte proliferation, and antioxidant status of laying hens during heat stress. Poult. Sci. 80:1190–1200. doi: 10.1093/ps/80.8.1190 [DOI] [PubMed] [Google Scholar]
  31. Renaudeau, D., Collin A., Yahav S., de Basilio V., Gourdine J. L., and Collier R. J... 2012. Adaptation to hot climate and strategies to alleviate heat stress in livestock production. Animal 6:707–728. doi: 10.1017/S1751731111002448 [DOI] [PubMed] [Google Scholar]
  32. Saleh, A. A., Eltantawy M. S., Gawish E. M., Younis H. H., Amber K. A., Abd El-Moneim A. E. E., and Ebeid T. A... 2020. Impact of dietary organic mineral supplementation on reproductive performance, egg quality characteristics, lipid oxidation, ovarian follicular development, and immune response in laying hens under high ambient temperature. Biol. Trace Elem. Res. 195:506–514. doi: 10.1007/s12011-019-01861-w [DOI] [PubMed] [Google Scholar]
  33. Shini, A., Shini S., and Bryden W. L... 2019. Fatty liver haemorrhagic syndrome occurrence in laying hens: impact of production system. Avian Pathol. 48:25–34. doi: 10.1080/03079457.2018.1538550 [DOI] [PubMed] [Google Scholar]
  34. Squires, E. J., and Leeson S... 1988. Aetiology of fatty liver syndrome in laying hens. Br. Vet. J. 144:602–609. doi: 10.1016/0007-1935(88)90031-0 [DOI] [PubMed] [Google Scholar]
  35. Tan, B., Yin Y. L., Liu Z. Q., Tang W. J., Xu H. J., Kong X. F., Li X. G., Yao K., Gu W. T., Smith S. B.,. et al. 2011. Dietary L-arginine supplementation differentially regulates expression of lipid-metabolic genes in porcine adipose tissue and skeletal muscle. J. Nutr. Biochem. 22:441–445. doi: 10.1016/j.jnutbio.2010.03.012 [DOI] [PubMed] [Google Scholar]
  36. Temim, S., Chagneau A. M., Peresson R., and Tesseraud S... 2000. Chronic heat exposure alters protein turnover of three different skeletal muscles in finishing broiler chickens fed 20 or 25% protein diets. J. Nutr. 130:813–819. doi: 10.1093/jn/130.4.813 [DOI] [PubMed] [Google Scholar]
  37. Torki, M., Zangeneh S., and Habibian M... 2014. Performance, egg quality traits, and serum metabolite concentrations of laying hens affected by dietary supplemental chromium picolinate and vitamin c under a heat-stress condition. Biol. Trace Elem. Res. 157:120–129. doi: 10.1007/s12011-013-9872-8 [DOI] [PubMed] [Google Scholar]
  38. Traber, M. G., and Stevens J. F... 2011. Vitamins c and e: beneficial effects from a mechanistic perspective. Free Radic. Biol. Med. 51:1000–1013. doi: 10.1016/j.freeradbiomed.2011.05.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Wang, G., Kim W. K., Cline M. A., and Gilbert E. R... 2017. Factors affecting adipose tissue development in chickens: a review. Poult. Sci. 96:3687–3699. doi: 10.3382/ps/pex184 [DOI] [PubMed] [Google Scholar]
  40. Wasti, S., Sah N., and Mishra B... 2020. Impact of heat stress on poultry health and performances, and potential mitigation strategies. Animals (Basel). 10:1266. doi: 10.3390/ani10081266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wolfenson, D., Bachrach D., Maman M., Graber Y., and Rozenboim I... 2001. Evaporative cooling of ventral regions of the skin in heat-stressed laying hens. Poult. Sci. 80:958–964. doi: 10.1093/ps/80.7.958 [DOI] [PubMed] [Google Scholar]
  42. Yi, X., Liu J. Y., Wu P., Gong Y., Xu X. Y., and Li W. D.. 2020. The whole transcriptional profiling of cellular metabolism during adipogenesis from hMSCs. J. Cell. Physiol. 235:349–363. doi: 10.1002/jcp.28974 [DOI] [PubMed] [Google Scholar]
  43. Zhou, C., Gao X., Cao X., Tian G., Huang C., Guo L., Zhao Y., Hu G., Liu P., and Guo X... 2022. Gut microbiota and serum metabolite potential interactions in growing layer hens exposed to high-ambient temperature. Front. Nutr 9:877975. doi: 10.3389/fnut.2022.877975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zuo, J., Xu M., Abdullahi Y. A., Ma L., Zhang Z., and Feng D... 2015. Constant heat stress reduces skeletal muscle protein deposition in broilers. J. Sci. Food Agric. 95:429–436. doi: 10.1002/jsfa.6749 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

skad308_suppl_Supplementary_Tables_S1
Click here for additional data file. (12.5KB, docx)
skad308_suppl_Supplementary_Tables_S2
Click here for additional data file. (39.3KB, xlsx)

Data Availability Statement

The datasets used in the study are available from the corresponding author on reasonable request.

Articles from Journal of Animal Science are provided here courtesy of Oxford University Press

RESOURCES