Skip to main content
Poultry Science logoLink to Poultry Science
. 2023 Sep 17;102(12):103117. doi: 10.1016/j.psj.2023.103117

Construction and immune evaluation of the recombinant duck adenovirus type 3 delivering capsid protein VP1 of the type 1 duck hepatitis virus

Yongsen Wen ⁎,†,1, Jie Kong ⁎,‡,§,#,ǁǁ,1, Yong Shen *,‡,§,#,ǁǁ, Jiahui He *,‡,§,#,ǁǁ, Guanming Shao *,‡,§,#,ǁǁ, Keyu Feng *,‡,§,#,ǁǁ, Qingmei Xie *,‡,§,#,ǁǁ, Xinheng Zhang *,‡,§,#,ǁǁ,1
PMCID: PMC10591007  PMID: 37852056

Abstract

Adenovirus serves as an excellent viral vector and is employed in vector vaccine research. Duck hepatitis A virus type 1 (DHAV1) and duck adenovirus type 3 (DAdV3) cause significant economic losses in the Chinese duck industry. In this study, we found an excellent exogenous gene insertion site in DAdV3 genome of CH-GD-12-2014 strain, within 3 intergenic regions (IGR). Subsequently, we generated a recombinant duck adenovirus named rDAdV3-VP1-188, which exhibits excellent replication characteristics and immunogenicity of DAdV3 and DHAV1. Animal experiments showed that rDAdV3-VP1-188 can provide 100% protection against the DAdV3 and 80% protection against DHAV1. These results showed that rDAdV3-VP1-188 could induce protection against DAdV3 and DHAV1 in ducks, thus indicating the feasibility of DAdV3 as a vector for the development of avian vector vaccines. These insights contribute to the further development of DAdV3 vectors and other adenovirus vectors.

Key words: adenovirus, duck adenovirus type 3, duck hepatitis A virus type 1, Redα/Redβ, protective immunity

INTRODUCTION

Duck adenovirus belongs to avian adenovirus, is divided into duck adenovirus type 1 (DAdV1) and duck adenovirus type 2 (DAdV2) by the International Committee on Taxonomy of Viruses (ICTV) classification (Van Eck et al., 1976). In 2014, we isolated a novel type of duck adenovirus named CH-GD-12-2014 strain from a duck farm in Guangdong Province. Due to its low homology with DAdV-2, it was classified as a DAdV-3 candidate (Zhang et al., 2016). In addition, our research indicates that the livers were yellowish and, with hemorrhagic spots, kidney enlargement, and bleeding in DAdV3-infected Shaoxing ducks and Muscovy ducks (Zhang et al., 2016). In recent years, Fujian, Anhui, Zhejiang, Guangdong, and other regions have successively experienced outbreaks of diseases characterized by swollen and hemorrhagic duck liver and kidney, with mortality rates of 35 and 43%, respectively, all identified as DAdV-3 (Shi et al., 2019). The Fiber 2 protein is a structural protein encoded by DAdV-3 (Guo et al., 2023). In adenoviruses, "fiber" proteins play a crucial role in the virus's ability to attach to and enter host cells. It is a component of the virus's outer capsid and is responsible for recognizing and binding to specific receptors on the surface of host cells (Lin et al., 2023). This property makes it a good target for the development of antibodies that can be used in diagnostic assays to detect the presence of DAdV-3.

Duck viral hepatitis is an acute infectious disease characterized by hepatomegaly, necrosis and bleeding (Ding and Zhang, 2007). Duck viral hepatitis is caused by the duck hepatitis A virus (DHAV), which is a linear single-stranded RNA virus, belonging to the genus avian hepatoviruses, in the family small RNA virus, can invade the central and peripheral immune organs, resulting in immune dysfunction of the infected, and then lead to the occurrence of other secondary diseases (Liu et al., 2019). Currently, based on serum neutralization test and phylogenetic analysis, DHAV can be divided into 3 serotypes: DHAV1, DHAV2, and DHAV3 (Doan et al., 2016). DHAV1 was first isolated in the 1950s and belongs to the classical serotype (Tseng and Tsai, 2007). DHAV infection is common in duck farms in China (Liu et al., 2018). From 2010 to 2012, there were more outbreaks of duck viral hepatitis caused by DHAV1 in duck farms in China, and the mixed infection caused by DHAV1 and DHAV3 has become common in domestic ducks, and there is no significant difference in clinical characteristics between the 2 groups (Wen et al., 2018). The current prevention and control strategy for DHAV is through attenuated vaccines and inactivated immunization (Zou et al., 2016).

The picornavirus surface protein VP1 has the highest genetic diversity among isolates and is the most external and dominant (Zhang et al., 2014). Due to the presence of a motif that interacts with cellular receptors, VP1 is the main capsid protein on the surface of DHAV, which is the main antigenic determinant that triggers neutralizing antibodies (Zhang et al., 2014). VP1 protein of DHAV contains B cell and T cell epitopes and can induce protective neutralizing antibodies, so the protein can be used for vaccine development and serological diagnosis (Zhang et al., 2015). VP1 gene has been widely used in DHAV genotyping and molecular epidemiological studies (Zhang et al., 2015; Wang et al., 2019a). Since there is no effective vaccine against DAdV3, we intended to recombine the VP1 protein of DHAV1 into the entire genome of DAdV3 and construct a recombinant duck adenovirus to prevent and control DHAV1 and DAdV3 at the same time.

Intergenic region (IGR) refers to the sequence between 2 genes. Structural noncoding RNA (ncRNA) has been identified through routine analysis of intergenic regions (IGR), which may carry various functional units, such as transposons, enzyme binding sites, transcription factor binding sites, and small open reading frames (ORFs). Interestingly, partial potential coding genes have also been found within the IGR. The intergenic region is also one of the directions for vector vaccines to explore exogenous gene insertion sites (Manuel et al., 2010). However, there is no research information about the IGR of DAdV3 now.

The Redα/Redβ recombinases originated from the λ phage. Redα is a 5′–3′ exonuclease and Redβ is a DNA annealing protein. The Redα/Redβ system can mediate linear and circular DNA segments’ homologous recombination to precisely modify DNA in E. coli (Zhang et al., 1998; Fu et al., 2012). The ccdB and ccdA were located in the ccd operon of the E. coli F plasmid (Ogura and Hiraga, 1983). The ccdB gene is located on the F plasmid of E. coli and is part of the virus-antivirulence system encoded by the ccd operon. The ccdB encoding toxic protein CcdB, when its action is not prevented by CcdA protein, the CcdB protein is a potent efficiently traps gyrase in a cleavable complex (Bernard et al., 1993). The free ccdB is toxic, binding the GyrA subunit of DNA Gyrase, blocking the passage of DNA polymerases, leading to DNA breakage and cell death (Van Melderen et al., 1994; Afif et al., 2001). The ccdA is antidotal, prevents the ccdB toxin by forming a tight ccdA-ccdB complex (Gerdes, 2000). However, mutation of the gyrA gene can cause CcdB resistance in E. coli (Gerdes, 2000). Therefore, the ccdB gene can be used as a counter-selection marker during the recombination process to ensure that the plasmid was transferred to E. coli with gyrA mutation and ccdA deletion, and can express RecE/RecT recombinase, and then screen the correct recombinant DNA.

In this study, based on the infectious clones of DAdV3 CH-GD-12-2014 vaccine strain, looking for suitable gene insertion sites and embedding the VP1 gene of DHAV1 in the suitable IGR of DAdV3 to construct recombinant virus, and the immune protection was evaluated. To explore whether the recombinant duck adenovirus type 3 can protect ducks from DAdV3 and DHAV1 infection. In this study, recombinant virus rDAdV3-VP1 expressing DHAV VP1 protein was generated by Red/ET homologous recombination technology, so as to provide more theoretical basis for the evaluation of DHAV VP1 vector vaccine. Recombinant virus rDAdV3-VP1 expressing DHAV VP1 protein was generated by Red/ET homologous recombination technology, so as to provide more theoretical basis for the evaluation of DHAV VP1 vector vaccine.

MATERIALS AND METHODS

Cells and Virus

The duck embryo fibroblasts (DEF) were prepared by standard method and maintained in a growth medium consisting of DMEM (Macgene, Beijing, China) supplemented with 10% FCS (Corning, NY), 100 U/mL penicillin, and 0.1 mg/mL streptomycin (Wang et al., 2019b). The cells were incubated at 37°C in 5% CO2. The embryo used to prepare DEFs was obtained from Harbin Veterinary Research Institute. DAdV3 CH-GD-12-2014 stain (GenBank ID: KR135164) and DHAV-1 (GenBank ID: OK104992) were provided by our laboratory.

Antibodies and Reagents

Anti-EGFP polyclonal antibody, anti-VP1 polyclonal antibody, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody were obtained from Bioss, China. HRP-conjugated anti-duck secondary antibody was obtained from KPL. Primer STAR Max polymerase was purchased from Takara, China. Taq Master Mix was purchased from CWBIO, China. The expression of EGFP protein was detected by Western blot (WB) to confirm the feasibility of insertion sites.

Plasmid and E. Coli

The pBR322-mNeonGreen is preserved in our laboratory. The pBR322-DHAV-VP1 plamid was constructed by cloning DHAV-VP1 sequence (GenBank ID: OK104992) into the pBR322 vector. The pBR322-DAdV3-cm-ccdB-IGR162, pBR322-DAdV3-cm-ccdB-IGR188, pBR322-DAdV3-cm-ccdB-IGR641 plasmids were constructed by inserting the genomic suquence of the DAdV3 CH-GD-12-2014 strain (GenBank ID: KR135164), along with cm-ccdB and different IGR sequences. The IGR162 contains 162 bp of the ORF20 intron, the IGR188 spans 188 bp between the end of the pVIII gene and the beginning of the fiber1 gene, and the IGR641 contains 641 bp of the ORF19B intron. To remove the vector before rescue, restriction enzyme cutting sites for FseI were added at both ends of the pBR322 vector. These plasmids, as well as the E. coli GBred-gyrA462 strain with a gyrA mutation, ccdA deletion, and the ability to express Redα/Redβ recombinase, were generously donated by Professor Youming Zhang of Shandong University.

Construction of Recombinant Transfer Plasmid

The strategy of construction of recombinant transfer plasmid was shown in Figure 1A. The expression of transgenes in transfer plasmids was driven by the human CMV promoter. The mNeonGreen and VP1 fragment with homologous arm were amplified by PCR, pBR322-mNeonGreen, and pBR322-DHAV-VP1 were used as a template, the primers were shown in Table 1.

Figure 1.

Figure 1

The strategy of recombinant virus construction and the characterization of rDAdV3-mNeonGreen-162/188/641. (A) The design of recombinant virus construction. (B) CPE and fluorescence were observed in infected cells. (C) The PCR was used to detect the replication ability of the recombinant virus. (D) The growth kinetic curve of rDAdV3-mNeonGreen-188 and DAdV3 CH-GD-12-2014 strain.

Table 1.

The primers for amplifying mNeonGreen and VP1 which contains the homologous arm of pBR322-DAdV3-cm-ccdB-162/188/641.

Primer Sequence (5′→3′) Product
HA-mNeonGreen-F CAAGTAAAACCTCTACAAATGTGGTAGGC GATTATGATCAGCCCGGGCttacttgtacagctcgtccatgccc 811 bp
HA-mNeonGreen-R GTCGCAGTCTTCGGTCTGACCACCGTAGAAC
GCAGAGCCCGGGCGCCACcatggtgagcaagggcgaggaggata
HA-VP1-F CAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCAGCCCGGGCttaaaggtctagctcaagtttacg 814 bp
HA-VP1-R GTCGCAGTCTTCGGTCTGACCACCGTAGAACGCAGAGCCCGGGCGCCACCtacccactatggttggtcgatccc

Uppercase letters are homologous arm sequences, and lowercase letters are sequences that match mNeonGreen or VP1.

The mNeonGreen fragment with homologous arm was mixed with pBR322-DAdV3-cm-ccdB-IGR162, pBR322-DAdV3-cm-ccdB-IGR188, pBR322-DAdV3-cm-ccdB-IGR641, respectively, and transferred into E. coli GBred-gyrA462 for homologous recombination, as previously reported (Wang et al., 2016).

The primers in Table 2 were used for PCR identification of positive clones, and sequencing (Sangon, China). The recombinant plasmids were identified by restriction digestion for 4 h with SspI (NEB) and run on a 1% agarose gel.

Table 2.

Primers for recombinant virus gene detection.

Primer Sequence (5′→3′) Products
mNeonGreen-check-F TTACTTGTACAGCTCGTCCA 711 bp
mNeonGreen-check-R ATGGTGAGCAAGGGCGAGGA
VP1-check-F ATGGGTGATACCAACCAGC 714 bp
VP1-check-R CTCGATCTGGAAATTGAATAA
Fiber2-check-F TTCGCTAGCTGTGACAAGTG 680 bp
Fiber2-check-R CGATCTTGGCATAGTATGCG

Generation and Characterization of Recombinant Virus

All recombinant DAdV3 were rescued and propagated in DEFs. Before the rescue, the pBR322 vector of all recombinant plasmids was removed by endonuclease FseI (NEB) and then purified by Phenol: Chloroform: Isoamyl Alcohol 25:24:1 mixture (Sigma-Aldrich, Shanghai, China). Transfection was performed by Lipofectamine 3000 (Thermo Fisher, Waltham, MA).

In transfection culture after 48 h, the cells were repeated freeze-thaw to collect the virus supernatant. RT-PCR was used to detect the expression level of EGFP or VP1 genes and fiber2 gene of DAdV3 in the 3rd and 20th generations of different recombinant viruses, and the primers were shown in Table 2. The Viral DNA was extracted using Viral DNA Miniprep Kit (AxyGen Scientific, Union City, CA).

The expression of EGFP protein was detected by WB to confirm the feasibility of insertion sites. The expression of VP1 protein was also detected by WB. By obtaining recombinant DAdV3 at different points in time, the growth kinetic curve was drawn by TCID50 virus titer and compared with that of DAdV3 CH-GD-12-2014 original strain to observe whether the growth kinetic curve were similar.

Electron Microscopy

The protocol has been modified from previous reports (Zhang et al., 2016). Five hundred milliliter virus propagated in DEFs was obtained, centrifuged at 12,000 × g for 5 min, the supernatants were filtered through 0.22 μm filters to remove cellular debris, and then centrifuged at 40,000 × g for 3 h at 4°C, resuspended in 100 μL of PBS, negatively stained with 1% phosphotungstic acid for 30 s, mounted onto 200-mesh Formvar-coated copper grids, and viewed with a transmission electron microscope.

Animal Experiment

Animal operations of immune and challenge as shown in Figures 3A and 4A. All ducks were housed and bred at a pathogen-free animal isolation facility at 25°C to 30°C, provided with adequate commercial feed and water.

Figure 3.

Figure 3

The animal experiment of vaccine efficacy. (A) Schematic diagram of animal experiments and animal operations for assessing vaccine efficacy: this figure provides an overview of the experimental setup, including the timeline and procedures involved in assessing the efficacy of the vaccine. (B) Antibody responses against DAdV3: this graph depicts the antibody responses against duck adenovirus type 3 (DAdV3) in the rDAdV3-VP1-188, DAdV3, and PBS (control) groups. (C) Antibody responses against DHAV1: similar to the previous graph, this one illustrates the antibody responses, but specifically against duck hepatitis A virus type 1 (DHAV1). It compares the antibody levels in the rDAdV3-VP1-188, DAdV3, and PBS groups.

Figure 4.

Figure 4

The animal experiment on protective efficacy. (A) Schematic diagram of animal experiment and animal operations for protective efficacy. (B) Macroscopic appearance and histological images of liver and kidney in DAdV3 challenge groups (group 1–3). It presents macroscopic and histological images of the liver and kidneys in the DAdV3 challenge groups. (C) Macroscopic appearance and histological images of Liver and kidneys in DHAV1 challenge groups (group 4–6), and the control group (group 7). The grouping information is shown in Table 3.

In the animal immunity experiment, thirty 20-day-age Muscovy ducks were randomly divided into 3 groups, with 10 ducks in each group. After 2% formaldehyde inactivation and mixing with Freund's adjuvant (Sigma-Aldrich, Shanghai, China) in equal volume, rDAdV3-VP1-188, DAdV3 of 103.00 TCID50, and PBS in the same manner were injected subcutaneously in the neck every 2 wk. The plasma samples were collected in a pyrogen-free vacuum anticoagulant vessel via the cervical vein from ducks at 1 to 10 wk postvaccination (wpv), the serum was collected after coagulation and used for ELISA. After the experiment, all ducks were euthanized using CO2.

In the challenge experiment, seventy 20-day-age Muscovy ducks were randomly divided into 7 groups, with 10 ducks in each group, as shown in Table 3. After immunization according to the result above, 103.00TCID50 DAdV3 or DHAV were intramuscular injections at leg at 6 wpv, respectively. The infected ducks were observed and recorded mental state, whether death occurred, and all ducks were euthanized using CO2 and dissected 1 wk after the challenge. Liver and kidney samples were preserved in 4% formaldehyde for fixation, embedding in paraffin wax, section preparation, hematoxylin and eosin (H&E) staining, and histopathological analyses.

Table 3.

Grouping information of animal experiment.

Groups Vaccination Challenge Hyperemia Kidney swelling Death
1 PBS DAdV3 (103TCID50) 9/10 9/10 5/10
2 DAdV3 0/10 0/10 0/10
3 rDAdV3-VP1-188 0/10 0/10 0/10
4 PBS DHAV1 (103TCID50) 10/10 10/10 9/10
5 DAdV3 9/10 10/10 8/10
6 rDAdV3-VP1-188 3/10 2/10 2/10
7 PBS PBS 0/10 0/10 0/10

ELISA

Two indirect ELISA based on a Fiber2 protein (approximately 57 kDa) or VP1 protein (approximately 57 kDa) was expressed as a recombinant protein in Escherichia coli by our laboratory, was developed to assess IgG and IgA antibody responses in ducks immunized with rDAdV3-VP1-188. ELISA was used to detect the antibody levels of DHAV-VP1 and DADV3-Fiber2 in the plasma of ducks in 1 to 10 wpv.

In brief, a concentration of 0.1 μg/mL purified recombinant protein in 0.05 M NaHCO3 was used to coat ELISA plates (Corning, NY) and then incubated with samples (1: 200 dilution) at 37°C for 1 h. After the plate was washed with PBST 3 times, an HRP-conjugated anti-duck IgG mAb (1:500 dilution; KPL) was added and incubated at 37°C for 0.5 h. Then, the plate was washed with PBST 3 times, followed by adding the 3,3′,5,5′-tetramethylbenzidine (TMB) substrate and incubated at 37°C for 15 min. Then, 50 μL of stop solution was added, and the absorbance was determined at 450 nm.

RESULTS

Characterization of rDAdV3-mNeonGreen-188

pBR322-DAdV3-mNeonGreen-IGR188 was rescued, cytopathic effects (CPE) and fluorescence could be observed in P3 and P20 (Figure 1B), compared to normal DEF, the infected cells became round and clustered like grapes, which is a classical characteristic of the CPE in adenovirus-infected cells (Xie et al., 2012; Liu et al., 2016). DAdV3-fiber2 and mNeonGreen genes were detected by PCR (Figure 1C). The growth kinetics of the rescued recombinant virus closely mirrored those of the original strain (Figure 1D). Unfortunately, pBR322-DAdV3-mNeonGreen-IGR162 and pBR322-DAdV3-mNeonGreen-IGR641 were rescued many times, but all failed.

Characterization of rDAdV3-VP1-188

Insert VP1 gene in IGR188 of DAdV3. Following virus rescue, CPE were observable in various cell passages, including P3 and P20 (Figure 2A), PCR was utilized to detect the DAdV3-fiber2 and VP1 genes (Figure 2B), and the VP1 protein was detected through WB analysis (Figure 2C). The growth kinetic curve of the rescued recombinant virus was similar to the original strain (Figure 2D).

Figure 2.

Figure 2

Characterization of rDAdV3-VP1-188. (A) CPE was observed in infected cells. (B) PCR was employed to assess the replication ability of the recombinant virus. (C) The expression of VP1 protein was detected by WB. (D) The growth kinetic curve of rDAdV3-VP1-188 and DAdV3 CH-GD-12-2014 strain. (E) Electron microscope image of virus particles of rDAdV3-VP1-188.

Electron Microscopy

Identification of virion-packaged host proteins requires purified virions with high purity. A purification involving the 10th-generation virus was used to produce purified rDAdV3-VP1-188J virions, the characteristics of the viral particles as shown in Figure 2E. The virions are free of cellular debris, and most of them have a high integrity of diameter 70 nm, the particles were empty and complete virions.

Vaccine Efficacy in Ducks

We analyzed antibody responses using ELISA. The antibody response against DAdV3 in the rDAdV3-VP1-188 and DAdV3 groups peaked at 4 wpv and declined by 7 wpv. In contrast, the PBS group did not show any detectable antibodies between 1 and 10 wpv (Figure 3B). Similarly, the antibody response against DHAV in the rDAdV3-VP1-188 group peaked at 4 wpv and declined at 7 wpv, while both the DAdV3 and PBS groups did not exhibit detectable antibodies between 1 and 10 wpv (Figure 3C).

Protective Efficacy Against DAdV3

The ducks in the control groups showed depression, 5 ducks died in 7 d after the challenge, and no death in DAdV3 and rDAdV3-VP1-188 groups (Table 3), showing that rDAdV3-VP1-188 provides 100% protection against DAdV3. The dead ducks showed yellowish in the liver and slight congestion in the kidney, the ducks of DAdV3 and rDAdV3-VP1-188 groups showed no typical signs of above. There was no death in DAdV3 and rDAdV3-VP1-188 groups (Figure 4B). Histopathological examination of the PBS group revealed congestion in the liver, and the dilated sinusoid was full of red blood cells. In addition, hepatocytes were swollen and denatured with round or irregular vacuoles that appeared in the cytoplasm. Congestion was also observed in the kidney. The inflammatory cells were aggregated. Renal tubular epithelial cells were swollen and degenerated, and some epithelial cells were necrotic. No significant histopathological damage was found from the ducks of the DAdV3 and rDAdV3-VP1-188 group (Figure 4B).

Protective Efficacy Against DHAV

The ducks in the PBS and DAdV3 groups showed depression, 9 and 8 ducks died in 1 wk after the challenge, respectively and 2 ducks of the rDAdV3-VP1-188 group died in 1 wk after the challenge (Table 3), showing that rDAdV3-VP1-188 provides 80% protection against DHAV1. The death ducks showed typical hemorrhagic hepatitis and kidney swelling (Figure 4C). Histopathological examination of the PBS and DAdV3 group revealed hemorrhage in the liver, and a high number of enlarged hepatocytes and a sparse number of localized infiltrates of inflammatory cells were discovered in the livers. In addition, hepatocytes were swollen and denatured with round or irregular vacuoles that appeared in the cytoplasm. Congestion was also observed in the kidney. The inflammatory cells were aggregated. Renal tubular epithelial cells were swollen and degenerated, and some epithelial cells were necrotic. The ducks of the rDAdV3-VP1-188 group showed no typical signs of the above. No significant histopathological damage was found in the ducks of negative PBS group (Figure 4C).

DISCUSSION

Virus-vectored vaccine development has experienced major technological breakthroughs with the advent of scientific knowledge and molecular biology (Fougeroux and Holst, 2017). There are many critical advantages of adenovirus as a vector, including the simplicity of the vector development, their ability to replicate to high titers (Kamen and Henry, 2004), broad cell tropism (Vorburger and Hunt, 2002), can encode relatively large DNA inserts (Bett et al., 1993), safety, and already for human applications (Sayedahmed et al., 2020). Compared with human adenoviruses that have been well studied, duck adenoviruses were discovered late and poorly researched. The Convenience of certified cell lines for large-scale production and purification is not available, but the development and application potential are huge.

To find a feasible insertion site in the DAdV3 genome, the infectious clone of CH-GD-12-2014 stain was used, and the mNeonGreen gene expression box was inserted at IGR162, IGR188, and IGR641 by Redα/Redβ system. Only the rDAdV3-mNeonGreen-188 could rescue, replication was stable, and mNeonGreen was stable and expressed in the infected cells, which indicated that IGR188 was ideal for the insertion of the exogenous gene. The growth kinetic curve of rDAdV3-mNeonGreen-188 was similar to the DAdV3 CH-GD-12-2014 stain, indicating that the insertion of the mNeonGreen gene at IGR188 did not affect the replication characteristics of DAdV3 CH-GD-12-2014 stain. Adenovirus genomes can be divided into early (E) and late (L) genes based on the initiation time of DNA replication. The late genes of adenovirus encode the majority of structural proteins required for the adenovirus capsid assembly (Liu, 2014), and the early genes of adenovirus are essential for the initiation of the adenovirus genome replication. The genes in the E2 and E4 regions are critical for virus replication (Sayedahmed et al., 2020). According to the HAdV5 genome (Sayedahmed et al., 2020), early and late genes of the DAdV3 CH-GD-12-2014 strain genome were labeled. IGR188 is located in the middle of 2 late genes, IGR162 and IGR641 are located in several early genes, corresponding to the E4 and E5 regions of HAd5. The insertion of a gene into IGR162 and IGR641 may disrupt the transcription of DAdV3, leading to rescue failure. At present, there are few studies on the duck adenovirus genome. The results above can provide a vision for further research of DAdV3.

DHAV1 is internationally widespread and can cause acute and highly lethal diseases of ducklings (Wang et al., 2019a). Common commercial attenuated vaccines against DHAV carry a potential risk of virulence reversion (Kim et al., 2009; Wang et al., 2019a), using vector vaccines can prevent this problem. DAdV3 is an emerging virus. Several outbreaks of DAdV3 recently, characterized by swelling and hemorrhagic liver and kidney, have been threatening duckling farms in the east and south of China (Shi et al., 2019). DAdV3 is rarely reported, although it is widely spread and endangers duckling farms in China.

Based on the above results, we used Redα/Redβ system to insert the DHAV-1 VP1 expression box at IGR188, and successfully obtained the rDAdV3-VP1-188 that could replicate stably and express VP1 protein, the growth kinetic curve of rDAdV3-VP1-188 was similar to DAdV3 CH-GD-12-2014 stain, indicated that the rDAdV3-VP1-188 has the replication characteristics and immunogenicity of DAdV3 and DHAV1, can be used for further study.

In animal experiments, in order to know the immune efficacy in ducks of rDAdV3-VP1-188, we measured the changes of specific antibody content in the serum of ducks after immunization by ELISA, and rDAdV3-VP1-188 induced specific antibody to DAdV3 and DHAV in higher titer both in 5 to 7 wpv. To further understand the protective effect of rDAdV3-VP1-188 on DAdV3 and DHAV infection, we used the above immune procedure and then conducted a challenging experiment. According to the results, replication characteristics and immunogenicity of DAdV3 were not changed after the insertion of the VP1 gene at IGR188. In this experiment, the DAdV3 group and rDAdV3-VP1-188 group produced a 100% protective effect against DAdV3, indicating that the DAdV3 vector of rDAdV3-VP1-188 played an immunogenicity. On the other hand, rDAdV3-VP1-188 provided protection against DHAV1, but DAdV3 and PBS groups did not, suggesting that VP1 expressed by rDAdV3-VP1-188 produced immunogenicity and provided protection. Although rDAdV3-VP1-188 does not provide 100% protection against DHAV1, which may be due to insufficient protection provided by VP1 protein alone, and also requires VP0 protein (Wang et al., 2018; Niu et al., 2020).

DAdV3 CH-GD-12-2014 strain can cause disease in ducks (Zhang et al., 2016), and the insertion of the VP1 gene expression box into IGR188 did not affect recombinant virus replication. Therefore, the rDAdV3-VP1-188 was inactivated. In order to compensate for the virus's inability to replicate, and generate enough protection, we immunized the ducks 3 times. In order to generate an adequate immune response, Muscovy ducks aged 20 d were selected for the experiment, considering that the duck immune system is primitive (Higgins et al., 1993), and was not fully established in ducklings.

Despite the high cost of immunization in rDADV3-VP1-188, this study demonstrates the feasibility of using DAdV3 as a vector for the development of avian vector vaccines, provides directions for further development of DAdV3 vectors and other adenovirus vectors, such as genome modification to increase the carrying capacity of the exogenous gene, generate live adenovirus vectors, development of corresponding cell lines, and reduction of production costs, like human adenovirus (Danthinne and Imperiale, 2000; Mitani and Kubo, 2002; Crystal, 2014; Fougeroux and Holst, 2017).

ACKNOWLEDGMENTS

The authors gratefully acknowledge the Animal Experiment Center of South China Agricultural University for the support provided with the animal experiments.

Funding: This study was supported by National Key R&D Program of China (2022YFD1801000), the Heyuan Branch, Guangdong Laboratory for Lingnan Modern Agriculture Project (DT20220003), the Natural Science Foundation of Guangzhou (2023A04J1461), the China Agriculture Research System of MOF and MARA (CARS-42-13), the Guangdong Provincial Key R&D Program (2020B020222001, 2019B020218004), the Guangdong Basic and Applied Basic Research Foundation (2023A1515010584), the Guangdong Chimelong Philanthropic Foundation (CLPF2021007Z), the construction project of modern agricultural science and technology innovation alliance in Guangdong province (2023KJ128, 2022KJ128, 2021KJ128, 2020KJ128), the Special Project of National Modern Agricultural Industrial Technology System (CARS-41), the Science and Technology Program of Guangdong province, China (2020B1212060060) and Provincial Science and Technology Special Fund Project for Zhongshan City (major special project + Task list management mode) (2021sdr003).

Ethics Statement: All experiments were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The use of animals in this study was approved by the South China Agricultural University Committee of Animal Experiments (approval ID: SYXK2019-0136).

Author Contributions: Y. S. and K. J. designed the project and finalized the manuscript. S. Y. performedthe data analysis. J. H., G. M. and K. Y. performed the experiments. X. H. conducted the validation. Q. M. reviewed the draft.

DISCLOSURES

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

REFERENCES

  1. Afif H., Allali N., Couturier M., Van Melderen L. The ratio between CcdA and CcdB modulates the transcriptional repression of the ccd poison-antidote system. Mol. Microbiol. 2001;41:73–82. doi: 10.1046/j.1365-2958.2001.02492.x. [DOI] [PubMed] [Google Scholar]
  2. Bernard P., Kézdy K.E., Van Melderen L., Steyaert J., Wyns L., Pato M.L., Higgins P.N., Couturier M. The F plasmid CcdB protein induces efficient ATP-dependent DNA cleavage by gyrase. J. Mol. Biol. 1993;234:534–541. doi: 10.1006/jmbi.1993.1609. [DOI] [PubMed] [Google Scholar]
  3. Bett A.J., Prevec L., Graham F.L. Packaging capacity and stability of human adenovirus type 5 vectors. J. Virol. 1993;67:5911–5921. doi: 10.1128/jvi.67.10.5911-5921.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Crystal R.G. Adenovirus: the first effective in vivo gene delivery vector. Hum. Gene. Ther. 2014;25:3–11. doi: 10.1089/hum.2013.2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Danthinne X., Imperiale M.J. Production of first generation adenovirus vectors: a review. Gene Ther. 2000;7:1707–1714. doi: 10.1038/sj.gt.3301301. [DOI] [PubMed] [Google Scholar]
  6. Ding C., Zhang D. Molecular analysis of duck hepatitis virus type 1. Virology. 2007;361:9–17. doi: 10.1016/j.virol.2007.01.007. [DOI] [PubMed] [Google Scholar]
  7. Doan H.T., Le X.T., Do R.T., Hoang C.T., Nguyen K.T., Le T.H. Molecular genotyping of duck hepatitis A viruses (DHAV) in Vietnam. J. Infect. Dev. Ctries. 2016;10:988–995. doi: 10.3855/jidc.7239. [DOI] [PubMed] [Google Scholar]
  8. Fougeroux C., Holst P.J. Future prospects for the development of cost-effective adenovirus vaccines. Int. J. Mol. Sci. 2017;18:686. doi: 10.3390/ijms18040686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fu J., Bian X., Hu S., Wang H., Huang F., Seibert P.M., Plaza A., Xia L., Müller R., Stewart A.F., Zhang Y. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat. Biotechnol. 2012;30:440–446. doi: 10.1038/nbt.2183. [DOI] [PubMed] [Google Scholar]
  10. Gerdes K. Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress. J. Bacteriol. 2000;182:561–572. doi: 10.1128/jb.182.3.561-572.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Guo Y., Lin Y., Xie Q., Zhang W., Xu Z., Chao Y., Cao X., Jiang H., Li H., Li T., Wan Z., Shao H., Qin A., Ye J. A novel recombinant serotype 4 fowl adenovirus expressing fiber-2 protein of duck adenovirus 3. Front. Cell Infect. Microbiol. 2023;13 doi: 10.3389/fcimb.2023.1177866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Higgins D.A., Cromie R.L., Srivastava G., Herzbeck H., Schlüter C., Gerdes J., Diamantstein T., Flad H.D. An examination of the immune system of the duck (Anas platyrhynchos) for factors resembling some defined mammalian cytokines. Dev. Comp. Immunol. 1993;17:341–355. doi: 10.1016/0145-305x(93)90006-c. [DOI] [PubMed] [Google Scholar]
  13. Kamen A., Henry O. Development and optimization of an adenovirus production process. J. Gene Med. 2004;6(Suppl. 1):S184–S192. doi: 10.1002/jgm.503. [DOI] [PubMed] [Google Scholar]
  14. Kim M.C., Kim M.J., Kwon Y.K., Lindberg A.M., Joh S.J., Kwon H.M., Lee Y.J., Kwon J.H. Development of duck hepatitis A virus type 3 vaccine and its use to protect ducklings against infections. Vaccine. 2009;27:6688–6694. doi: 10.1016/j.vaccine.2009.08.092. [DOI] [PubMed] [Google Scholar]
  15. Lin Y., Zhang W., Xie J., Wang W., Xie Q., Li T., Shao H., Qin A., Wan Z., Ye J. Identification of novel B cell epitopes in Fiber-2 protein of duck adenovirus 3 and their application. AMB Exp. 2023;13:62. doi: 10.1186/s13568-023-01552-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu L. Fields virology, 6th edition. Clin. Infect. Dis. 2014;59 613-613. [Google Scholar]
  17. Liu R., Chen C., Huang Y., Cheng L., Lu R., Fu G., Shi S., Chen H., Wan C., Fu Q., Lin J. Microbiological identification and analysis of waterfowl livers collected from backyard farms in southern China. J. Vet. Med. Sci. 2018;80:667–671. doi: 10.1292/jvms.17-0452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Liu R., Shi S., Huang Y., Chen Z., Chen C., Cheng L., Fu G., Chen H., Wan C., Fu Q. Comparative pathogenicity of different subtypes of duck hepatitis A virus in Pekin ducklings. Vet. Microbiol. 2019;228:181–187. doi: 10.1016/j.vetmic.2018.11.030. [DOI] [PubMed] [Google Scholar]
  19. Liu Y., Wan W., Gao D., Li Y., Yang X., Liu H., Yao H., Chen L., Wang C., Zhao J. Genetic characterization of novel fowl aviadenovirus 4 isolates from outbreaks of hepatitis-hydropericardium syndrome in broiler chickens in China. Emerg. Microbes Infect. 2016;5:e117. doi: 10.1038/emi.2016.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Manuel E.R., Wang Z., Li Z., La Rosa C., Zhou W., Diamond D.J. Intergenic region 3 of modified vaccinia ankara is a functional site for insert gene expression and allows for potent antigen-specific immune responses. Virology. 2010;403:155–162. doi: 10.1016/j.virol.2010.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mitani K., Kubo S. Adenovirus as an integrating vector. Curr. Gene Ther. 2002;2:135–144. doi: 10.2174/1566523024605591. [DOI] [PubMed] [Google Scholar]
  22. Niu Y., Liu B., Sun C., Zhao L., Chen H. Construction of the recombinant duck enteritis virus delivering capsid protein VP0 of the duck hepatitis A virus. Vet. Microbiol. 2020;249 doi: 10.1016/j.vetmic.2020.108837. [DOI] [PubMed] [Google Scholar]
  23. Ogura T., Hiraga S. Mini-F plasmid genes that couple host cell division to plasmid proliferation. Proc. Natl. Acad. Sci. USA. 1983;80:4784–4788. doi: 10.1073/pnas.80.15.4784. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Sayedahmed E.E., Elkashif A., Alhashimi M., Sambhara S., Mittal S.K. Adenoviral vector-based vaccine platforms for developing the next generation of influenza vaccines. Vaccines. 2020;8 doi: 10.3390/vaccines8040574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Shi S., Liu R., Wan C., Cheng L., Chen Z., Fu G., Chen H., Fu Q., Huang Y. Isolation and characterization of duck adenovirus 3 circulating in China. Arch. Virol. 2019;164:847–851. doi: 10.1007/s00705-018-4105-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Tseng C.H., Tsai H.J. Molecular characterization of a new serotype of duck hepatitis virus. Virus Res. 2007;126:19–31. doi: 10.1016/j.virusres.2007.01.012. [DOI] [PubMed] [Google Scholar]
  27. Van Eck J.H., Davelaar F.G., Heuvel-Plesman T.A., Van Kol N., Kouwenhoven B., Guldie F.H. Dropped egg production, soft shelled and shell-less eggs associated with appearance of precipitins to adenovirus in flocks of laying fowls. Avian Pathol. 1976;5:261–272. doi: 10.1080/03079457608418195. [DOI] [PubMed] [Google Scholar]
  28. Van Melderen L., Bernard P., Couturier M. Lon-dependent proteolysis of CcdA is the key control for activation of CcdB in plasmid-free segregant bacteria. Mol. Microbiol. 1994;11:1151–1157. doi: 10.1111/j.1365-2958.1994.tb00391.x. [DOI] [PubMed] [Google Scholar]
  29. Vorburger S.A., Hunt K.K. Adenoviral gene therapy. Oncologist. 2002;7:46–59. doi: 10.1634/theoncologist.7-1-46. [DOI] [PubMed] [Google Scholar]
  30. Wang A., Gu L., Wu S., Zhu S. Duck hepatitis A virus structural proteins expressed in insect cells self-assemble into virus-like particles with strong immunogenicity in ducklings. Vet. Microbiol. 2018;215:23–28. doi: 10.1016/j.vetmic.2017.12.020. [DOI] [PubMed] [Google Scholar]
  31. Wang H., Li Z., Jia R., Hou Y., Yin J., Bian X., Li A., Müller R., Stewart A.F., Fu J., Zhang Y. RecET direct cloning and Redαβ recombineering of biosynthetic gene clusters, large operons or single genes for heterologous expression. Nat. Protoc. 2016;11:1175–1190. doi: 10.1038/nprot.2016.054. [DOI] [PubMed] [Google Scholar]
  32. Wang M., Li Z., Liu H., Wang X., Zhang D. Effect of fetal calf serum on propagation of duck hepatitis A virus genotype 3 in duck embryo fibroblast cells. BMC Vet. Res. 2019;15:153. doi: 10.1186/s12917-019-1904-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang A.P., Liu L., Gu L.L., Guo C.M., Wu S., Feng Q., Xia W.L., Wu Z., Zhu S.Y. Protection against duck hepatitis a virus type 1 conferred by a recombinant avian adeno-associated virus. Poult. Sci. 2019;98:112–118. doi: 10.3382/ps/pey325. [DOI] [PubMed] [Google Scholar]
  34. Wen X., Zhu D., Cheng A., Wang M., Chen S., Jia R., Liu M., Sun K., Zhao X., Yang Q., Wu Y., Chen X. Molecular epidemiology of duck hepatitis a virus types 1 and 3 in China, 2010-2015. Transbound. Emerg. Dis. 2018;65:10–15. doi: 10.1111/tbed.12741. [DOI] [PubMed] [Google Scholar]
  35. Xie L., Yu X.F., Sun Z., Yang X.H., Huang R.J., Wang J., Yu A., Zheng L., Yu M.C., Hu X.W., Wang B.M., Chen J., Pan J.C., Liu S.L. Two adenovirus serotype 3 outbreaks associated with febrile respiratory disease and pharyngoconjunctival fever in children under 15 years of age in Hangzhou, China, during 2011. J. Clin. Microbiol. 2012;50:1879–1888. doi: 10.1128/JCM.06523-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhang Y., Buchholz F., Muyrers J.P., Stewart A.F. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 1998;20:123–128. doi: 10.1038/2417. [DOI] [PubMed] [Google Scholar]
  37. Zhang T., Li X., Wu X., Shaozhou W., Bai X., Liu S., Liu M., Zhang Y. Characterization of monoclonal antibodies against duck hepatitis type 1 virus VP1 protein. J. Virol. Methods. 2014;208:166–170. doi: 10.1016/j.jviromet.2014.07.035. [DOI] [PubMed] [Google Scholar]
  38. Zhang X., Zhong Y., Zhou Z., Liu Y., Zhang H., Chen F., Chen W., Xie Q. Molecular characterization, phylogeny analysis and pathogenicity of a Muscovy duck adenovirus strain isolated in China in 2014. Virology. 2016;493:12–21. doi: 10.1016/j.virol.2016.03.004. [DOI] [PubMed] [Google Scholar]
  39. Zhang R., Zhou G., Xin Y., Chen J., Lin S., Tian Y., Xie Z., Jiang S. Identification of a conserved neutralizing linear B-cell epitope in the VP1 proteins of duck hepatitis A virus type 1 and 3. Vet. Microbiol. 2015;180:196–204. doi: 10.1016/j.vetmic.2015.09.008. [DOI] [PubMed] [Google Scholar]
  40. Zou Z., Ma J., Huang K., Chen H., Liu Z., Jin M. Live attenuated vaccine based on duck enteritis virus against duck hepatitis A virus types 1 and 3. Front. Microbiol. 2016;7:1613. doi: 10.3389/fmicb.2016.01613. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES