Skip to main content
Journal of Cancer Research and Clinical Oncology logoLink to Journal of Cancer Research and Clinical Oncology
. 2023 Aug 16;149(16):14701–14719. doi: 10.1007/s00432-023-05270-4

The combined signatures of G protein-coupled receptor family and immune landscape provide a prognostic and therapeutic biomarker in endometrial carcinoma

Shengyue Chen 1,2,#, Xukai Luo 2,#, Baicai Yang 3,#, Jingming Zhuang 4, Jinshuai Guo 1, Yingjie Zhu 3, Jiahang Mo 2,
PMCID: PMC10602984  PMID: 37584707

Abstract

G protein-coupled receptors (GPRs) are one of the largest surface receptor superfamilies, and many of them play essential roles in biological processes, including immune responses. In this study, we aim to construct a GPR- and tumor immune environment (TME-i)-associated risk signature to predict the prognosis of patients with endometrial carcinoma (EC). The GPR score was generated by applying univariate Cox regression and the Least Absolute Shrinkage and Selection Operator (LASSO) Cox regression in succession. This involved identifying the differentially expressed genes (DEGs) in the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma (TCGA-UCEC) cohort. Simultaneously, the CIBERSORT algorithm was applied to identify the protective immune cells for TME score construction. Subsequently, we combined the GPR and TME scores to establish a GPR-TME classifier for conducting clinical prognosis assessments. Various functional annotation algorithms were used to conduct biological process analysis distinguished by GPR-TME subgroups. Furthermore, weighted correlation network analysis (WGCNA) was applied to depict the tumor somatic mutations landscapes. Finally, we compared the immune-related molecules between GPR-TME subgroups and resorted to the Tumor Immune Dysfunction and Exclusion (TIDE) for immunotherapy response prediction. The mRNA and protein expression of GPR-related gene P2RY14 were, respectively, validated by RT-PCR in clinical samples and HPA database. To conclude, our GPR-TME classifier may aid in predicting the EC patients’ prognosis and immunotherapy responses.

Supplementary Information

The online version contains supplementary material available at 10.1007/s00432-023-05270-4.

Keywords: Endometrial carcinoma, G protein-coupled receptor, Tumor microenvironment, Immunotherapy, Prognosis

Introduction

Endometrial carcinoma (EC) is the sixth most prevalent cancer in women, with over 400,000 new diagnoses made in 2020, according to global cancer statistics (Sung et al. 2021). Though many early-stage EC cases are cured with surgery alone, there are a notable number of women with aggressive variants whose prognosis remains dismal (Crosbie et al. 2022; Oaknin et al. 2022a). Traditionally, EC was subclassified into two types based on its clinical and pathological features. Type I ECs are more common and result from unopposed estrogenic stimulation of the endometrium (Bokhman 1983). The histotypes of type I ECs are mostly endometrioid with indolent biological behavior, accompanied by PTEN and KRAS mutations and microsatellite instability (MSI) status aberrance (Huvila et al. 2021). In contrast, type II ECs are aggressive phenotypes and are high-grade carcinomas. This subtype is primarily identified by p53 mutations and is considered the cause of relapse and death. (Brinton et al. 2013).

In 2013, The Cancer Genome Atlas (TCGA) Research Network proposed molecular subtypes of EC based on genomic profiles. These subtypes are the POLEmut group, MMRd (hypermutated/microsatellite unstable) group, SMP (no specific molecular profile) group, and p53abn (serous-like) group (Kandoth et al. 2013). Other than significant molecular abnormalities, these molecular subtypes differ in terms of genetic and environmental risk factors, prognosis, and response to hormonal therapy (Huvila et al. 2021). Surrogate markers for these molecular subtypes have been developed and successfully implemented in clinical practice (Talhouk et al. 2015, 2017; Stelloo et al. 2016). However, challenges remain in current EC classification systems, particularly in prognostic and therapeutic evaluation (McAlpine et al. 2018). Thus, new molecular patterns defining prognosis and therapeutic response in EC are urgently needed.

The G protein-coupled receptors (GPRs) family, a large superfamily of cell-surface signaling proteins, is involved in a variety of biological processes, including cell adhesion and motion (Orduna-Castillo et al. 2022), metabolites signaling transduction (Uranbileg et al. 2022; Brown et al. 2020; Pillai et al. 2022), and even immune responses (Ge et al. 2020). Aberrant GPR expression has been observed in various cancers (Bar-Shavit et al. 2016). Recent GPRs function research has highlighted mechanisms related to metabolites among these carcinous patterns. As a metabolic response to acid stress, the acid-sensing GPR (GPR68) has been reported to mediate lipogenesis in cancer cells, thereby promoting lipid droplet accumulation and enhancing viability under acidic stress (Pillai et al. 2022). In human hepatocellular carcinoma (HCC), S1P lyase (SPL) converts sphingolipids into glycerophospholipids (LPI and LPG). These subsequently combine with GPR55 and activate the p38/MAPK pathway, contributing to tumor progression (Uranbileg et al. 2022). Other metabolite-related GPRs, including lactate receptor (GPR81) (Brown et al. 2020), succinate receptor‑1 (GPR91) (Kuo et al. 2022), neurokinin-1 receptor (Zhang et al. 2022), and purinergic receptor (Wang et al. 2020), were extensively investigated in cancer research. In ECs, estrogenic transmembrane receptor (GPR30) has been extensively studied over the decade (He et al. 2009). Numerous evidence has already revealed that estrogen-mediated GPR signaling played a critical role in gaining malignant phenotypes (He et al. 2012; Zhang et al. 2019). In light of the preceding, it is necessary to propose a novel GPR molecular set that can shed light on EC prognosis and biological behavior.

Interestingly, numerous GPRs have been studied for their immunological functions. Activation of A2A receptors (A2AR), a typical GPR with a high affinity for adenosine, has been shown to promote the immune escape of cancer cells in tumor niche (Sun et al. 2022). The lactate receptor (GPR81) in breast cancer nidus promotes tumor growth through a paracrine mechanism involving dendritic cell (DCs) function impairment. This paracrine mechanism is complementary to an autocrine mechanism by which lactate induces programmed cell death ligand 1 (PD-L1) in tumor cells via activation of GPR81; therefore, inhibition of GPR81 signaling may provide a novel cancer immunotherapy strategy (Brown et al. 2020). Activated by low pH, proton-sensing GPR has been reported to promote PD-L1 expression in tumor cells (Mori et al. 2021). GPR87 expression is positively correlated with immune infiltration in lung adenocarcinoma (LUAD), suggesting potential benefits from immune checkpoint inhibitors (ICIs) (Bai et al. 2022). Another GPR, lysophosphatidic acid receptor 6 (LPAR6), was excluded from the immune infiltration evaluation (He et al. 2022, 2021). Therefore, given that ICIs agents are widely investigated for treating ECs (Ott et al. 2017; Makker et al. 2019), a series of biomarkers linking GPRs and immune features are ready for clinical application.

Materials and methods

Data sources and available analysis platforms

The current study enrolled 533 EC samples with RNA sequencing data and clinical information from TCGA (https://portal.gdc.cancer.gov/). Moreover, single-cell RNA (scRNA) sequencing data with cell reannotation of 1 microsatellite instability-high/mismatch repair-deficient (MSI-H/MMR-d) EC was obtained from GSE193430 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE193430) to visualize GPR scores in each immune cell (Guo et al. 2022). External validation was performed on an EC database comprised of 95 patients from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) as described by Li et al. (three were excluded for data deficient) (Dou et al. 2020; Li et al. 2023). Another Gene Expression Omnibus (GEO) dataset for differentially expressed genes (DEGs) seeking was obtained from GSE17025 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi) (Day et al. 2011). The extended analysis utilized four of the available analysis platforms. The Metascape (https://metascape.org) was applied for gene set annotation analysis (Zhou et al. 2019); Tracking Tumor Immunophenotype (TIP; http://biocc.hrbmu.edu.cn/TIP/) for immune evolutionary analysis (Xu et al. 2018); Tumor Immune Dysfunction and Exclusion (TIDE; http://tide.dfci.harvard.edu/) for immunotherapy response prediction (Jiang et al. 2018); and Proteomaps (https://www.proteomaps.net/) for depicting the protein composition of different subgroups (Liebermeister et al. 2014). Lastly, the Human Protein Atlas (HPA) (https://www.proteinatlas.org) was searched for P2YR14 immunohistochemical (IHC) staining assessment between normal and EC tissues (Liu et al. 2021a).

GPR-related genes and tumor immune microenvironment cells quantification

A compendium of 872 GPR-related genes was acquired from the Molecular Signatures Database (MSigDB; http://www.gsea-msigdb.org/gsea/msigdb) (Liberzon et al. 2015). Expression of all GPR-related genes was extracted from the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma (TCGA-UCEC) cohort. The CIBERSORT algorithm (https://cibersort.stanford.edu/) (Chen et al. 2018) was applied to quantify 22 immune cells based on the transcriptomes of the TCGA-UCEC cohort for tumor immune microenvironment (TME-i) cells.

Establishment of GPR score, TME score, and GPR-TME classifier

DEGs of GPR between ECs and normal uterine tissue were first extracted for subsequent analysis (“limma” package, version 3.50.3; Log (FC) > 1 or <  − 1, P < 0.05 were regard as the cutoff). The prognostic assessment of GPR-related genes and TME-i cells was further narrowed by univariate Cox regression analysis in the TCGA-UCEC cohort (“survminer” R package; version 0.4.9; with a cutoff of P < 0.05). Five protective immune cells were isolated for TME score construction, and 20 GPR-related genes were identified using the Least Absolute Shrinkage and Selection Operator (LASSO) regression model to generate a GPR risk signature (GPR score). An advanced algorithm, “bootstrap,” was applied to stabilize the coefficient generated from LASSO in both the GPR and TME score constructions. Simply, the GPR score was assigned by.

GPRscore=i=120Xi×Yi.

Likewise, the TME score was given by.

TMEscore=j=15Xj×Yj.where Xi is the relative expression value of each selected gene, Yi is the coefficient modified by the “bootstrap” algorithm; Xj is the relative expression value of each selected immune cell, and Yj is the coefficient modified the same algorithm. The GPR and TME scores were then integrated to develop the GPR-TME classifier. Subsequently, EC samples were divided into the following subgroups: GPR_high + TME_low, intermediate mixed (GPR_high + TME_low and GPR_low + TME_low), and GPR_low + TME_high based on the mean value of GPR score and TME score in TCGA-UCEC cohort.

Single-sample gene set enrichment analysis and fast gene set enrichment analysis

The “clusterProfiler” package (version 4.4.4) was used for single-sample gene set enrichment analysis (ssGSEA) to clarify the pathways enriched in different subgroups based on the expression level of GPR or TME-i cells (Liu et al. 2020). After combining the intermediate subgroups, the “fgsea” (version 1.20.0) and the “msigdbr” (version 7.5.1) packages were applied for fast GSEA analysis.

Comprehensive analysis of GPR score in a scRNA sequencing set

A unique sample of scRNA sequencing data (MSI‑H/MMR‑d EC) containing only immune cells was enrolled for GPR expression analysis among these infiltrative cells. The “Seurat” (version 4.3.0), “tidyverse” (version 1.3.2), and other subordinate packages were used to visualize the abundance of GPR scores in TME-i cells. Furthermore, the “CellChat” package (version 1.6.1) was used to outline intercellular communication.

Weighted correlation network analysis based on GPR-TME classifier

Weighted correlation network analysis (WGCNA) can be used to identify clusters of highly correlated genes and summarize them using the module eigengene or an intramodular hub gene (Langfelder and Horvath 2008). Thus, the “WGCNA” R package (version 1.71) was used to generate distinct modules (sft value was set as 0.90; Supplementary Fig. 1A). Then the desired module (marked “yellow”) was identified, and the gene clusters belonging to this module were submitted to Metascape for functional analysis.

Tumor somatic mutation, functional annotation, and TIP analysis

Somatic mutation data was available in the TCGA- UCEC database. The top 20 mutation genes were obtained using the “maftools” package (4.1.2) and then compared between GPR-TME subgroups. Hub genes with significant differences among GPR-TME subgroups were then extracted and analyzed. As described previously (Liu et al. 2022), each EC case's tumor mutation burden (TMB) score was also calculated. DEGs analysis was repeated before submitting to Proteomaps for functional annotation. Ten cases of each GPR-TME subgroup (including the mix subgroup) were randomly sampled to generate a matrix before TIP analysis. The returned online tool data were then visualized using the “pheatmap” R package (version 1.0.12).

Quantitative real time PCR

Tissue RNA Purification Kit PLUS (EZBiosciences, China) was utilized to extract RNA from EC tissue samples (twelve pairs). After extraction, NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) was used to detect RNA quantity and concentration. Hifair® III Reverse Transcriptase Kit (YEASEN, China) was subsequently designed for reverse transcription of total RNA to cDNA. Quantitative real time PCR (qRT-PCR) was conducted using the Taq Pro Universal SYBR qPCR Master Mix Kit (Vazyme, China). Record the cycling threshold (Ct) for P2RY14 and calculate the P2RY14 mRNA expression in cancer and paracancerous tissues with the 2−ΔΔCt method. All steps of the qRT-PCR were performed according to the reagent instructions and all experiments were repeated three times. The primers used in qRT-PCR protocol are presented in Table 1.

Table 1.

The primers used in qRT-PCR

Gene Forward (5′–3′) Reverse (5′–3′)
P2RY14 AGCTGAACGTGTTTGTGTGC GGAACAGCAAGGAGGAGCAT
GAPDH GACTTCAACAGCAACTCCCAC TCCACCACCCTGTTGCTGTA

Statistical analysis

All statistical analysis was performed in R (version 4.1.0). Standard tests included the Student’s t test, Wilcoxon rank-sum test, and Kruskal–Wallis test. Spearman correlation analysis (“ggcorrplot” R package; version 0.1.4) was used to determine the relationship between the GPR-related genes/TME-i cells. The log-rank test and Cox regression were used to investigate related independent patients’ prognosis classifiers. P < 0.05 was considered statistically significant.

Results

Development of the GPR score based on GPR-related genes in TCGA-UCEC and validation in CPTAC

The schematic diagram of the entire study is depicted in Fig. 1. To develop a method indicative of GPR expression, 533 EC cases from TCGA-UCEC were enrolled. Figure 2A depicts a preliminary screen of DEGs and prognostic genes (univariate Cox analysis, FDR < 0.05). Then, the LASSO regression analysis was performed to narrow down the most robust prognostic genes among the candidate genes by evaluating their risk prediction contributions (Fig. 2B, C). Additional results of principal component analysis (PCA) also demonstrate the different clusters based on the selected risk genes (Supplementary Fig. 1D, E). As shown in Fig. 2D, a multivariate Cox analysis of these genes revealed that 20 GPR-related genes were ultimately involved in GPR score construction. Based on the mean value of the GPR score in the TCGA-UCEC cohort, two subgroups of EC patients were identified. Statistically, patients with low GPR scores had a longer survival rate than patients with high GPR scores (Fig. 2E). The receiver operating characteristic (ROC) curves demonstrated the value of survival prediction with a total area under the curve (AUC) of 0.664 (Fig. 2F). Considering the limited prognostic data regarding ECs, the recognized phenotype “myometrial invasion” was applied for prognostic assessment. In an external cohort, the GPR score was validated as a risk factor for myometrial invasion in ECs (Fig. 2G); and its predictive role for myometrial invasion in the CPTAC cohort was comparable to the former (Fig. 2H; AUC = 0.673 vs. AUC = 0.664). EC samples with higher GPR scores were also significantly enriched for the proliferative phenotype (Fig. 2I, J). In this section, a GPR score for predicting the prognosis of TCGA-UCEC patients was developed, and the underlying function of GPR molecules in ECs was examined.

Fig. 1.

Fig. 1

Schematic diagram portraying the establishment and comprehensive analysis of the GPR-TME classifier. TCGA-UCEC the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma, DEGs differentially expressed genes, GPR G protein-coupled receptor, GEO Gene Expression Omnibus

Fig. 2.

Fig. 2

Development of the GPR score based on GPR-related genes in TCGA-UCEC. A Heatmap shows DEGs and prognostic genes candidates for GPR score construction. B Selection of the optimal λ in the LASSO analysis. C LASSO coefficient profiles of 20 genes in TCGA-UCEC cohort. D Forest plot shows a multivariate Cox analysis of these enrolled genes. E K–M curves for the OS of EC patients in the low- and high-risk subgroups based on the GPR score. F ROC curves demonstrate the predictive efficiency of the GPR score in the TCGA cohort. G Validation of the predictive role of GPR score in CPTAC cohort. H ROC curves demonstrate the predictive efficiency of the GPR score in the CPTAC cohort. I, J GSEA identifies the phenotype differences between the GPR score high and GPR score low subgroups. Significance: *P < 0.05; **P < 0.01. GPR G protein-coupled receptor, TCGA-UCEC the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma, DEGs differentially expressed genes, LASSO Least Absolute Shrinkage and Selection Operator, K–M Kaplan–Meier, OS overall survival, EC endometrial carcinoma, ROC receiver operating characteristic curves, CPTAC Clinical Proteomic Tumor Analysis Consortium, GSEA gene set enrichment analysis

Development of the TME score and correlation between GPR score and TME cells

The CIBERSORT algorithm was applied to quantify 22 immune cells based on transcriptomes of the TCGA-UCEC cohort to generate a TME-based signature. Subsequently, five types of immune cells were identified for their protective roles in overall survival (OS) based on their respective optimum cut-off value. These immune cell types include CD8 T cells, memory-activated CD4 T cells, activated natural killer (NK) cells, follicular helper T (Tfh) cells, and plasma cells (Fig. 3A–E). Figure 3F depicts the multivariate Cox analysis of these immune cells. Contrary to the GPR score, patients with high TME scores showed statistically longer survival than patients with low TME scores (Fig. 3G). GSEA further identified the potential differences between the TME subgroups, implying intercellular communication is more vibrant among the TME high tumors (Fig. 3H). The correlation analysis illustrates the connections between GPR expression and immune infiltrations (Fig. 3I). To further delineate the GPR score status in single cell clusters, scRNA sequencing data of MSI-H/MMR-d EC was enrolled (extra data are available in Supplementary Fig. 2). Figure 3J depicts the immune landscape of MSI‑H/MMR‑d EC. In contrast, Fig. 3K depicts the GPR score of each immune cell cluster, with plasmacytoid DCs (pDCs) and NKT presenting a seemingly higher level of GPR expression. This section established a TME score and clarified the relationship between the GPR score and immune cells.

Fig. 3.

Fig. 3

Development of the TME score and correlation analysis for GPR score and TME cells. K–M curves for the OS of EC patients in low- and high-CD8 T cell A memory activated CD4 T cell B activated NK cell C follicular helper T cell D, and plasma cell E subgroups. F Forest plot shows a multivariate Cox analysis of these immune cells. G K-M curves for the OS of EC patients in the low- and high-TME score subgroups. H GSEA identifies the phenotype differences between the TME score high and TME score low subgroups. I Correlation analysis shows the relationship between the GPR and TME score components. J Immune cell clusters of MSI-H/MMR-d EC. K GPR score counted in each immune cell cluster. TME tumor environment, GPR G protein-coupled receptor, K–M Kaplan–Meier, OS overall survival, EC endometrial carcinoma, CD cluster of differentiation, NK natural killer, GSEA gene set enrichment analysis, MSI-H/MMR-d microsatellite instability-high/mismatch repair-deficiency, pDCs plasmacytoid DCs, NKT natural killer T, Treg regulatory T cell

Prognostic value and functional annotation of the established GPR-TME classifier

Based on the findings, we questioned whether it would be possible to combine the GPR and TME scores to construct a GPR-TME classifier for joint assessment. After combination, four subgroups were generated: GRP_low + TME_high, GPR_low + TME_low, GPR_high + TME_high, and GPR_high + TME_low. The GPR-TME classifier presented a statistically different prognosis in the TCGA-UCEC cohort (Fig. 4A). Notably, EC cases in the GRP_low + TME_high subgroup had the best prognosis compared to cases from the other three subgroups. The predictive ability of the GPR-TME classifier on OS was evaluated using time-dependent ROC curves. The AUC was 0.769 for three years, 0.790 for five years, and 0.889 for seven years, as shown in Fig. 4B. To further elucidate the significant differences in survival, WGCNA was applied for exploring the gene variations among these subgroups (Supplementary Fig. 1). The “blue” and “yellow” modules were then distinguished for the most significant variations between GPR_high + TME_low and GRP_low + TME_high subgroups (Fig. 4C). The gene clusters representing “blue” and “yellow” modules were then submitted to the online tool Metascape for functional annotation. Cell pre-filtration-related items were enriched in the GPR_high + TME_low subgroup, while immune cell activation-related items were gathered in GRP_low + TME_high subgroups (Fig. 4D, E). To determine whether GPR status could affect the function of immune cells, we analyzed intercellular communication. Based on the findings derived from Fig. 3K, pDCs, and NKT cells were selected for analysis. The number of interactions and interaction strength of intercellular communication are depicted in Fig. 4F, G, respectively. Figure 4H, I demonstrate that immune cells (pDCs and NKT cells) with high expression of GPR have less intercellular signaling activation. Overall, for this section, a GPR-TME classifier was constructed by combining GPR and TME scores. Then by using multiple bioinformatics tools, the functional differences between four subgroups were investigated.

Fig. 4.

Fig. 4

Prognostic value, cellular signaling pathways, and intercellular communication analysis based on GPR-TME classifier. A K–M curve for the OS of EC patients in the GRP_low + TME_high, GPR_low + TME_low, GPR_high + TME_high, and GPR_high + TME_low subgroups. B Time-dependent ROC curves demonstrate the predictive efficiency of the GPR-TME classifier. C Gene modules derived from WGCNA show the different clusters among four subgroups. D Top 20 annotations collected for GPR_high + TME_low subgroup. E Top 20 annotations collected for GRP_low + TME_high subgroup. F The number of interactions for intercellular communication analysis. G The interaction strength of intercellular communication analysis. H pDCs with high GPR score compromise activation of the cell chatting pathway. I NKT cells with high GPR score compromise activation of the cell chatting pathway. GPR G protein-coupled receptor, TME tumor environment, K-M Kaplan–Meier, OS overall survival, EC endometrial carcinoma, ROC receiver operating characteristic, WGCNA weighted correlation network analysis, pDCs plasmacytoid DCs, NKT natural killer T, AUC area under the curve

Simplification of the GPR-TME classifier and association between GPR-TME classifier with clinical features

To simplify the GPR-TME classifier for clinical application, GPR_low + TME_low and GPR_high + TME_high subgroups were merged due to their less divergence. Figure 5A depicts the K-M curves for the OS of EC patients after combination. As shown in Fig. 5B, C, the GPR-TME classifier exhibited a significant correlation with the OS of EC patients (HR 2.60, 95% confidence interval (CI) 1.72–3.80; P < 0.001; refer to multivariate Cox analysis). These findings suggest that the GPR-TME classifier, constructed using the TCGA-UCEC cohort, was an independent prognostic factor for EC patients. Interestingly, the simplified GPR-TME classifier exhibited a quite decent predictive efficacy regardless of age, tumor grade, and stage (Fig. 5D). Fast GSEA for simplified subgroups revealed significant differences in biological process enrichment (Fig. 6A), which is similar to the Metascape functional annotation. TIP analysis was performed on an expression matrix containing ten cases from each subgroup to track the tumor immunophenotype. The TIP analysis results were then visualized using a heatmap, as shown in Fig. 6B. Fourteen immune cells infiltration atlas for individual patient (N = 30) are presented in Fig. 6C. We simplified the GPR-TME classifier for clinical use and clarified the relationship between the GPR-TME classifier and clinical characteristics.

Fig. 5.

Fig. 5

Simplification of the GPR-TME classifier for clinical application. A K–M curve for the OS of EC patients in the GRP_low + TME_high, Mixed, and GPR_high + TME_low subgroups. B Forest plot of univariate analysis shows the simplified GPR-TME classifier possesses a better-predicting efficacy than clinical parameters. C Forest plot of multivariate analysis shows the simplified GPR-TME classifier is an independent prognostic factor for EC patients. D K-M curves for the simplified GPR-TME classifier present statistically significant discriminations regardless of age, tumor grade, and stage. Significance: *P < 0.05; ***P < 0.001. GPR G protein-coupled receptor, TME tumor environment, K–M Kaplan–Meier, OS overall survival, EC endometrial carcinoma

Fig. 6.

Fig. 6

Immune characteristic of GPR-TME classifier demonstrated in different subgroups. A Fast GSEA for the simplified GPR-TME classifier. B TIP analysis for the simplified GPR-TME classifier. C Fourteen immune cells infiltration atlas of individual patient (n = 30) from TIP analysis. GPR G protein-coupled receptor, TME tumor environment, GSEA gene set enrichment analysis, TIP Tracking Tumor Immunophenotype

Differential patterns of tumor somatic mutations in patients among GPR-TME subgroups

We next examined the tumor somatic alterations among different GPR-TME subgroups. The top 20 variant mutations in the TCGA-UCEC cohort were identified (Fig. 7A, B). The tumor somatic mutation landscapes differ between groups. TP53, PIK3CA, and PTEN mutations rank top three in the GPR_high + TME_low subgroup; while PTEN, ARID1A, and PIK3CA mutations rank top three in the GPR_low + TME_high subgroup. Compared to Fig. 7A, B, the GPR_low + TME_high subgroup was distinguished by a higher somatic mutation. Similarly, as depicted in Fig. 6C, the TMB in the GPR_low + TME_high subgroup was significantly higher than those in GPR_high + TME_low and Mixed subgroups. Further examination of the most prevalent mutations among subgroups revealed that PIK3CA expression varied among these subgroups (Fig. 7C). Detailed analysis was performed using K-M curves mixed with TMB (or PIK3CA status) and GPR-TME subgroups. However, neither TMB nor PIK3CA status could successfully optimize the predictive efficacy of the GPR-TME classifier (Fig. 7D).

Fig. 7.

Fig. 7

Association between tumor somatic mutations and GPR-TME classifier. The OncoPrint was constructed by the top 20 mutation genes between GPR_high + TME_low A and GPR_low + TME_high subgroups B. Each EC from an individual patient was represented in each column (TCGA-UCEC). C Comparison of TMB, TP53, PTEN, and PIK3CA expression among defined subgroups according to GPR-TME classifier. D K–M curves of EC patients divided by TMB (or PIK3CA status) and GPR-TME classifier. GPR G protein-coupled receptor, TME tumor environment, TCGA-UCEC the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma, TMB tumor mutational burden, TP53 tumor protein 53, PTEN phosphatase and tensin homolog, PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Distinct immune response profile in tumors among GPR-TME subgroups

The immune response-associated genes among different subgroups were further investigated (Liu et al. 2021a). The GPR_low + TME_high subgroup had a higher expression of most of the inhibitory immune markers (including CTLA4, LAG3, and PDCD1; Fig. 8A) and human leukocyte antigen (HLA) markers (Fig. 8B) than the GPR_high + TME_low and Mixed subgroups. Given these findings, we tested whether the GPR-TME classifier could predict clinical responses in immunotherapies patients. TIDE for predicting immunotherapy response was used to solve this interrogatory. As depicted in Fig. 8C, the GPR_low + TME_high subgroup had the highest percentage (31%) of patients with therapeutic response to an immune checkpoint blockade (ICB), while the GPR_high + TME_low subgroup had only 3%. Patients with EC responding to ICB therapy showed statistically lower GPR scores (Fig. 8D). Similar patterns of Proteomaps are observed in the GPR_low + TME_high subgroup and ICB responder (Fig. 8E). These findings may suggest that the pretreatment GPR-TME classifier can depict the tumor immune microenvironment, thereby enhancing the EC patient's therapy responses prediction.

Fig. 8.

Fig. 8

Comparison of immune-related markers in three subtypes and therapy response prediction based on GPR-TME classifier. A Comparison analysis of the inhibitory immune molecules among subgroups based on the GPR-TME classifier. B Comparison analysis of the HLA molecules among subgroups based on the GPR-TME classifier. C The different percentages of ICB responder among subgroups based on the GPR-TME classifier. D Comparison of GPR scores among patients with different ICB immunotherapy response status. E Functional analysis in GPR_high + TME_low (left) and responder (right) of patients under ICB immunotherapy illustrated using Proteomaps. GPR G protein-coupled receptor, TME tumor environment, HLA human leukocyte antigen, ICB immune checkpoint blockade

Clinical validation for mRNA and protein expression of GRP-related gene

To further explore the potential GPR-related targets regulating the process of EC, the GEO dataset (GSE17025) was enrolled for crossed DEGs filtration. Interestingly, the purinergic receptor encoding gene P2RY14 presents significantly downregulated in EC tissues compared to normal endometrium tissues (Fig. 9A, B). qRT-PCRT’s results derived from twelve pairs of EC tissues and its paracancerous endometrium tissues also shows the similar results suggested by the crossed DEGs (Fig. 9C). In terms of protein level, HPA database was applied for inspecting the different protein expression of P2RY14. Conformably, the IHC staining from HPA database presents quite weak P2RY14 expression in EC glandular tissues compared to normal endometrium glandular (Fig. 9D).

Fig. 9.

Fig. 9

GEO filtration for DEGs of GPR-related genes and validation in clinical tissue samples. A Heatmap of DEGs of GPR-related genes from a GEO cohort (GSE17025). B Volcano plot of DEGs of GPR-related genes intersected by TCGA-UCEC and GEO (GSE17025) cohorts. C qRT-PCR of P2RY14 gene expression in EC samples (cancers vs. paracancerous, n = 12). D Protein expression of P2RY14 in EC and normal endometrium in the HPA database. Significance: *P < 0.05; ***P < 0.001. GEO Gene Expression Omnibus, DEGs differentially expressed genes, GPR G protein-coupled receptor, TCGA-UCEC the Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma, qRT-PCR quantitative real time PCR, EC endometrioid carcinoma, the HPA the Human Protein Atlas

Discussion

The explosion of research on GPR and TME enhances our understanding of the possibility of combining these factors to predict cancer patients' prognosis and therapies (O’Hayre et al. 2014). However, few studies have integrated GPR and TME signatures to predict prognosis and therapeutic responses (Zhao et al. 2022). Signatures based on the combination of GPR and TME may enable clinical classification and therapeutic strategy optimization when targeting GPR combined with immunotherapy for EC treatment. Here, we systematically utilized the TCGA-UCEC cohort to assess the prognostic and therapeutic value of the GPR-TME classifier.

In this study, twenty GPR-related genes were enrolled in our risk signature, including adrenoceptor, prostaglandin receptors, vasoactive intestinal peptide (VIP) receptors, dopamine receptors, lysophosphatidic acid receptors, corticotropin-releasing hormone (CRH) receptors, purinergic receptors, bradykinin receptors, among others. Many of these novel targets have been studied in EC research. Dopamine receptor D2 (DRD2) overexpression in EC was significantly associated with grade, serous histology, stage, and worse progression-free survival and overall survival. While antagonizing DRD2 with ONC201 exhibited significant anti-tumorigenic effects in EC cells and an EC transgenic mouse model (Pierce et al. 2021). DRD2 was reported to promote malignant tumor progression by activating the oxygen-independent hypoxia-inducible factor-1α (HIF-1α) pathway in response to psychologic stress (Liu et al. 2021b). Similarly, CRHR1 was identified as an independent prognostic factor for EC in disease-free survival (DFS) and OS (Sato et al. 2014). A subfamily of adhesion GPRs in EC was recently thoroughly analyzed, and ADGRF1 was highlighted for its dual role in prognosis prediction and immune infiltrating evaluation (Lei et al. 2022). Purinergic receptors, the most common GPRs in the current model, play critical roles in various cancers. Purinergic receptor P2Y2 (P2RY2) activation has been reported to promote tumor cell proliferation via multiple downstream signaling pathways (Zaparte et al. 2021; Dong et al. 2022). The P2RY2 enhancer RNA (P2RY2e) has been validated as an estrogen-responsive eRNA and has been involved in the development of breast cancer and the progression of bladder cancer (Ding et al. 2018). Given that EC is an estrogen-related malignancy, we suggested that enhanced expression of P2RY2 induced by unopposed estrogenic stimulation may also promote the progression of EC. Conversely, down-regulation of P2RY14 in head and neck squamous cell carcinoma (HNSC) patients was associated with poor prognosis and reduced immune infiltration, indicating a conversion from immune-dominant to metabolic-dominant status (Li et al. 2021). The down-regulation of P2RY14 in TME of EC needs further investigation, as confirmed by the GEO dataset and clinical tissue samples (Fig. 9). Many GPRs in the galectin (GAL) subfamily were associated with immune suppression and regulated cytotoxicity T cell fate (Cagnoni et al. 2021; Yang et al. 2021), highlighting potential therapeutic targets for cancer immunotherapy. GPR132 mediates tumor-macrophage interactions to promote the alternatively activated M2-like phenotype by detecting lactate in the acidic tumor microenvironment. This facilitates cancer cell adhesion, migration, and invasion (Chen et al. 2017). Overall, research focusing on GPR functions and their interaction with tumor immune microenvironment has the potential to broaden the horizons of cancer immunology.

For the other part of the classifier, the TME score also exerts its critical role in cancer control. This model identified CD8 T cells, memory-activated CD4 T cells, activated NK cells, Tfh cells, and plasma cells as EC TME protectors. The anti-cancer effect of CD8 T cells, activated CD4 T cells, and activated NK cells have been verified in multiple cancers. Since in-depth research has been conducted on antitumor immunity, the function of Tfh cells and plasma cells in TME has emerged gradually. Tfh cells not only function in shaping B cell response during germinal center formation (Hollern et al. 2019) but also exert an antitumor immune effect in a CD8+-dependent manner. Tfh cells restore the exhausted T cells’ cytotoxic functions by producing interleukin-21 (IL-21), thereby enhancing the anti-PD-L1/PD-1 efficacy (Niogret et al. 2021). Plasma cells secrete specific antibodies into tumor niche as executors of humoral immunity. A recent study in EC has demonstrated that polymeric immunoglobulin receptor (pIgR) dependent, antigen-independent IgA occupancy triggers the activation of interferon (IFN) and tumor necrosis factor (TNF) signaling pathway in tumor cells. This activation is accompanied by apoptotic and endoplasmic reticulum stress downstream while hindering the DNA repair mechanisms (Mandal et al. 2022). After reannotating the EC scRNA sequencing dataset with MSI‑H/MMR‑d (Guo et al. 2022), the GPR score was significantly elevated in pDC and NKT cells. The intercellular communication analysis revealed impaired cell-chatting function in these GPR-elevated cells. Jiang et al. recently depicted that single-cell profiling of the immune atlas of tumor-infiltrating lymphocytes (TILs) in EC (Jiang et al. 2022). There was a cluster of NKT cells in their TILs atlas; however, the specific functions of this cluster have not been thoroughly analyzed yet.

Throughout the study, EC patients in the GPR_low + TME_high subgroup exhibited the most favorable prognosis and clinical responses to ICB treatment. The time-dependent ROC curves confirmed the sensibility and specificity of this risk signature. When merged for simplification, the GPR-TME classifier was identified as an independent prognostic factor for EC patients. This classifier’s OS predictive value was independent of the patient’s age, tumor grade, and stage, indicating a stable prediction efficiency. Moreover, multiple algorithms methods for functional annotation revealed different biological process enrichment among GPR-TME subgroups. This may imply that the host tumor profiles of the various GPR-TME subgroups share certain common characteristics. The results of tumor somatic mutations analysis revealed subtle correlations between the molecular subtyping of EC and the GPR-TME subgroup. The frequent TP53 mutations observed in the GPR_high + TME_low subgroup suggest a large body of copy number high (CN-H) molecular subtyping in this cluster. This corresponds to higher cell proliferation potentials and poor prognosis (Kandoth et al. 2013; Talhouk et al. 2015). Conversely, the GPR_low + TME_high subgroup indicated more common PTEN and ARID1A mutations suggesting potential association with other molecular subtypes (Kandoth et al. 2013; Stelloo et al. 2016). Further studies are needed to elucidate this vague relationship.

Immunotherapy has presented clinical efficacy in some patients with gynecological malignancies (Taha et al. 2020), primarily employed for advanced and recurrent cases that have failed conventional treatment. Among the three major gynecological malignancies, EC is the most curable. Currently, the evidence of ICIs application in advanced/recurrent EC mainly comes from the KEYNOTE series clinical trials of Pembrolizumab (KEYNOTE-016, KEYNOTE-158, KEYNOTE-028) (Ott et al. 2017; Le et al. 2015; O'Malley et al. 2022). The objective response rate (ORR) for Pembrolizumab in EC patients with MSI-H/dMMR ranged from 53.0% to 57.1% in the KEYNOTE trials. Similarly, the ORR for Nivolumab and Dostarlimab-gxly in EC patients with dMMR was over 40% in the EAY131 (Azad et al. 2020) and GARNET (Oaknin et al. 2022b) studies. These studies provide additional support using PD-1/PD-L1 mAbs in previously treated patients with MSI-H/dMMR advanced/recurrent EC. Notably, MSI-H/dMMR patients are the primary recipients of ICIs. However, only approximately 25% of EC patients have MSI-H/dMMR aberrance (Stelloo et al. 2016). This indicates that it is unclear whether immunotherapy will benefit the remaining patients. In our GPR-TME classifier, over 30% of patients in the GPR_low + TME_high subgroup were successfully predicted to benefit from immunotherapy regardless of the molecular subtyping. In contrast, merely 3% of GPR_high + TME_low patients were predicted to respond to ICB treatment, which is discouraged for immunotherapy.

Finally, we acknowledge certain limitations to this study. Firstly, the lack of survival data for EC necessitates the inclusion of more cohorts, particularly the in-house cohort, to further assess the performance of this classifier. Secondly, the GPR-TME signatures require additional validation using experimental methods.

Conclusions

To our knowledge, this is the first comprehensive study conferring GPRs on a novel role in EC immune infiltration. In our study, depicting the integrated GPRs and immune cell landscape signatures within the TME may benefit the prediction of the EC patients’ prognosis and immunotherapy responses. It might be a potential method for prognosis assessment and stratification of EC patients for clinical management in practice.

Supplementary Information

Below is the link to the electronic supplementary material.

432_2023_5270_MOESM1_ESM.tif (1.2MB, tif)

Supplementary Figure 1. WGCNA for GPR-TME subgroups and PCA for GPR score evaluation. A, B The soft threshold for WGCNA (sft = 20). C Cluster dendrogram of five modules. D PCA evaluation for all GPR-related genes. E PCA evaluation for GPR score. WGCNA, weighted correlation network analysis; sft, soft threshold; GPR, G protein-coupled receptor; TME, tumor environment; PCA: principal component analysis. (TIF 1214 KB)

432_2023_5270_MOESM2_ESM.tif (1.3MB, tif)

Supplementary Figure 2. Scrna Sequencing Analysis For One Case Of MSI‑H/MMR‑D EC Sample. (A, B) PCA For The MSI‑H/MMR‑D EC Sample. (C) UMAP Of 11 Clusters Of Cells For The MSI‑H/MMR‑D EC Sample. (D, E) Reannotation Of 11 Clusters Of Cells For The MSI‑H/MMR‑D EC Sample. Scrna, Single Cell RNA; MSI‑H/MMR‑D, Micro Satellite Instability-High/Mis-Match Repair-Deficiency; EC, Endometrial Carcinoma; PCA, Principal Component Analysis; UMAP, Uniform Manifold Approximation And Projection. (TIF 1326 KB)

Acknowledgements

Here, we would like to express our utmost appreciation to TCGA and GEO projects. We also appreciate the team members at Bioinfo_composer, the leading bioinformatics platform in China, for their selfless help. Moreover, we thank Home for Researchers editorial team (www.home-for-researchers.com) for language editing service.

Abbreviations

EC

Endometrial carcinoma

GPRs

G protein-coupled receptors

LASSO

Least Absolute Shrinkage and Selection Operator

DEGs

Differentially expressed genes

TCGA

The Cancer Genome Atlas

WGCNA

Weighted correlation network analysis

TIDE

Tumor Immune Dysfunction and Exclusion

TMB

Tumor mutation burden

MSI

Microsatellite instability

HCC

Hepatocellular carcinoma

SPL

S1P lyase

LPI

Sphingolipids

LPG

Glycerophospholipids

A2AR

A2A receptors

DCs

Dendritic cells

PD-L1

Programmed cell death ligand 1

LUAD

Lung adenocarcinoma

ICIs

Immune checkpoint inhibitors

LPAR6

Lysophosphatidic acid receptor 6

scRNA

Single-cell RNA

MSI-H/MMR-d

Micro satellite instability-high/mis-match repair-deficiency

GEO

Gene Expression Omnibus

TIP

Tracking Tumor Immunophenotype

MSigDB

Molecular Signatures Database

TCGA-UCEC

The Cancer Genome Atlas-Uterine Corpus Endometrioid Carcinoma

TME-I

Tumor immune microenvironment

ssGSEA

Single-sample gene set enrichment analysis

NK

Natural killer

Tfh

Follicular helper T

OS

Overall survival

pDCs

Plasmacytoid DCs

PCA

Principal component analysis

ROC

Receiver operating characteristic

AUC

Area under the curve

CI

Confidence interval

HLA

Human leukocyte antigen

ICB

Immune checkpoint blockade

VIP

Vasoactive intestinal peptide

CRH

Corticotropin-releasing hormone

DRD2

Dopamine receptor D2

HIF-1α

Hypoxia-inducible factor-1α

DFS

Disease-free survival

P2RY2

Purinergic receptor P2Y2

HNSC

Head and neck squamous cell carcinoma

GAL

Galectin

IL-21

Interleukin-21

pIgR

Polymeric immunoglobulin receptor

IFN

Interferon

TNF

TILs: Tumor-infiltrating lymphocytes

CN-H

Copy number high

ORR

Objective response rate

CPTAC

Clinical Proteomic Tumor Analysis Consortium

Author contributions

Conception and design was contributed by JM and BY; development of methodology was contributed by SC, XL, and JZ; data acquisition was contributed by JM and JZ; analysis was contributed by SC, XL, and JG; interpretation of results was contributed by SC and JZ; writing, revision, and review of the manuscript were contributed by SC, XL, JG, and JZ; sample collection and experiments were contributed by BY and YZ; JM contributed to study supervision.

Funding

This work was supported by the Science and Technology of the People's Livelihood Project of Jiaxing City (Grant number 2022AY30022).

Data availability

The RNA-seq data and corresponding clinical information were observed from TCGA (https://portal.gdc.cancer.gov/) and GEO (https://www.ncbi.nlm.nih.gov/geo/); scRNA sequencing data were obtained from GEO (https://www.ncbi.nlm.nih.gov/geo/). The accession number(s) can be found in the article/Supplementary Material.

Declarations

Competing interests

The authors declare no competing interests.

Conflict of interest

The authors have no relevant financial or non-financial interests to disclose.

Human and animal participants

This article does not contain any studies with human participants or animals performed by any of the authors.

Ethics statement

The studies involving human participants were reviewed and approved by Jiaxing University Affiliated Women and Children Hospital (no. 2018-101). The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Shengyue Chen, Xukai Luo and Baicai Yang contributed equally to this work.

References

  1. Azad NS, Gray RJ, Overman MJ, Schoenfeld JD, Mitchell EP, Zwiebel JA et al (2020) Nivolumab is effective in mismatch repair-deficient noncolorectal cancers: results from arm Z1D-A subprotocol of the NCI-MATCH (EAY131) Study. J Clin Oncol 38(3):12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bai R, Zhang J, He F, Li Y, Dai P, Huang Z et al (2022) GPR87 promotes tumor cell invasion and mediates the immunogenomic landscape of lung adenocarcinoma. Commun Biol 5(1):663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bar-Shavit R, Maoz M, Kancharla A, Nag JK, Agranovich D, Grisaru-Granovsky S et al (2016) G protein-coupled receptors in cancer. Int J Mol Sci 17(8):1320 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bokhman JV (1983) Two pathogenetic types of endometrial carcinoma. Gynecol Oncol 15(1):8 [DOI] [PubMed] [Google Scholar]
  5. Brinton LA, Felix AS, McMeekin DS, Creasman WT, Sherman ME, Mutch D et al (2013) Etiologic heterogeneity in endometrial cancer: evidence from a Gynecologic Oncology Group trial. Gynecol Oncol 129(2):277–284 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Brown TP, Bhattacharjee P, Ramachandran S, Sivaprakasam S, Ristic B, Sikder MOF et al (2020) The lactate receptor GPR81 promotes breast cancer growth via a paracrine mechanism involving antigen-presenting cells in the tumor microenvironment. Oncogene 39(16):3292–3304 [DOI] [PubMed] [Google Scholar]
  7. Cagnoni AJ, Giribaldi ML, Blidner AG, Cutine AM, Gatto SG, Morales RM et al (2021) Galectin-1 fosters an immunosuppressive microenvironment in colorectal cancer by reprogramming CD8(+) regulatory T cells. Proc Natl Acad Sci USA. 10.1073/pnas.2102950118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cancer Genome Atlas Research N, Kandoth C, Schultz N, Cherniack AD, Akbani R, Liu Y et al (2013) Integrated genomic characterization of endometrial carcinoma. Nature 497(7447):67–73 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen P, Zuo H, Xiong H, Kolar MJ, Chu Q, Saghatelian A et al (2017) Gpr132 sensing of lactate mediates tumor-macrophage interplay to promote breast cancer metastasis. Proc Natl Acad Sci USA 114(3):580–585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen B, Khodadoust MS, Liu CL, Newman AM, Alizadeh AA (2018) Profiling tumor infiltrating immune cells with CIBERSORT. Methods Mol Biol 1711:243–259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crosbie EJ, Kitson SJ, McAlpine JN, Mukhopadhyay A, Powell ME, Singh N (2022) Endometrial cancer. Lancet 399(10333):1412–1428 [DOI] [PubMed] [Google Scholar]
  12. Day RS, McDade KK, Chandran UR, Lisovich A, Conrads TP, Hood BL et al (2011) Identifier mapping performance for integrating transcriptomics and proteomics experimental results. BMC Bioinformatics 12:14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ding M, Zhan H, Liao X, Li A, Zhong Y, Gao Q et al (2018) Enhancer RNA—P2RY2e induced by estrogen promotes malignant behaviors of bladder cancer. Int J Biol Sci 14(10):1268–1276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dong CR, Hu DX, Liu SC, Luo HL, Zhang WJ (2022) AKT/GSK-3beta/VEGF signaling is involved in P2RY2 activation-induced the proliferation and metastasis of gastric cancer. Carcinogenesis 44:65–79 [DOI] [PubMed] [Google Scholar]
  15. Dou Y, Kawaler EA, CuiZhou D, Gritsenko MA, Huang C, Blumenberg L et al (2020) Proteogenomic characterization of endometrial carcinoma. Cell 180(4):729-48e26 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ge YJ, Liao QW, Xu YC, Zhao Q, Wu BL, Ye RD (2020) Anti-inflammatory signaling through G protein-coupled receptors. Acta Pharmacol Sin 41(12):1531–1538 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Guo YE, Liu Y, Zhang W, Luo H, Shu P, Chen G et al (2022) The clinicopathological characteristics, prognosis and immune microenvironment mapping in MSI-H/MMR-D endometrial carcinomas. Discov Oncol 13(1):12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. He YY, Cai B, Yang YX, Liu XL, Wan XP (2009) Estrogenic G protein-coupled receptor 30 signaling is involved in regulation of endometrial carcinoma by promoting proliferation, invasion potential, and interleukin-6 secretion via the MEK/ERK mitogen-activated protein kinase pathway. Cancer Sci 100(6):1051–1061 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. He YY, Du GQ, Cai B, Yan Q, Zhou L, Chen XY et al (2012) Estrogenic transmembrane receptor of GPR30 mediates invasion and carcinogenesis by endometrial cancer cell line RL95-2. J Cancer Res Clin Oncol 138(5):775–783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. He J, Gao R, Meng M, Yu M, Liu C, Li J et al (2021) Lysophosphatidic Acid Receptor 6 (LPAR6) Is a potential biomarker associated with lung adenocarcinoma. Int J Environ Res Public Health 18(21):11038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. He J, Meng M, Wang H (2022) A novel prognostic biomarker LPAR6 in hepatocellular carcinoma via associating with immune infiltrates. J Clin Transl Hepatol 10(1):90–103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hollern DP, Xu N, Thennavan A, Glodowski C, Garcia-Recio S, Mott KR et al (2019) B Cells and T follicular helper cells mediate response to checkpoint inhibitors in high mutation burden mouse models of breast cancer. Cell 179(5):1191–20621 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huvila J, Pors J, Thompson EF, Gilks CB (2021) Endometrial carcinoma: molecular subtypes, precursors and the role of pathology in early diagnosis. J Pathol 253(4):355–365 [DOI] [PubMed] [Google Scholar]
  24. Jiang P, Gu S, Pan D, Fu J, Sahu A, Hu X et al (2018) Signatures of T cell dysfunction and exclusion predict cancer immunotherapy response. Nat Med 24(10):1550–1558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Jiang F, Jiao Y, Yang K, Mao M, Yu M, Cao D et al (2022) Single-cell profiling of the immune atlas of tumor-infiltrating lymphocytes in endometrial carcinoma. Cancers (basel) 14(17):4311 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kuo CC, Wu JY, Wu KK (2022) Cancer-derived extracellular succinate: a driver of cancer metastasis. J Biomed Sci 29(1):93 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Langfelder P, Horvath S (2008) WGCNA: an R package for weighted correlation network analysis. BMC Bioinform 9:559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Le DT, Uram JN, Wang H, Bartlett BR, Kemberling H, Eyring AD et al (2015) PD-1 blockade in tumors with mismatch-repair deficiency. N Engl J Med 372(26):2509–2520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lei P, Wang H, Yu L, Xu C, Sun H, Lyu Y et al (2022) A correlation study of adhesion G protein-coupled receptors as potential therapeutic targets in Uterine Corpus Endometrial cancer. Int Immunopharmacol 108:108743 [DOI] [PubMed] [Google Scholar]
  30. Li Q, Xu L, Li Y, Yang R, Qiao Q, Wang Y et al (2021) P2RY14 is a potential biomarker of tumor microenvironment immunomodulation and favorable prognosis in patients with head and neck cancer. Front Genet 12:670746 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li H, Wang J, Li L, Zhao L, Wang Z (2023) Expression of EMT-related genes in lymph node metastasis in endometrial cancer: a TCGA-based study. World J Surg Oncol 21(1):55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P (2015) The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst 1(6):417–425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liebermeister W, Noor E, Flamholz A, Davidi D, Bernhardt J, Milo R (2014) Visual account of protein investment in cellular functions. Proc Natl Acad Sci USA 111(23):8488–8493 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu JH, Meng HY, Nie SP, Sun Y, Jiang PP, Li SY et al (2020) Identification of a prognostic signature of epithelial ovarian cancer based on tumor immune microenvironment exploration. Genomics 112(6):4827–4841 [DOI] [PubMed] [Google Scholar]
  35. Liu JH, Chen C, Wang YC, Qian C, Wei JT, Xing Y et al (2021a) Comprehensive of N1-methyladenosine modifications patterns and immunological characteristics in ovarian cancer. Front Immunol 12:746647 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liu H, Yang J, Zhang Y, Han J, Yang Y, Zhao Z et al (2021b) Psychologic stress drives progression of malignant tumors via DRD2/HIF1alpha signaling. Cancer Res 81(20):5353–5365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Liu JH, Geng R, Ni SM, Cai LX, Yang S, Shao F et al (2022) Pyroptosis-related lncRNAs are potential biomarkers for predicting prognoses and immune responses in patients with UCEC. Mol Ther Nucleic Acids 27:1036–1055 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Makker V, Rasco D, Vogelzang NJ, Brose MS, Cohn AL, Mier J et al (2019) Lenvatinib plus pembrolizumab in patients with advanced endometrial cancer: an interim analysis of a multicentre, open-label, single-arm, phase 2 trial. Lancet Oncol 20(5):711–718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mandal G, Biswas S, Anadon CM, Yu X, Gatenbee CD, Prabhakaran S et al (2022) IgA-dominated humoral immune responses govern patients’ outcome in endometrial cancer. Cancer Res 82(5):859–871 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. McAlpine J, Leon-Castillo A, Bosse T (2018) The rise of a novel classification system for endometrial carcinoma; integration of molecular subclasses. J Pathol 244(5):538–549 [DOI] [PubMed] [Google Scholar]
  41. Mori D, Tsujikawa T, Sugiyama Y, Kotani SI, Fuse S, Ohmura G et al (2021) Extracellular acidity in tumor tissue upregulates programmed cell death protein 1 expression on tumor cells via proton-sensing G protein-coupled receptors. Int J Cancer 149(12):2116–2124 [DOI] [PubMed] [Google Scholar]
  42. Niogret J, Berger H, Rebe C, Mary R, Ballot E, Truntzer C et al (2021) Follicular helper-T cells restore CD8(+)-dependent antitumor immunity and anti-PD-L1/PD-1 efficacy. J Immunother Cancer 9(6):e002157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Oaknin A, Bosse TJ, Creutzberg CL, Giornelli G, Harter P, Joly F et al (2022a) Endometrial cancer: ESMO Clinical Practice Guideline for diagnosis, treatment and follow-up. Ann Oncol 33(9):860–877 [DOI] [PubMed] [Google Scholar]
  44. Oaknin A, Gilbert L, Tinker AV, Brown J, Mathews C, Press J et al (2022b) Safety and antitumor activity of dostarlimab in patients with advanced or recurrent DNA mismatch repair deficient/microsatellite instability-high (dMMR/MSI-H) or proficient/stable (MMRp/MSS) endometrial cancer: interim results from GARNET-a phase I, single-arm study. J Immunother Cancer 10(1):e003777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. O’Hayre M, Degese MS, Gutkind JS (2014) Novel insights into G protein and G protein-coupled receptor signaling in cancer. Curr Opin Cell Biol 27:126–135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. O’Malley DM, Bariani GM, Cassier PA, Marabelle A, Hansen AR, De Jesus AA et al (2022) Pembrolizumab in patients with microsatellite instability-high advanced endometrial cancer: results from the KEYNOTE-158 Study. J Clin Oncol 40(7):11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Orduna-Castillo LB, Del-Rio-Robles JE, Garcia-Jimenez I, Zavala-Barrera C, Beltran-Navarro YM, Hidalgo-Moyle JJ et al (2022) Calcium sensing receptor stimulates breast cancer cell migration via the Gbetagamma-AKT-mTORC2 signaling pathway. J Cell Commun Signal 16(2):239–252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ott PA, Bang YJ, Berton-Rigaud D, Elez E, Pishvaian MJ, Rugo HS et al (2017) Safety and antitumor activity of pembrolizumab in advanced programmed death ligand 1–positive endometrial cancer: results from the KEYNOTE-028 study. J Clin Oncol 35(22):9 [DOI] [PubMed] [Google Scholar]
  49. Pierce SR, Fang Z, Yin Y, West L, Asher M, Hao T et al (2021) Targeting dopamine receptor D2 as a novel therapeutic strategy in endometrial cancer. J Exp Clin Cancer Res 40(1):61 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Pillai S, Mahmud I, Mahar R, Griffith C, Langsen M, Nguyen J et al (2022) Lipogenesis mediated by OGR1 regulates metabolic adaptation to acid stress in cancer cells via autophagy. Cell Rep 39(6):110796 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sato N, Takagi K, Suzuki T, Miki Y, Tanaka S, Nagase S et al (2014) Immunolocalization of corticotropin-releasing hormone (CRH) and its receptors (CRHR1 and CRHR2) in human endometrial carcinoma: CRHR1 as a potent prognostic factor. Int J Gynecol Cancer 24(9):1549–1557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Stelloo E, Nout RA, Osse EM, Jurgenliemk-Schulz IJ, Jobsen JJ, Lutgens LC et al (2016) Improved risk assessment by integrating molecular and clinicopathological factors in early-stage endometrial cancer-combined analysis of the PORTEC cohorts. Clin Cancer Res 22(16):4215–4224 [DOI] [PubMed] [Google Scholar]
  53. Sun C, Wang B, Hao S (2022) Adenosine-A2A receptor pathway in cancer immunotherapy. Front Immunol 13:837230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71(3):209–249 [DOI] [PubMed] [Google Scholar]
  55. Taha T, Reiss A, Amit A, Perets R (2020) Checkpoint inhibitors in gynecological malignancies: are we there yet? BioDrugs 34(6):749–762 [DOI] [PubMed] [Google Scholar]
  56. Talhouk A, McConechy MK, Leung S, Li-Chang HH, Kwon JS, Melnyk N et al (2015) A clinically applicable molecular-based classification for endometrial cancers. Br J Cancer 113(2):299–310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Talhouk A, McConechy MK, Leung S, Yang W, Lum A, Senz J et al (2017) Confirmation of ProMisE: a simple, genomics-based clinical classifier for endometrial cancer. Cancer 123(5):802–813 [DOI] [PubMed] [Google Scholar]
  58. Uranbileg B, Kurano M, Kano K, Sakai E, Arita J, Hasegawa K et al (2022) Sphingosine 1-phosphate lyase facilitates cancer progression through converting sphingolipids to glycerophospholipids. Clin Transl Med 12(9):e1056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wang H, Wang X, Xu L, Zhang J, Cao H (2020) High expression levels of pyrimidine metabolic rate-limiting enzymes are adverse prognostic factors in lung adenocarcinoma: a study based on The Cancer Genome Atlas and Gene Expression Omnibus datasets. Purinergic Signal 16(3):347–366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Xu L, Deng C, Pang B, Zhang X, Liu W, Liao G et al (2018) TIP: a web server for resolving tumor immunophenotype profiling. Cancer Res 78(23):6575–6580 [DOI] [PubMed] [Google Scholar]
  61. Yang R, Sun L, Li CF, Wang YH, Yao J, Li H et al (2021) Galectin-9 interacts with PD-1 and TIM-3 to regulate T cell death and is a target for cancer immunotherapy. Nat Commun 12(1):832 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zaparte A, Cappellari AR, Brandao CA, de Souza JB, Borges TJ, Kist LW et al (2021) P2Y(2) receptor activation promotes esophageal cancer cells proliferation via ERK1/2 pathway. Eur J Pharmacol 891:173687 [DOI] [PubMed] [Google Scholar]
  63. Zhang F, Peng L, Huang Y, Lin X, Zhou L, Chen J (2019) Chronic BDE-47 exposure aggravates malignant phenotypes and chemoresistance by activating ERK through ERalpha and GPR30 in endometrial carcinoma. Front Oncol 9:1079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhang XW, Li L, Hu WQ, Hu MN, Tao Y, Hu H et al (2022) Neurokinin-1 receptor promotes non-small cell lung cancer progression through transactivation of EGFR. Cell Death Dis 13(1):41 [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Zhao L, Zhang H, Liu X, Xue S, Chen D, Zou J et al (2022) TGR5 deficiency activates antitumor immunity in non-small cell lung cancer via restraining M2 macrophage polarization. Acta Pharm Sin B 12(2):787–800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhou Y, Zhou B, Pache L, Chang M, Khodabakhshi AH, Tanaseichuk O et al (2019) Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10(1):1523 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

432_2023_5270_MOESM1_ESM.tif (1.2MB, tif)

Supplementary Figure 1. WGCNA for GPR-TME subgroups and PCA for GPR score evaluation. A, B The soft threshold for WGCNA (sft = 20). C Cluster dendrogram of five modules. D PCA evaluation for all GPR-related genes. E PCA evaluation for GPR score. WGCNA, weighted correlation network analysis; sft, soft threshold; GPR, G protein-coupled receptor; TME, tumor environment; PCA: principal component analysis. (TIF 1214 KB)

432_2023_5270_MOESM2_ESM.tif (1.3MB, tif)

Supplementary Figure 2. Scrna Sequencing Analysis For One Case Of MSI‑H/MMR‑D EC Sample. (A, B) PCA For The MSI‑H/MMR‑D EC Sample. (C) UMAP Of 11 Clusters Of Cells For The MSI‑H/MMR‑D EC Sample. (D, E) Reannotation Of 11 Clusters Of Cells For The MSI‑H/MMR‑D EC Sample. Scrna, Single Cell RNA; MSI‑H/MMR‑D, Micro Satellite Instability-High/Mis-Match Repair-Deficiency; EC, Endometrial Carcinoma; PCA, Principal Component Analysis; UMAP, Uniform Manifold Approximation And Projection. (TIF 1326 KB)

Data Availability Statement

The RNA-seq data and corresponding clinical information were observed from TCGA (https://portal.gdc.cancer.gov/) and GEO (https://www.ncbi.nlm.nih.gov/geo/); scRNA sequencing data were obtained from GEO (https://www.ncbi.nlm.nih.gov/geo/). The accession number(s) can be found in the article/Supplementary Material.


Articles from Journal of Cancer Research and Clinical Oncology are provided here courtesy of Springer

RESOURCES