Table 1.
Summary of included studies (see Supplementary Material S4 for complete data extraction table).
| Study | Year | Location | Population Size | Age | Gender | Sample Type | Matching Factor | Sample Preservative |
Extraction Method | Sequencing Platform | Sequenced Regions | Forward Primer | Reverse Primer | Data Availability |
Main Microbiota Finding |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| [38] | 2019 | Finland | 128 (64 case, 64 control) | case: 65.2 ± 5.52/control: 64.45 ± 6.9; (years, mean ±SD) | Female: case: 48.6%/control: 50.0% | stool | age, sex | DNA stabilizer PSP (Spin Stool DNA Plus Kit, STRATEC Molecular) | PSP Spin Stool DNA Plus Kit (STRATEC Molecular) | Illumina MiSeq | V3–V4 | 341F1–4 (5′ CCTACGGGNGGCWGCAG 3′) | 785R1–4 (5′ GACTACHVGGGTATCTAATCC 3′) | PRJEB27564 | Significant differences in gut microbiota between cases and controls. Disease progression did not influence gut microbiota. No difference in Firmicutes/Bacteroidetes ratio between cases and controls. |
| [39] | 2020 | Ireland | 309 (147 case, 162 control) | case: 69.3 ± 8.6/control: 63.3 ± 8.3; (mean ± SD) | Female: case: 31.5%/control: 35.8% | stool | age, sex | MNIgene.GUT® kit | Chemagic DNA blood protocol | Illumina MiSeq | V3–V4 | NR | NR | Available on request | Composition of the gut microbiome could potentially serve as a marker of disease severity in PD. Bilophila and Paraprevotella abundance were significantly associated with disease severity. |
| [23] | 2018 | Italy | 350 (237 cases, 113 control) | cases: 67.6 (9.7)/control: 65.9 (9.9); (y, mean (SD)) | cases: 115 (59.6)/control 47 (41.6): Male gender, n (%) | stool | age, nutritional status, geographical area | No preservative | QIAamp DNA Stool Mini Kit | Illumina MiSeq | V3–V4 | NR | NR | NR | Low Lachnospiraceae in cases. |
| [19] | 2017 | Germany | 59 (31 case, 28 control) | case: 64.8 ± 9.5/control 65.6 ± 10.4; (years, mean ± SD) | Male: all case and control | stool | age | NR | NR | Illumina Hiseq4000 | NR | NR | NR | ERP019674 | Case and controls had different gut microbiota composition, characterized by increased levels of Verrucomicrobiaceae (Akkermansia muciniphila) and unclassified Firmicutes, and decreased levels of Prevotellaceae (Prevotella copri) and Erysipelotrichaceae (Eubacterium biforme) in cases. |
| [44] | 2020 | Canada | 300 (197 case, 103 control) | case:66 (59–71)/control 66 (58–71); (years) | Female: case: 38.1%/control: 51.5% | feces | age | DNA stabilizer buffer | OMNIgeneGUT Kit | Illumina MiSeq | V4 | 515F | 806R | On publisher’s website | Increased abundance of Akkermansia and Bifidobacterium and decreased abundance of Faecalibacterium, Lachnospiraceae, and SCFA-producing bacteria in cases. |
| [22] | 2020 | Germany | 101 (71 case, 30 control) | case: 65.3 ± 10.2/controls: 64.3 ± 8.9; (years) | Female: case 45.7%/controls: 45.2% | feces | MS score, NMS constipation item, Wexner Constipation, coffee consumption | DNA stabilizing solution | PSP R Spin Stool DNA Plus Kit | Illumina MiSeq | V3–V4 | 341F (5′-ACTCCTACGGGAGGCAGCAG-3′) | 806R (5′-GGACTAC HVGGGTWTCTAAT-3′) | Available on request | High abundance of Faecalibacterium, Ruminococcus, Clostridia, Lachnospiraceae, Oscillospira, Betaproteaobacteria, Burkholderiales, Alcaligenaceae, and Sutterella in cases compared to controls. |
| [20] | 2017 | Germany | 154 (76 case, 78 control) | case: 68.0 6 9.7/control: 68.4 6 6.7; (year) | Male: case 66%/control 59% | stool | diabetes medication | Stool specimen collector (MedAuxil) | Qiagen AllPrep kit | Illumina MiSeq | V4 | 515F | 805R | PRJNA381395 | High abundance of Akkermansia in PD, different gut microbiota between cases and controls. |
| [24] | 2017 | USA | 327 (197 case, 130 control) | Total 69, 68.4, 9.2; (Median, Mean, SD) | Female: 65; 132 (67.0%), Male (% Male) | stool | PD medications, disease duration, spousal relationship, geographic site | Media-free swabs kit with DNA/RNA-free sterile swabs | According to the Earth Microbiome Project Protocol | Illumina MiSeq | V4 | 515F | 806R | ERP016332 | Significantly higher abundance of Bifidobacteriaceae, Christensenellaceae, Lactobacillaceae, Pasteurellaceae, and Verrucomicrobiaceae families in cases compared to controls/association of a high abundance of Akkermansia, Lactobacillus, Bifidobacterium, and reduced Lachnospiraceae (chain fatty acids producer) with disease development. |
| [41] | 2017 | Germany | 58 (29 case, 29 control) | case: 69.2, 6.5/control: 69.4, 6.7 (years; mean, SD) | case: 23 male, 6 female/control: 13 male, 16 female | stool | age | Shipment with no preservative, at room temp | PowerSoil Kit | Illumina MiSeq | V1–V2 | NR | NR | NR | High abundance of Lactobacillaceae, Barnesiellaceae, and Enterococcacea in cases. |
| [14] | 2015 | USA | 72 (38 case, 34 control) | case: 61.6 ± 9.4/control: 45.1 ± 14.4; (mean) | case: 24/14, control: 18/16; male/female | fecal samples and sigmoid mucosal biopsies | NR | Supporting info | Supporting info | NR | V4 | NR | NR | NR | Anti-inflammatory butyrate- producing bacteria from the genera Blautia, Coprococcus, and Roseburia were significantly more abundant in the feces of controls than PD patients/Faecalibacterium were significantly more abundant in the mucosa of controls than in PD/proinflammatory bacteria such as Proteobacteria were significantly more abundant in the mucosa of PD than controls/the ratio of Firmicutes-to-Bacteroidetes in fecal samples was not significantly different between PD and HC groups/positive correlation of Bacteroidetes and Proteobacteria with PD duration/negative correlation of Firmicutes with PD duration. |
| [47] | 2019 | China | 99 (51 case, 48 control) | case: 62.4 ± 8.2, control: 62.2 ± 9.2 (years, mean ± SD) | case: male: 32, female: 19/control: control: male: 19, female: 29 | stool | age | Sterilized tube | QIAamp Fast DNA Stool Mini Kit | HiSeq2500 PE250 | V4 | 515F | 806R | NR | Low alpha and beta diversity, high abundance of Akkermansia, P. copri Prevotella, Ruminococcaceae, Veillonellaceae Verrucomicrobiaceae, methanobrevibacter smithii, Ruminococcus callidus, Roseburia inulinivorans, Parabacteroides merde, Ruminococcus torques in cases and a high abundance of Bacteroidales, Lactobacillaceae, lactobacillus gasseri in controls. |
| [21] | 2019 | China | 20 (10 case, 10 control) | over 65 | case: male: 7 (70%)/control: male: 5 (50%) | feces | NR | DNA/RNA Shield | PSP SPIN Stool DNA plus kit | Illumina MiSeq | V1–V3 | 341F | 805R | NR | Slightly different gut microbiota between cases and controls, a significant abundance of Bacteroides and Prevotellaceae in healthy controls, a significant abundance of Ruminococcaceae, Verrucomicrobiaceae, Porphyromondaceae, Hydrogenoanaerobacterium, and Lachnospiraceae in PD cases. |
| [27] | 2018 | China | 120 (75 case, 45 control) | case: 60.48 ± 10.72/control; 63.20 ± 6.00 | case: male: 49, female: 26/control: male: 23, female: 22 | stool | age | Without preservation solution at room temperature during shipment | Huirui.® DNA kit | Illumina HiSeq PE250 | V4 | V4T9 (5′-GTGTGYCAGCMG-CCGCGG TAA-3′) | V4R19 (5′-CCGGACTACNVGGGTWTCTAAT-3′) | NR | Significant reductions in Tenericutes, Euryarchaeota, and Firmicutes, Lachnospiraceae in patients with PD. Veillonellaceae and Verrucomicrobiaceae showed marked increases but without statistical significance. Significant differences in alpha diversity (but not beta) between patients with PD who had a disease duration of greater than 5 years compared to those with a disease duration of fewer than 5 years. |
| [49] | 2019 | Taiwan | 157 (80 case, 77 control) | case: 62.3 ± 7.8/control: 61.8 ± 8.3 | case: 62.5% men/control: 60% men | stool | age and sex | Flash-frozen on dry ice, and stored at −80 °C | QIAamp Fast DNA Stool Mini Kit | Illumina MiSeq | V3–V4 | NR | NR | NR | Microbiota from patients with PD dominated by Verrucomicrobia, Mucispirillum, Porphyromonas, Lactobacillus, and Parabacteroides. In contrast, Prevotella was more abundant in controls. The abundances of Bacteroides were more increased in patients with non-tremor PD subtype than patients with tremor subtype. Bacteroides abundance was correlated with motor symptom severity defined by UPDRS part III motor scores. |
| [48] | 2017 | China | 38 (24 case, 14 control) | case: 73.75 ± 6.26/control: 74.64 ± 5.57 | case: 16 men/control: 6 men | stool | age and sex | NR | TIANamp stool DNA kit (Tiangen Biotech Co., Ltd., Beijing, China) | Illumina MiSeq | V3–V5 | 5′-CCTACGGRRBGCASCAGKVRVGAAT-3′ | e 5′-GGACTACNVGGGTWTCTAATCC-3′ | NR | The genera Blautia, Faecalibacterium, and Ruminococcus were significantly decreased in PD compared to healthy controls. The genera Escherichia-Shigella, Streptococcus, Proteus, and Enterococcus were significantly increased in PD subjects. |
| [50] | 2017 | Russia | 155 (89 case, 66 control) | case: 67/control: 63 | NR | stool | age and sex | NR | NR | Illumina MiSeq | V3–V4 | NR | NR | NR | Reduction in taxonomic diversity of gut microbiota in patients with PD. |
| [51] | 2019 | Italy | 152 (80 case, 72 control) | NR | NR | stool | age, sex, loss of weight | NR | PSP Spin Stool DNA Kit Plus (Stratec Molecular) | Illumina MiSeq | V3–V4 | NR | NR | PRJNA510730 | Significantly higher levels of Lactobacillaceae, Enterobacteriaceae, and Enterococcaceae families compared to healthy individuals. On the other hand, the levels of Lachnospiraceae were significantly reduced in PD patients. |
| [52] | 2020 | China | 80 (40 case, 40 control) | case: 66.6 ± 7.1/control: 66.3 ± 8.1 | case: 19 men/control: 21 men | stool | lifestyle, gender, age, and BMI | NR | QIAamp DNA Stool Mini Kit (Qiagen) | Illumina HiSeq X-ten | NR | NR | NR | PRJNA433459 | The diversity and community of gut microbial genes in PD patients differed from those of healthy control subjects. Thirty-six different taxa were enriched in the PD patients, and no taxon was enriched in the healthy controls. |
| [53] | 2018 | China | 90 (45 case, 45 control) | case: 68.1 ± 8.0/control: 67.9 ± 8.0 | case: 22 men/control: 23 men | stool | age, sex, BMI, constipation | NR | QIAamp DNA Stool Mini Kit (Qiagen) | Illumina MiSeq | V3–V4 | 341F | 806R | PRJNA391524 | Some bacteria were correlated with PD clinical characteristics, including disease duration, severity, medication, and non-motor symptoms. |
| [66] | 2020 | China | 40 (27 case, 13 control) | case: 62.1 ± 10.2/control: 63 ± 8.76 | case: 19 men/control: 3 men | stool | age | NR | QIAamp DNA Stool Mini Kit (Qiagen) | Illumina MiSeq | V3–V4 | 515F 5′-GTGCCAGCMGCCGCGGTAA-3′ | 926R 5′-CCGTCAATTCMTTTGAGTTT-3′ | PRJNA561023 | Compared with HC and patients with PD-NC, the gut microbiota of patients with PD-MCI was significantly altered, particularly manifesting in enriched genera from Porphyromonadaceae family and decreased abundance of genera Blautia and Ruminococcus. |
| [55] | 2021 | Malaysia | 200 (104 case, 96 control) | case: 65.4 ± 8.4/control: 62.4 ± 9.0 | case: 62.5% male/control: 37.5% male | stool | age, sex | Preservatives were not added | QIAamp DNA Stool Mini Kit (Qiagen) | Illumina MiSeq | V3–V4 | 341F (5′-CCTACGGGNGGCWGCAG-3′) | 805R (5′-GACTACHVGGGTATCTAATCC-3′) | PRJNA494620 | Ten bacterial taxa were significantly increased in PD; largest fold changes were observed for B. fragilis, Lactobacillus acidophilus, Megasphaera and Gammaproteobacteria. |
| [56] | 2020 | Italy | 115 (64 case, 51 control) | case: 71.39 ± 10.99/51.67 ± 12.42 | case: 44 men/control: 31 men | stool | sex, age, BMI, coffee consumption, smoking | NR | QIAamp DNA Stool Mini Kit (Qiagen) | Illumina MiSeq | V3–V4 | NR | NR | PRJEB30401 | The most significant changes within the PD group highlighted a reduction in bacterial taxa, which are linked to anti-inflammatory/neuroprotective effects, particularly in the Lachnospiraceae family and key members, such as Butyrivibrio, Pseudobutyrivibrio, Coprococcus, and Blautia. |
| [43] | 2019 | Germany | 59 (34 case, 25 control) | case: 67.9 ± 8.6/63.9 ± 5.8 | case: 23 men/control: 11 men | stool | age | Sterile containers | FastDNA SPIN kit | Illumina MiSeq | V4–V5 | 520 F (5′-AYTGGGYDTAAAGNG-3′) | 926 R (5′-CCGTCAATTCMTTTRAGTTT-3′) | PRJEB30615 | PD patients exhibit alterations in their gut microbiota composition, characterized by a decrease in beneficial bacteria and an increase in certain bacterial groups. A potential link between the gut microbiome and PD development, as well as the influence of PD medications on the gut microbiota. |
| [60] | 2021 | China | 40 (20 case, 20 control) | case: 63.65 ± 5.64/61.95 ± 4.73 | case: 10 men/control: 10 men | stool | age, sex, BMI | NR | DNeasy PowerSoil Kit (Qiagen) | Illumina MiSeq | V3–V4 | 343 F: 5′-TACGGRAGGCAGCAG-3′ | 798 R: 5′-AGGGTATCTAATCCT-3′ | NR | A greater abundance of Alistipes, Rikenellaceae_RC9_gut_group, Bifidobacterium, Parabacteroides, while Faecalibacterium was decreased in fecal samples from PD patients. |
| [62] | 2020 | China | 126 (63 case, 63 control) | case: 64.0 ± 7.4/63.9 ± 7.9 | case: 40 men/control: 23 men | stool | age | NR | QIAamp Fast DNA Stool Mini Kit (Qiagen) | Illumina HiSeq PE250 | V4 | NR | NR | CRA001938 | There were markedly different microbial compositions among PD, HS, and HP samples by alpha/beta diversity. They also found differential microbial compositions among Hoehn and Yahr stage/disease duration. |
| [25] | 2014 | Finland | 144 (72 case, 72 control) | case: 65.3 ± 6 5.5/64.5 ± 6.9 | case: 51.4% male/control: 50% men | stool | age, sex | NR | NR | NR | V1–V3 | NR | NR | NR | Reduced abundance of Prevotellaceae in PD patients and the positive association of Enterobacteriaceae abundance with PIGD symptoms. |
| [40] | 2022 | China | 172 (132 case (mild: 43, moderate: 89), 40 control) | 60 to 90 | M/F case: 15/28 (mild AD), 33/56 (moderate AD)/control: 16/24 | feces | age, sex | Special cytoprotective agent | E.Z.N.A. Soil DNA Kit | Illumina MiSeq | V3–V4 | CCTACGGGNGGCWGCAG | GACTACHVGGGTATCTAATCC | PRJNA855571 | Elevated abundance of certain bacteria in cases (moderate vs. control), including Proteobacteria, Verrucomicrobia, Actinobacteria, and Synergistetes. Reduced levels of Firmicutes and Bacteroidetes in cases. Controls, when compared to mild and moderate cases, showed higher levels of Firmicutes, Erysipelotrichia, Acidaminococcaceae, Ruminococcaceae, and Bacteroidetes. |
| [26] | 2022 | Canada | 99 (45 case, 54 control) | case: 74: (65–78)/control: 70 (66–74); (year) | Female: case 33.3%/control 33.3% | feces | age | OMNIgene® GUT | QIAamp PowerFecal DNA Kits | MiSeq | V4 | 515F (GTGCCAGC MGCCGCGGTAA) | 806R (GGACTACHVHHHTWTCTAAT) | PRJNA770746 | No significant different between AD patients and controls (beta diversity), lower alpha diversity in cases, higher abundance of Erysipelotrichaceae in cases. |
| [45] | 2021 | China | 64 (28 cases (18 AD), 18 control) | case: 63.5 (4.7)/control: 64.5 (4.5); (SD) | Male (%): case 2 (11)/control: 4 (22) | feces | age, sex | NR | PowerSoil DNA Isolation Kit | Illumina Miseq/Microseq | V3–V4 | NR | NR | NR | AD cases exhibited increased microbial diversity, decreased levels of Bacteroides, Lachnospira, and Ruminiclostridium, and increased Prevotella. |
| [17] | 2019 | USA | 108 | case: 84.7 (8.1)/control: 83 (10.2); (mean [SD]) (year) | Male: case: 4 (16.7)/control: 8 (15.7) | stool | age, sex | NR | PowerMag soil DNA isolation kit | NextSeq 500 | NR | NR | NR | Upon request | Significant increase in Bacteroides, Alistipes, Odoribacter, Barnesiella, Osplanchnicus, Odoribacter spp., K. pneumoniae, B. fragilis, E. lenta, and Desulfovibrio AD (sulfate-reducing bacteria). Conversely, there were significant decreases in bacteria, including Lachnoclostridium, Butyrivibrio, B. proteoclasticus, B. hungatei, Eubacterium, E. eligens, E. hallii, E. rectale, Clostridium sp. SY8519, R. hominis, and F. prausnitzii./significantly different beta diversity between controls and AD cases. |
| [46] | 2022 | Kazakhstan | 84 (41 case, 43 control) | case: 68 (62–74)/control 68 (61–75); (median (IQR)) | Female, n (%): case 30 (73.2%)/control 35 (81.4%) | feces | NR | special kit | QIAamp DNA stool Mini Kit | Illumina MiSeq | NR | NR | NR | PRJNA811324 | Increased abundance of Acidobacteriota, Verrucomicrobiota, Planctomycetota, and Synergistota and decreased abundance of Bifidobacterium, Clostridia bacterium, Castellaniella, Erysipelotrichaceae UCG-003, Roseburia, Tuzzerella, Lactobacillaceae and Monoglobus in AD patients. |
| [28] | 2019 | China | 97 (33 case (32 aMCI), 32 control) | case: 74.85 ± 11.37 (AD), 70.53 ± 11.0 (aMCI)/control: 76.88 ± 9.35; (years, mean ± SD) | Male: case: 14 (AD; 42.42%), 18 (56.25%) aMCI/control 16 (50%) | feces | age, sex | Sterile collection containers | QIAGEN | Illumina MiSeq | V3–V4 | 5′-CAAGCAGAAG ACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCT-3′ | 5′-AATGATACGGCGACCACCGAGATC TACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ | PRJNA496408 | Decreased diversity in AD patients compared to controls. Different gut microbiota between healthy and cases/reduced abundance of Firmicutes, increased abundance of Proteobacteria in cases/a significant correlation between AD severity and the abundance of altered microbiomes/association of Enterobacteriaceae with AD. |
| [42] | 2021 | China | 105 (case: 53 (SCD) 14 (CI: MCI, n = 8; mild AD dementia, n = 6))/38 control) | case: 66.68 ± 6.32 (SCD), 73.21 ± 7.89 (CI)/control: 66.79 ± 5.13; (year) | M/F: case: 10/43 (SCD), 4/10 (CI)/control: 15/23 | feces | age, sex, educational years, other potential factors | Cytoprotective agents | QIAamp DNA Stool Mini Kit | Illumina Miseq PE250 | V3–V4 | 341F (CCTAC GGGRSGCAGCAG) | 806R (GGACTACVVGGGTATCTAATC) | NR | Decreasing abundance of Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, and Faecalibacterium in cases. |
| [54] | 2020 | Austria | 41 (23 case, 18 control) | case: 88 (73, 85)/control: 75 (74, 76); (years) | F/M: case: 15/18, control: 11/7 | stool | age, sex | Collection tubes | MagnaPure LC DNA Isolation Kit III | Illumina MiSeq | V1–V2 | 27F (AGAGTT TGATCCTGGCTCAG) | R357 (CTGCTGCCTYCCGTA) | PRJNA608281 | Decreased abundance of Lachnospiraceae in cases, clear clustering of case and controls at different stages of dementia according to beta diversity, AD association with a reduction in bacteria producing short-chain fatty acids (SCFA) and increased biomarkers of gut permeability and inflammation. Increased abundance of C. clostridioforme and Eisenbergiella is associated with cognitive impairment. |
| [18] | 2022 | Spain | 22 (12 case, 10 control) | 60 to 70 | case: 2 men/control: 6 men | stool | NR | NR | QIAamp PowerFecal Pro DNA isolation kit (Qiagen, Madrid, Spain) | Illumina MiSeq | NR | 515F-Y (50 GTG YCA GCM GCC GCG GTA A 30 | 806R (50 GGA CTA CNV GGG TWT CTA AT 30 | NR | At a more advanced stage of AD, the gut microbiota and volatiles shifted towards a profile with increases in Ruminococcus and Blautia. |
| [58] | 2022 | Thailand | 40 (20 case, 20 control) | case: 72.8 ± 5.6/control: 69.4 ± 6.2 | case: 45.5% male/control: 38.5% male | stool | NR | Preservation System (Norgen Biotek Corp., Thorold, ON, Canada) | QIAamp Stool Mini kit (Qiagen, USA) | Illumina MiSeq | V3–V4 | NR | NR | NR | A significant difference at the operational taxonomic unit level. The altered gut microbiome could be potentially targeted for the early diagnosis of dementia and the reduction in AD risk. |
| [59] | 2021 | China | 65 (21 case, 44 control) | case: 76.2 ± 9.9/control: 78.4 ± 6.6 | case: 13 men/control: 20 men | stool | NR | Sterile fecal collection containers | E.Z.N.A.@ Stool DNA Kit (Omega Bio-Tek, Norcross, GA, USA) | Illumina Miseq | V3–V4 | 338 forward (5′-ACTCCTACGGGAGGCAGCAG-3′) | 806 reverse (5′-GGACTACHVGGGTWTCTAAT-3′) | SRP252374 | Gut microbial alterations and related metabolic output changes may be associated with pathogenesis of AD. Fecal markers might be used as a non-invasive examination to assist screening and diagnosis of AD. |
| [61] | 2022 | Turkey | 98 (47 case, 51 control) | case: 71.4 ± 5.1/control: 67 ± 5.3 | case: 24 men/control: 28 men | stool | NR | NR | QiaAmp DNA stool minikit (Qiagen, Germany) | Illumina MiSeq | V3–V4 | 341 F (59-CCTACGGGNGGCWGCAG-39) | 805 R (59-GACTACHVGGGTATCTAATCC-39) | NCBI BioProject database | A different gut microbiota composition in AD cases marked primarily by Prevotella and Bacteroides, but also subnetworks of other taxa exist in the community. |
| [63] | 2021 | China | 92 (60 case, 32 control) | case: 72.82 ± 7.25/control: 71.06 ± 5.92 | case: 24 men/control: 14 men | stool | age | NR | QIAamp® DNA Stool Mini Kit (Qiagen, Hilden, Germany) | Illumina MiSeq | V3–V4 | 5-CCTACGGGNGGCWGCAG-3 | 5-GACTACHVGGGTATCTAATCC-3 | NR | AD patients had gut microbiota alterations related to cognition, and differential taxa between AD patients with and without NPS associated differently with NPS domains. |
| [65] | 2018 | China | 86 (43 case, 43 control) | case: 70.12 ± 8.76/control: 69.72 ± 9.24 | case: 23 men/control: 23 men | stool | age, sex | NR | QIAamp® DNA Stool Mini Kit (Qiagen, Hilden, Germany) | Illumina MiSeq | V3–V4 | 338F | 806R | NR | Altered gut microbiota composition and diversity AD cases compared to cognitively normal controls. Several bacterial taxa, including Actinobacteria, Bacteroidales, Ruminococcaceae, Selenomonadales, and Lachnoclostridium, were found to contribute to these differences. |
| [64] | 2022 | China | 302 (125 MCI, 83 AD case, 94 control) | case: 71.8 ± 8.3/control: 74.3 ± 10.6 | case: 53 men/control: 58 men | stool | NR | Sterile containers | E.Z.N.A.® soil DNA Kit (Omega Bio-tek, Norcross, GA, USA) | Illumina MiSeq | V3–V4 | 338F (50 -ACTCCTACGGGAGGCAGCAG-30) | 806R (50-GGACTACHV GGGTWTCTAAT-30) | NR | No significant difference in the alpha and beta diversity among groups. Patients with AD or MCI had increased bacterial taxa including Erysipelatoclostridiaceae, Erysipelotrichales, Patescibacteria, Saccharimonadales, and Saccharimonadia, compared with NC group. |
| [57] | 2017 | USA | 50 (25 case, 25 control) | case: 71.3 ± 7.3/control: 69.3 ± 7.5 | case: 8 men/control: 7 men | stool | age, sex | NR | NR | Illumina MiSeq | V4 | NR | NR | NR | Decreased microbial diversity in AD cases and compositionally distinct from controls. |