Mitigative potential of rhoifolin against cisplatin prompted testicular toxicity: biochemical, spermatogenic and histological based analysis

Abstract

Rhoifolin (ROF) is a naturally occurring flavonoid compound with diverse pharmacological and therapeutic benefits. The current investigation was designed to evaluate the curative potential of Rhoifolin (ROF) against Cisplatin (CP) induced testicular damage. Mature male albino rats (n = 48) were randomly distributed into 4 equal groups: control, CP (10 mg/kg), CP + ROF (10 mg/kg + 20 mg/kg) and ROF (20 mg/kg) supplemented group. Following 56 days of the trial, biochemical, inflammatory markers, spermatogenic, steroidogenic, hormonal, apoptotic, anti-apoptotic, and histopathological parameters were evaluated. The exposure to CP markedly (p < 0.05) lowered the activities of anti-oxidant enzymes, glutathione reductase (GSR), catalase (CAT), and glutathione peroxidase (GPx) as well as superoxide dismutase (SOD) in testicular tissues of male albino rats. Besides the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) were considerably augmented in CP exposed rats. The administration of CP also increased the level of inflammatory cytokines i.e. IL-6, TNF-α, 1L-1β and NF-κβ as well as COX-2 activity. Additionally, a notable (p < 0.05) upsurge was observed in dead sperms count, abnormality in the tail, midpiece as well as head of sperms along with a notable decline in sperm motility in CP treated rats. Moreover, the expressions of steroidogenic enzymes were also lowered in CP administered group. The levels of follicle stimulating hormone (FSH) and plasma testosterone as well as luteinizing hormone (LH) were decreased in CP treated group. Moreover, the expression of Bax as well as Caspase-3 (apoptotic markers) were increased. On the other hand, Bcl-2 expression (anti-apoptotic marker) was reduced. Furthermore, the histopathological analysis showed that CP considerably (p < 0.05) damaged the testicular tissues. However, the administration of ROF significantly reduced the damaging effects of CP in testicular tissues. The results of our study suggested that ROF can potentially alleviate CP-induced testicular damages due to its androgenic, anti-oxidant and anti-inflammatory as well as anti-apoptotic nature.

Introduction

Cancer is one of the most critical health issues around the globe and second leading cause of death.¹ Chemotherapy is a potential chemical therapy that works locally or systemically to eradicate rapidly proliferating cells even at locations far from tumor source.² CP is an effective chemotherapeutic agent with a vast spectrum of anticancer activity that is used to treat prostate,³ testicular,⁴ bladder,⁵ neck⁶ as well as ovarian cancers.⁷ Despite its effective anti-cancer activity, its therapeutic application is limited due to its severe nontargeted organ toxicity such as, hepatotoxicity,^8,9 neurotoxicity,¹⁰ oto-toxicity,¹¹ nephro-toxicity¹² as well as testicular toxicity.^8,13

CP damages the physiology and chemical composition of tissues by inducing oxidative stress (OS).¹⁴ CP instigates imbalance between antioxidants and oxidants profile that plays a pivotal role in testicular damages.¹⁵ CP is generally an alkylating agent, which destroys cells by various mechanisms such as OS, DNA damage, apoptosis, lipid peroxidation (LP), which eventually leads to the testicular dysfunction.^16–19 Reactive oxygen species (ROS) injures the cells as well as tissues by interacting with cellular macromolecules prompting the formation of oxidized species.^20,21 CP instigates germ cell death and testicular injuries by retarding the function of Leydig cells that leads to reduced testosterone synthesis.²² CP causes significant anomalies in semen profile and interstitial cells by inducing the shrinkage as well as vacuolation.²³

Plant based bioactive elements such as flavonoids have been shown to demonstrate anti-inflammatory,²⁴ anti-oxidant²⁵ and anti-cancerous effect.²⁶ ROF is a flavanone extracted from citrus plants.²⁷ ROF is reported to exhibit anti-inflammatory as well as antioxidant potentials.²⁸ Moreover, ROF shows potential protective effect against diabetes²⁹ and neurotoxicity.³⁰ However, the therapeutic activity of ROF against testicular toxicity remains unascertained. Therefore, the present study was designed to evaluate the curative effects of ROF against CP-instigated testicular toxicity in adult male albino rats.

Materials and methods

Chemicals

CP (CAT No: 15663-27-1), ROF (CAT No: 17306-46-6), formalin, sodium bicarbonate, eosin, nigrosin, fructose, formaldehyde, ethanol, paraffin, hematoxylin, NADH, phenazine methosulfate, guaicol, hydrogen peroxide, EDTA and ferric chloride were purchased from Sigma-Aldrich, Germany.

Animals

Male albino rats having weight 220 ± 20 were used for the experiment. The animals were procured from the animal house of the University of Agriculture, Faisalabad. Rats were provided with tap water and food chaw and temperature was maintained at 23 to 25 °C. The animals were stored in steel enclosures, at humidity (45 ± 5%) and 12 h light or dark cycle in the animal research station at University of Agriculture, Faisalabad (UAF). Rats were handled in compliance with the guidelines of European Union for the Animal Care and Experimentation and the protocols were approved by the Institutional Animal Care and Use Committee of UAF (DGS No.13837-40/18-04-2022).

Experimental design

48 mature male albino rats were arbitrary separated into 4 groups (n = 12). They were given the following treatment: Control group; CP administrated group (10 mg/kg of CP orally); CP + ROF co-administrated group (10 mg/kg of CP and 20 mg/kg of ROF) and ROF supplemented group (20 mg/kg of ROF through oral gavage). After 56 days of experiment, rats were anesthetized by using ketamine (60 mg/kg) and xylazine (6 mg/kg) and sacrificed by decapitation. Blood samples were kept in sterile tubes and centrifuged for 15 min at 3,000 rpm. Blood was isolated and stored at −20 °C till further analysis. The right testis was preserved in 10% formalin solution for histopathological examination, besides the left testis was stored at −80 °C for biochemical assessment. The homogenization of testicular tissues in phosphate buffer (2 mL, pH 7.4) was performed at 4 °C and 12,000 rpm for 15 min. Finally, multiple parameters were analyzed using this supernatant.

Biochemical markers evaluation

Catalase (CAT)

The CAT activity was estimated according to the protocol demonstrated by Chance and Maehly.³¹ Various compounds, including 2.5 mL of 50 mM phosphate buffer (pH 5.0), 0.4 mL of 5.9 mM H₂O₂, and 0.1 mL enzyme extract were mixed to make reaction mixture. Absorbance changes in the mixture were checked at 240 nm. One unit of CAT activity was considered as an absorbance change of 0.01 as units/min.

Superoxide dismutase (SOD)

The SOD activity was evaluated by a method outlined by Kakkar et al.³² Reaction mixture consisted of 1.2 mL of sodium pyrophosphate buffer (0.052 mM; pH 7.0) and 0.1 mL of phenazine methosulphate (186 mM). 0.3 mL of supernatant after centrifugation (1,500 × g for 10 min followed by 10,000 × g for 15 min) of homogenate was added to the reaction solution. Then, 0.2 mL of NADH (780 mM) was added to initiate enzyme reaction, which was later on terminated by adding 1 mL of glacial acetic acid. Finally, chromogen’ amount was assessed by noticing the change in color intensity (at 560 nm). The values of SOD activity were expressed as unit/mg protein.

Glutathione peroxidase (GPx)

The GPx activity was determined according to the technique of Rotruck et al.³³ Reaction mixture for GPx activity consisted of 0.01 mL of 10 mM sodium azide, 2.0 mL of 0.4 M Tris–HCl buffer (pH 7.0), 0.5 mL of 0.2 mM. H2O2 and 0.2 mL of 10 mM glutathione. Incubation was carried out at 37 °C for about 10 min and then 0.4 mL 10% (v/v) TCA was added to terminate the reaction. The mixture was centrifuged at 5,000 rpm for about 5 min and absorbance was noticed at 430 nm. Its final values were displayed as unit/mg protein.

Glutathione reductase (GSR)

The GSR activity was assessed by the method of Carlberg and Mannervik.³⁴ Reaction mixture consisted of 0.1 mL EDTA (0.5 mM), 0.05 mL oxidized glutathione (1 mM), 0.1 mL NADPH (0.1 mM), 1.65 mL phosphate buffer (0.1 M, pH 7.6) and 0.1 mL of 10% homogenate in a volume of 2 mL. Enzymatic activity was measured at 25 °C by noticing NADPH disappearance at about 340 nm. The values obtained were exhibited as nM NADPH oxidized/ min/mg tissue.

Reactive oxygen species (ROS)

ROS level was determined from homogenate as per the process explained by Hayashi et al.³⁵ Homogenate (5 mL) and 0.1 M sodium acetate buffer (140 mL) with pH 4.8 were mixed and dispensed in 96 well-plate. After incubating at 37 °C for 5 min, 100 mL of mixed solution of ferrous sulfate and N, N-diethyl-para-phenylenediamine was dispensed to each plate, and then incubated at 37 °C for 1 min. At 505 nm, the absorbance was noticed with the help of a microplate reader for 180 s with a 15 s interval. Finally, the standard curve was plotted. ROS was recorded as Unit/mg tissues and 1 unit of ROS was equivalent to 1.0 mg/L of H₂O₂ in the sample.

Thiobarbituric acid reactive substances (TBARS)

The level of TBARS was assessed by following the method outlined by Wright et al.³⁶ but with few modifications. TBARS is produced as a result of lipid peroxidation (LP), therefore, degree of LP was indicated by TBARS level. 1.0 mL total volume of reaction mixture consisted of 0.2 mL homogenate sample, 0.02 mL ferric chloride (100 mM), 0.58 mL phosphate buffer (0.1 M pH 7.4) and 0.2 mL ascorbic acid (100 mM). Incubation was carried out at 37 °C for about 1 h in a shaking water bath. Addition of 1.0 mL 10% trichloroacetic acid terminated the reaction. After adding 1.0 mL 0.67% thiobarbituric acid, tubes were boiled in water bath for about 20 min. Then, mixture was transferred to crush ice-bath prior centrifuging at 2,500 × g for about 10 min. The TBARS level was determined by measurement of optical density of supernatant at 535 nm with spectrophotometer against reagent blank. Its final values were shown as nM TBARS/min/mg tissue at 37 °C using molar extinction coefficient of 1.56 × 10⁵ M⁻¹ cm⁻¹.

Sperm motility

The sperm motility was determined in accordance with the modified method of Moumeni et al.³⁷ The cauda epididymis was sliced and placed in 0.5 mL of prewarmed phosphate-buffered solution (pH 7.3) containing a drop of nigrosin stain. 50 mL of homogenate was kept in pre-heated (35 °C) slide for examination under light microscope at 200×. About 10 fields and 100 sperms per sample were examined. Each sperm was categorized either as progressive motile sperm (PMS), non-progressive motile sperm (NPMS), or non-motile sperm (NMS). Semen samples were assessed in triplicate and then mean of these 3 determined values was considered as final sperm motility.

Sperm viability

The 25 mL of eosin-nigrosin stain was mixed with the semen sample. 15 mL of aliquot from this sample was placed on slide, and a smear was prepared and dried at room temperature. Finally, the slides were observed under the microscope at 40×. Unstained or white sperms were classified as alive, while red stained sperms were considered dead. About 300 spermatozoa were examined, and the results were explained in percentage.³⁸

Sperm count

The epididymal sperm count was estimated using a hemocytometer according to the modified procedure outlined by Yokoi et al.³⁹ The caudal region of the epididymis was minced using anatomical scissors in 5 mL of physiological saline solution, kept in a rocker for 10 min, and incubated at room temperature for about 3 min. The supernatant was diluted 1:100 using a solution containing 1 mL formalin (35%), 5 g sodium bicarbonate, and 25 mg eosin per 100 mL of distilled water. A 10 mL drop of this mixture was placed in a sperm-counting chamber. Finally, at least 10 fields were observed under light microscope at 400×.

Sperm morphological abnormality

Sperm morphology was estimated using Kwik-Diff™ staining kit (Thermo Scientific, Pittsburgh, PA, USA). Smears were prepared using 5 mL of semen sample, then air dried and stained with eosin/nigrosin. Finally, slides were rinsed with water to remove excessive stain and examined under light microscope at 400×. 300 random cells were carefully observed on all slides and partial (head, mid-piece/neck, and tail) as well as complete morphological abnormalities of sperms were determined.⁴⁰

Hypo-osmotic swelling (HOS) test

The integrity of the sperm was determined by using HOS test, as mentioned by Correa and Zavos.⁴¹ The test was performed by keeping 20 μL of semen in 180 μL of fructose solution, at osmotic pressure 80 mOsm/L for about 20 min. Followed by subsequent incubation as well as processing, the sperm were stained using eosin/nigrosin. Lastly, two hundred sperms exhibiting swollen as well as non-swollen tails were recorded under a light microscope (400×).

Hormonal level

The levels of LH (serial number-H206), FSH (serial number- H101), and plasma testosterone (serial number-H090) were determined by ELISA kits (Los Angeles, CA USA) as per the manufacturer’s procedures. 50 mL of assay diluent and 10 mL of plasma were added to 96-well ELISA plate and incubated for approximately 2 h at room temperature. Then, plates were rinsed with the deionized water and before adding 100 mL of peroxidase-conjugated immunoglobulin G (IgG) anti-FSH solution, anti-LH, or anti-testosterone in each well, incubation was carried out for maximum 2 h. Plates were again rinsed with the deionized water, substrate solution was added in wells and incubated for about 25 min at room temperature. 50 mL of stop solution was added into each well to terminate the reaction. Finally, the absorbances of FSH, LH and plasma testosterone were recorded at 450 nm. All samples were run in triplicates and conducted at same time under same conditions to avoid inter-assay variation.

Inflammatory markers

Testicular tissues were used to estimate the levels of inflammatory markers. The Level of NF-kВ (CSB-E13148r), TNF-α (CSB-E07379r), IL-1β (CSB-E08055r) and IL-6 (CSB-E04640r) as well as COX-2 (CSB-E13399r) activity were estimated by ELISA kits (Cusabio Technology Llc, Houston, TX, USA) and the company’s guidelines were followed. Firstly, 50 mL of sample was dispensed to the microplate wells. After that, 50 mL of antibody cocktail was poured into the wells. Plates were incubated at room temperature for the duration of 1 h. After washing properly with the help of washing buffer, 100 mL of TMB substrates were dispensed to each well and incubated for about 10 min. After the addition of 100 mL of stop solution, the color was developed. The optical density was noted at 450 nm using Tecan Multimode Reader.

Ribonucleic acid (RNA) extraction and real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

Testicular tissues were used to perform qRT-PCR. The steroidogenic enzymes expression such as 17β-HSD, StAR and 3β-HSD, as well as Bax, Caspase-3 & Bcl-2 were assessed using RT-qPCR. In the first step, using a TRIzol reagent total RNA isolation was performed, which was subsequently converted into complementary DNA through reverse transcription. Variations in expression of these enzymes along with apoptotic markers were measured by 2^−ΔΔCT, considering β-actin as an internal control.⁴² The primer sequences of target genes are demonstrated in Table 1, as described earlier by Ijaz et al.⁴³

Table 1.

Primers sequences for the real-time quantitative reverse transcription-polymerase (RT-qPCR).

Gene	Primers 5′ ->3′	Accession number
3β-HSD	Forward: GCATCCTGAAAAATGGTGGC	NM_001007719
	Reverse: GCCACATTGCCTACATACAC
17β-HSD	Forward: CAGCTTCCAAGGCTTTTGTG	NM_054007
	Reverse: CAGGTTTCAGCTCCAATCGT
StAR	Forward: AAAAGGCCTTGGGCATACTC	NM_031558
	Reverse: CATAGAGTCTGTCCATGGGC
Bax	Forward: GGCCTTTTTGCTACAGGGTT	NM_017059.2
	Reverse: AGCTCCATGTTGTTGTCCAG
Bcl-2	Forward: ACAACATCGCTCTGTGGAT	NM_016993.1
	Reverse: TCAGAGACAGCCAGGAGAA
Caspase-3	Forward: ATCCATGGAAGCAAGTCGAT	NM_012922.2
	Reverse: CCTTTTGCTGTGATCTTCCT
β-actin	Forward: TACAGCTTCACCACCACAGC	NM_031144
	Reverse: GGAACCGCTCATTGCCGATA

3β-hydroxysteroid dehydrogenase (3β-HSD); 17β-hydroxysteroid dehydrogenase (17β-HSD); Steroidogenic acute regulatory protein (StAR).

Histopathology

Testicular tissues were kept in 10% formaldehyde solution for the evaluation of histopathology, then dehydrated in increasing concentration (80%, 90% and 100%) of absolute ethanol and fixed in paraffin wax. After that the paraffin blocks were cut (5 μm) and stained using hematoxylin and eosin (H & E) and observed microscopically (Nikon, 187842, Japan). Image-J2X software was used to examine the photographs.

Statistical analysis

Results were displayed as Mean ± SEM. The normal distribution of the data was tested by Shapiro–Wilk test. After employing one-way ANOVA, Tukey’s test was applied to the entire data. P < 0.05 was considered as statistically significant.

Results

Effect of ROF and CP on testicular, epididymis, seminal vesicles, and prostate gland weight

There was no significant change in animal weight gain in all the groups. CP and ROF treatment did not alter the weights of the both testis (Right and Left), epididymis, seminal vesicles, and prostate gland (Table 2).

Table 2.

Effect of CP and ROF on testicular, epididymis, seminal vesicles, and prostate gland weight.

Parameters	Groups
	Control	CP	CP + ROF	ROF
Weight gain (g)	62.99 ± 2.83	60.85 ± 2.45	61.89 ± 3.68	63.66 ± 2.80
Left testes weight (g)	1.37 ± 0.04	1.35 ± 0.04	1.36 ± 0.04	1.38 ± 0.05
Right testes weight (g)	1.42 ± 0.06	1.40 ± 0.07	1.41 ± 0.06	1.43 ± 0.07
Epididymis weight (g)	0.68 ± 0.06	0.65 ± 0.07	0.66 ± 0.07	0.69 ± 0.07
Seminal Vesicles weight (g)	0.83 ± 0.04	0.80 ± 0.05	0.82 ± 0.03	0.84 ± 0.03
Prostate Gland weight (g)	0.63 ± 0.04	0.60 ± 0.03	0.61 ± 0.03	0.64 ± 0.04

Effect of ROF and CP on oxidant/antioxidant enzymes

CP intoxication notably (p < 0.05) decreased CAT, GPx, SOD as well as GSR activities, while elevated ROS as well as TBARS levels in contrast to the control group. Nonetheless, ROF supplementation to co-treated group resulted in a remarkable (p < 0.05) increase in CAT, GPx, SOD as well as GSR activities in addition to a reduction in ROS as well as TBARS levels in contrast to CP treated group. Moreover, no significant differences were noticed between ROF only supplemented rats in contrast to control (Table 3).

Table 3.

Effect of CP and ROF on biochemical markers of testes.

Parameters	Groups
	Control	CP	CP + ROF	ROF
CAT (U/mg protein)	8.99 ± 0.11a	4.94 ± 0.15c	7.62 ± 0.14b	9.05 ± 0.12a
SOD(U/mg protein)	7.66 ± 0.13a	2.66 ± 0.11c	5.58 ± 0.18b	7.70 ± 0.14a
GPx(U/mg protein)	19.74 ± 1.28a	7.90 ± 0.22c	13.51 ± 0.55b	20.06 ± 1.26a
GSR (nM NADPH oxidized/min/mg tissue)	4.94 ± 0.15a	1.30 ± 0.12c	3.52 ± 0.08b	4.98 ± 0.13a
TBARS (nM/mg tissue)	12.39 ± 1.37c	27.17 ± 1.38a	18.36 ± 0.82b	12.14 ± 1.16c
ROS (μmol/g)	0.70 ± 0.03c	8.39 ± 0.09a	2.47 ± 0.07b	0.69 ± 0.04c

Values having varying superscripts are considerably (p < 0.05) distinct from other groups.

Effect of ROF and CP on sperm indices

CP administration significantly (p < 0.05) lowered sperm motility, viability as well as sperm count, while increased the sperm structural abnormalities (tail, midpiece and head) in contrast to control group. However, ROF administration considerably recovered all the sperm indices in co-treated rats in contrast to CP treated rats. Moreover, only ROF supplemented group displayed a normal sperm profile as in the control group (Table 4).

Table 4.

Effect of CP and ROF on sperm parameters.

Parameters	Groups
	Control	CP	CP + ROF	ROF
Sperm motility (%)	86.72 ± 0.83a	27.48 ± 1.31c	59.87 ± 1.51b	88.82 ± 2.34a
Dead sperm (%)	16.74 ± 1.08c	79.92 ± 1.36a	29.92 ± 1.23b	16.67 ± 1.10c
Head abnormality(U/mg protein)	4.92 ± 0.51c	27.47 ± 1.34a	13.48 ± 1.35b	4.88 ± 0.49c
Mid sperm abnormality (%)	0.74 ± 0.03c	7.82 ± 0.16a	2.92 ± 0.11b	0.72 ± 0.03b
Tail abnormality (%)	2.35 ± 0.11c	17.65 ± 0.73a	8.46 ± 0.66b	2.31 ± 0.11c
Epididymal sperm count(million/mL)	25.32 ± 1.30a	8.46 ± 0.44c	20.55 ± 0.83b	26.45 ± 1.40a
Hypo-osmotic swelled sperm count (HOS) (%)	80.80 ± 1.34a	21.53 ± 0.98c	61.39 ± 1.41b	87.76 ± 1.98a

Values having varying superscripts are considerably (p < 0.05) distinct from other groups.

Effect of ROF and CP on hormonal level

CP administration considerably (p < 0.05) downregulated the level of LH, testosterone along with FSH in CP exposed rats as compared to the control group. Nonetheless, the ROF administration considerably raised the level of LH, testosterone as well as FSH in co-administrated rats compared with CP administered rats. Moreover, only ROF administered group exhibited a normal hormonal level as in the control group (Table 5).

Table 5.

Effect of CP and ROF on hormonal assay of testes.

Parameters	Groups
	Control	CP	CP + ROF	ROF
FSH (ng/mL)	3.87 ± 0.04a	1.63 ± 0.05c	2.84 ± 0.07b	3.91 ± 0.08a
LH (ng/mL)	2.63 ± 0.04a	0.97 ± 0.06c	2.02 ± 0.05b	2.65 ± 0.09a
Testosterone (ng/mL)	4.46 ± 0.09a	2.09 ± 0.05c	3.56 ± 0.08b	4.49 ± 0.10a

Values having varying superscripts are considerably (p < 0.05) distinct from other groups.

Effect of ROF and CP on inflammatory indices

CP intoxication substantially (p < 0.05) increased the level of NF-κB, IL-6, TNF-α and IL-1β as well as COX-2 activity in contrast to control rats. Nevertheless, the co-treatment of ROF with CP noticeably (p < 0.05) decreased the level of NF-κB, IL-6, TNF-α and IL-1β as well as COX-2 activity when compared to CP administrated group. ROF alone administrated rats showed values of inflammatory indices near to the control rats (Table 6).

Table 6.

Effect of CP and ROF on inflammatory markers of testes.

Parameters	Groups
	Control	CP	CP + ROF	ROF
NF-kB (ng/g tissue)	15.24 ± 0.80c	75.72 ± 1.48a	32.88 ± 0.84b	15.06 ± 0.75c
TNF-α (ng/g tissue)	7.10 ± 0.22c	26.63 ± 1.09a	15.87 ± 0.83b	7.04 ± 0.22c
1 L-1β (ng/g tissue)	21.57 ± 1.11c	83.80 ± 1.60a	43.80 ± 1.60b	21.12 ± 1.09c
IL-6 (ng/g tissue)	6.11 ± 0.09c	45.80 ± 2.17a	16.12 ± 1.33b	6.20 ± 0.17c
COX-2 (ng/g tissue)	24.02 ± 0.89c	81.45 ± 1.64a	45.04 ± 1.52b	23.73 ± 0.76c

Values having varying superscripts are considerably (p < 0.05) distinct from other groups.

Effect of ROF and CP on apoptotic/anti-apoptotic proteins

CP exposure downregulated anti-apoptotic (Bcl-2) protein expression, while upregulated apoptotic proteins expression, including Bax & Caspase-3 as compared to control group. Contrarily, co-treatment with ROF + CP notably upregulated the expression of anti-apoptotic protein, while downregulated apoptotic proteins expression in comparison to CP treated rats. Moreover, ROF alone administrated group displayed these expressions close to the control group (Fig. 1).

Fig. 1.

Effect of CP and ROF on the expression of A) Bax B) Bcl-2 and C) Caspase-3. Bars are displayed on the basis of mean and SEM values. Varying superscripts displaying significant (p < 0.05) dissimilarities among the groups.

Effect of ROF and CP on steroidogenic enzymes

CP administration considerably (p < 0.05) lowered the expression of steroidogenic enzymes i.e. 17β-HSD, StAR as well as 3β-HSD in CP-treated rats in contrast to control rats. Nonetheless, CP + ROF co-administration significantly (p < 0.05) recovered 17β-HSD, StAR and 3β-HSD expression in contrast to CP supplemented rats. In addition, the expression of these enzymes in ROF only supplemented and control rats was almost similar (Fig. 2).

Fig. 2.

Effect of CP and ROF on the expression of A) 17β-HSD, B) 3β-HSD and C) StAR protein. Bars are displayed on the basis of mean and SEM values. Different subscripts displaying significant difference at p < 0.05.

Effect of ROF and CP on histomorphological profile of testicular tissues

CP administration considerably (p < 0.05) decreased seminiferous tubular diameter along with epithelial height and tunica propria width. Furthermore, a remarkable escalation was noticed in interstitial spaces (IS) and tubular lumen (TL) in CP treated rats in contrast to control rats. Nonetheless, the administration of ROF substantially reversed these structural changes as well as increased the seminiferous tubules diameter and epithelial height along with tunica propria width, while TL as well as IS were decreased in CP + ROF co-administrated rats in comparison to CP exposed rats. Moreover, only ROF administrated rats showed normal histology as in the control group (Fig. 3, Table 7).

Fig. 3.

Photomicrographs of the adult albino rat testicles (H&E, 400×): A) Control group displaying impenetrable germinal epithelium exhibiting germ cells B) CP exposed group showing sloughing of the epithelial layer, vacant lumen as well as degenerated area of IS; C) CP + ROF co-treated group demonstrating restoration in epithelial part, TL filled with ST and recovered the deteriorated IS; D) ROF supplemented group showing compacted seminiferous tubules with less IS as well as luminal part filled with germ cells thus improved spermatogenesis. CP: Cisplatin; ROF: Rhoifolin; TL: Tubular lumen; ST: Spermatids; IS: Interstitial spaces.

Table 7.

Effect of CP and ROF on histomorphological profile.

Parameters	Groups
	Control	CP	CP + ROF	ROF
Interstitial Space (μm)	9.36 ± 0.15c	46.79 ± 1.55a	17.40 ± 1.36b	9.32 ± 0.15c
Tunica propria (μm)	58.82 ± 2.35a	15.40 ± 1.27c	47.45 ± 1.11b	59.64 ± 2.42a
Seminiferous tubule diameter (μm)	335.99 ± 5.89a	96.87 ± 1.80b	290.68 ± 29.03c	339.59 ± 5.14a
Seminiferous tubule epithelial height (μm)	85.35 ± 2.41a	33.49 ± 1.19c	71.21 ± 1.39b	87.04 ± 2.57a
Tubular lumen (μm)	37.52 ± 1.33c	95.43 ± 2.36a	63.87 ± 1.32b	36.97 ± 1.08c
Spermatogonia (n)	53.45 ± 1.02a	24.02 ± 0.84c	43.93 ± 1.46b	54.51 ± 1.30a
Primary spermatocytes (n)	45.31 ± 1.26a	16.05 ± 1.40c	36.21 ± 1.39b	46.19 ± 1.40a
Secondary spermatocytes (n)	34.82 ± 0.99a	11.01 ± 0.55c	24.87 ± 1.03b	35.99 ± 0.86a
Spermatids (n)	60.01 ± 0.83a	21.52 ± 1.06c	47.53 ± 1.33b	61.08 ± 1.23a

Values having varying superscripts are considerably (p < 0.05) distinct from other groups.

Discussion

The purpose of the current research was to assess the mitigative potential of ROF against CP-instigated damage in testicular tissues. CP induced testicular damage are attributed to OS induced by the production of free radicals and decrease in antioxidant enzymes.⁴⁴ Free radicals induce a cascade of reactions that is responsible for a vast range of damage instigated by CP.^45,46 The outcomes of our study depicted a drastic reduction in antioxidant enzymes activities which includes CAT, GPx, SOD as well as GSR, on the other hand TBARS as well as ROS levels were increased in CP administrated rats. Superoxide anion (O⁻²), hydrogen peroxide (H₂O_2), hydroxyl radical (OH) as well as nitric oxide (NO) are the prominent reactive oxygen and nitrogen species that cause cellular dysfunction.⁴⁷ SOD counteracts the O⁻² by converting it into oxygen and H₂O_2,⁴⁸ while GPx along with CAT converts H₂O₂ into H₂O.⁴⁹ GSR maintains the level of GSH that is crucial for GPx activity.⁵⁰ Decreased activities of these enzymes increases the level of ROS and triggers chemical reactions, known as lipid peroxidation (LP).⁵¹ TBARS acts as a LP indicator and elevated LP level augments the sperm plasma membrane permeability. Conversely, the administration of ROF significantly decreased ROS as well as TBARS levels by restoring the activities of antioxidant enzymes. The highly conjugated aromatic system with multiple hydroxyl groups makes flavonoid excellent hydrogen donor or electron donor that neutralizes free radical and other reactive species.⁵²

CP administration prompted a decrease in sperm number, motility and viability, while the abnormalities of tail, midpiece and head of sperm were increased. According to Ijaz et al.,⁸ CP induced OS results in higher concentration of ROS, that confers damaging impacts on sperm morphology, motility as well as sperm concentration.⁵³ Sperms are extremely vulnerable to the excessive ROS level due to the high amount of polyunsaturated fatty acids (PUFA)⁵⁴ and absence of cellular cytoplasmic protection.⁵⁵ The neck of spermatozoa is more vulnerable to ROS effects as it contains more mitochondria than the sperm tail and head. However, the administration of ROF reversed all these damaging effects possibly owing to its ROS scavenging nature.

CP administration lessened the steroidogenic enzymes expression i.e. 17β-HSD, StAR and 3β-HSD. StAR acts as a transporter protein that has an integral role in steroidogenic event and mediates cholesterol transportation to the inner mitochondrial membrane.⁵⁶ Then 3β-HSD along with 17β-HSD catalyze the conversion of this cholesterol to testosterone.⁵⁷ The decreased expressions of these enzymes in CP administrated rats results in decreased testosterone concentration. This might be due to the halted cholesterol channeling and hence decreased steroidogenesis. Nonetheless, ROF supplementation in CP-intoxicated rats recovered the level of testosterone by increasing the expression of these enzymes that may be due to its androgenic nature.

CP administration lowered the level of testosterone, LH and FSH, which are necessary for spermatogenesis. LH is responsible of producing testosterone, which influences spermatogenesis,⁵⁸ while FSH regulates seminiferous tubules and controls spermatogenesis.⁵⁹ CP reduces the production of gonadotropins as well as testosterone, by disturbing the hypothalamus-pituitary–gonadal (HPG) axis that disrupts the function of Sertoli as well as Leydig cells, which results in disturbed spermatogenesis.⁶⁰ However, ROF reversed these effects by increasing steroidogenic enzyme expressions along with hormone level in CP treated rats. It may be due to the retraction in suppression of HPG axis.

In this study, CP toxicity markedly augmented the level of NF-κB which promoted a considerable increase in inflammatory indices i.e. TNF-α, IL-1β as well as IL-6 and COX-2 activity. The increased level of NF-κB indicates its activation and transcription by CP provoked OS.^61,62 Nuclear translocation of NF-κB stimulates inflammatory genes expression, which is the major cause for increased inflammatory indices levels.⁶³ However, the administration of ROF reduced the level of inflammatory marker NF-κB, thereby inhibiting the synthesis of TNF-α, IL-6 as well as IL-1β. The protective potential of ROF might be attributes to its anti-inflammatory property. Our study is in line with Lim et al.,⁶⁴ who demonstrated the anti-inflammatory effect of ROF in chondrocytes.

CP treatment escalated Bax & Caspase-3 expression (apoptotic proteins), whereas lowered Bcl-2 expression. Gholami et al.⁶⁵ reported that CP prompts imbalance in these proteins. Pro-apoptotic along with anti-apoptotic proteins are responsible for apoptosis through mitochondrial dependent as well as independent pathways.⁶⁶ The relative imbalance between Bcl-2 & Bax leads to apoptosis.⁶⁷ Bax is an apoptotic protein that promotes the process of apoptosis, whereas Bcl-2 is an anti-apoptotic protein, which increases the suppression of apoptosis.⁶⁸ Elevation in Bax and reduction in Bcl-2 potentially change the mitochondrial membrane permeability, causing a rise in the discharge of cytochrome C in the cytoplasm.⁶⁹ The increased cytochrome C level in cytoplasm eventually stimulates Caspase-3 expression that prompts apoptotic cell death.⁷⁰ However, ROF restored all the above mentioned testicular damages by lowering Bax & Caspase-3 expression as well as by increasing the expression of Bcl-2. These findings highlight the anti-apoptotic nature of ROF.

The histological examination showed that CP exposure prompted a decrease in the germ cell count, reduced epithelial diameter as well as decreased seminiferous tubules and tunica propria thickness. There was also a prominent decline in the count of spermatogonia, primary-secondary spermatocytes along with spermatids. Moreover, CP administration also caused a significant increase in tubular lumen as well as interstitial spaces. These anomalies may be attributed to the increased production of ROS,⁷¹ inducing testicular dysfunction in male rats. Our results of histopathological analysis are in line with the earlier investigation of Imed et al.,⁷² who reported that CP exposure reduced testosterone level, which resulted in histopathological damages in rat testicles. However, ROF treatment significantly protected the number of germ cells and testicular architecture due to its antioxidant as well as androgenic potentials. Thus, the outcomes of this study proved the therapeutic effects of ROF and also endorsed the idea of its application to safeguard from CP-induced testicular damage.

Conclusion

The outcomes of our investigation revealed that CP exposure caused OS in the testicular tissues and disturbed the biochemical, spermatogenic as well as histopathological profiles. Moreover, CP exposure reduced the expression of steroidogenic enzymes and anti-apoptotic protein, besides the expression of apoptotic protein as well as the level of inflammatory indices were escalated. However, ROF supplementation exhibited significant ameliorative effects against CP-induced reproductive toxicity and prevented all these testicular damages due to its anti-oxidative, anti-apoptotic, anti-inflammatory and androgenic properties. Therefore, it can be stated that ROF can be used as a therapeutic agent in future to treat testicular damage. In future, clinical trials are recommended to evaluate its efficacy on human beings.

Author contributions

FS and MUI conceived and designed the study. MUI, HS and AH performed the experiment and histology, and helped in compiling the results. AH, QUA, TA, SR and MFH helped in statistical analysis and writing the results. FS, MUI, SR, TA, HS, AA and AH wrote the manuscript. All the authors read and approved the final manuscript.

Funding

The Authors extend their appreciation to the Researcher supporting project number (RSP2023R502), King Saud University, Riyadh Saudi Arabia for funding this project.

Conflict of interest statement. The authors declare that they have no competing interests.

Data availability

All the data is contained in the manuscript.

Ethics approval

The animals were handled in compliance with the guidelines of European Union for the Animal Care and Experimentation and the protocols were approved by the Institutional Animal Care and Use Committee of UAF (DGS No.13837-40/18-04-2022).

Consent to participate

Not applicable.

Consent for publication

Not applicable.