Prohibitin1 facilitates viral replication by impairing the RIG-I-like receptor signaling pathway

ABSTRACT

Innate immunity plays an essential role in defending the host against pathogenic infections. Appropriate controls are required to exert antiviral effects and avoid inflammatory disorders, but the negative regulation mechanisms are not fully understood. Here, Prohibitin1 (PHB1) was identified as a negative regulator of innate immune responses. We found that PHB1 protein and mRNA levels were promoted by virus-induced beta interferon (IFN-β) and subsequently suppressed the antiviral innate immune responses, thereby facilitating the replication of multiple RNA viruses. Further studies revealed that PHB1 interacted with IFN regulatory factor 3 (IRF3) to restrain the binding of IRF3 to nuclear import proteins, thereby suppressing the nuclear import of IRF3 and the downstream production of IFN-β. In summary, we elucidated the mechanism by which PHB1 regulates host antiviral innate immunity by inhibiting the nuclear translocation of IRF3, which contributed to the understanding of IRF3 regulation and revealed a novel role of PHB1 in host innate immunity.

IMPORTANCE

Type I interferon (IFN-I), produced by the innate immune system, plays an essential role in host antiviral responses. Proper regulation of IFN-I production is required for the host to balance immune responses and prevent superfluous inflammation. IFN regulatory factor 3 (IRF3) and subsequent sensors are activated by RNA virus infection to induce IFN-I production. Therefore, proper regulation of IRF3 serves as an important way to control innate immunity and viral replication. Here, we first identified Prohibitin1 (PHB1) as a negative regulator of host IFN-I innate immune responses. Mechanistically, PHB1 inhibited the nucleus import of IRF3 by impairing its binding with importin subunit alpha-1 and importin subunit alpha-5. Our study demonstrates the mechanism by which PHB1 facilitates the replication of multiple RNA viruses and provides insights into the negative regulation of host immune responses.

INTRODUCTION

Innate immunity plays a vital role in protecting the host from pathogenic infections (1). During virus infection, the pathogen-associated molecular patterns produced by RNA viruses are specifically recognized by the pattern recognition receptor retinoic acid-inducible gene I (RIG-I) (2, 3). Subsequently, the adaptor molecule mitochondrial antiviral signaling protein (MAVS) recruits the downstream TANK-binding kinase 1/inhibitor of κB kinase ε (TBK1/IKKε) complex and inhibitor-κB kinase α/β complex, leading to the phosphorylation of interferon regulatory factor 3/7 (IRF3/IRF7) and nuclear factor-κB (NF-κB) (4 – 6). The phosphorylated IRF3/7 and NF-κB are translocated into the nucleus and ultimately induce the transcription of type I interferon (IFN-I) and proinflammatory cytokines (7, 8).

Among the host factors involved in the innate immunity signaling pathway, IRF3 serves as a major regulator for IFN-β production (9). During virus infection, IRF3 needs to be phosphorylated and forms dimers, and then it is translocated from the cytoplasm to the nucleus, where it binds to target genes and activates transcription (10, 11). Proper controls are required for IRF3 to exert antiviral effects and avoid excessive inflammatory disorders (12). AKT serine/threonine kinase 3 and protein phosphatase 2A directly mediate the phosphorylation of IRF3 and are negatively regulated by 7-dehydrocholesterol reductase and receptor of activated C kinase 1, respectively (13, 14). Cell growth-regulating nucleolar protein (LYAR) interacts with phosphorylated IRF3, impeding its DNA binding capacity, which consequently leads to a decrease in IRF3 dimer formation (15). Meanwhile, ubiquitin-specific protease 22, nucleoporin 93, and interferon-inducible LINC02605 were identified as factors that promote antiviral responses by facilitating the nuclear translocation of IRF3 (16 – 18), which was antagonized by Asp-Glu-Ala-Asp-box RNA helicase 56 (DDX56) (19). Regulating factors of IRF3 remain to be identified to provide insight into the role of IRF3 in innate immunity.

Prohibitin1 (PHB1), along with its homologous counterpart, Prohibitin2 (PHB2), belongs to the PHB family. The PHB family consists of the N-terminal transmembrane domain, a conserved PHB domain, and the coil-coiled C-terminal domain (20). PHB proteins are ubiquitously expressed in various cellular compartments, including the plasma membrane, endoplasmic reticulum (ER), mitochondria, and nucleus (21). PHB1, located in the plasma membrane, has been shown to be involved in the viral entry of hepatitis C virus, Chikungunya virus, dengue virus 3, and enterovirus 71 (22 – 25). Additionally, PHB1 in the ER serves as a crucial modulator of ER stress transitioning to apoptosis after Japanese encephalitis virus (JEV) infection (26). Simultaneously, PHB complexes play an essential role in maintaining mitochondrial homeostasis and regulating autophagy (27, 28). Although PHB1 has been associated with numerous signaling pathways, there are still other biological functions to be explored.

In this study, a novel function of PHB1 was discovered, revealing its negative control over IFN-β antiviral innate immune responses. Virus-induced IFN-β promoted the protein and mRNA levels of PHB1, which suppressed the production of IFN-β in return, thereby promoting virus replication. Mechanistically, PHB1 is bound to IRF3, disrupting the complex formation between IRF3 and importin subunit alpha-1 (importin α1) or importin subunit alpha-5 (importin α5), thereby restraining the translocation of IRF3 to the nucleus. These findings uncover a novel mechanism by which PHB1 regulates virus-triggered IFN-β induction.

RESULTS

PHB1 promotes the replication of IAV, SeV, and VSV

Previous studies have reported the involvement of PHB1 in the replication of influenza A virus (IAV) (29, 30). To verify this view, three small interfering RNAs (siRNAs) specific for PHB1 were synthesized and transfected into adenocarcinomic human alveolar basal epithelial cells (A549) to determine their silencing efficiency. Si-PHB1-3 exhibited the most effective inhibitory effect compared to nontarget siRNA (si-NC) and was selected for subsequent experiments (Fig. S1). To explore the role of PHB1 in IAV replication, A549 cells were transfected with si-PHB1 or si-NC and then infected with influenza A/Puerto Rico/8/1934 (PR8, H1N1). Supernatants at indicated time points were collected and measured using 50% tissue culture infective dose (TCID₅₀) assays, while viral NP protein expressions were detected by western blot. The results demonstrated a significant decrease in PR8 viral titers and viral NP expressions in the PHB1 silencing cells compared to si-NC-treated cells (Fig. 1A). Meanwhile, transfection of exogenous Flag-PHB1 into A549 cells promoted the PR8 viral titers and the viral NP expressions (Fig. 1B). To determine whether PHB1 specifically regulates IAV replication, we also examined the effects of PHB1 on other RNA viruses. A549 cells transfected with Flag vector or Flag-PHB1 were infected with Sendai virus (SeV), and the mRNA levels of SeV M segment and Flag-PHB1 protein expression were assessed by quantitative real-time polymerase chain reaction (qRT-PCR) assay and western blot, respectively. The results revealed higher levels of SeV mRNA in the PHB1-overexpressed cells than in Flag vector-expressed cells (Fig. 1C). Furthermore, A549 cells transfected with the Flag vector or Flag-PHB1 were infected with recombinant vesicular stomatitis virus encoding green fluorescence protein (VSV-GFP), and the GFP signals were detected and statistically analyzed by fluorescence microscopy (Fig. 1D and E) at the indicated time points. Flow cytometry was also applied to detect the GFP fluorescence intensity of each group at 24 h post infection (hpi) (Fig. 1F), and the same results were acquired, indicating that PHB1 promotes VSV-GFP signals. Together, these data indicated that PHB1 positively regulated the virus titers of multiple RNA viruses.

FIG 1.

PHB1 promotes the replication of multiple RNA viruses. (A) Growth curves of PR8 H1N1 in si-PHB1 or si-NC-treated cells. A549 cells were transfected with si-PHB1 or si-NC for 24 h and then infected with the PR8 H1N1 virus at an MOI of 0.01. Cell supernatants were collected at the indicated time points. Virus titers were determined by TCID₅₀ on MDCK cells (means ± SD from three independent experiments), and expressions of the PHB1 and viral NP proteins were detected by western blot. (B) Growth curves of PR8 H1N1 in Flag-PHB1 or Flag-vector overexpressed cells. A549 cells were transfected with Flag-PHB1 or Flag-vector for 24 h and then infected with the PR8 H1N1 virus at an MOI of 0.01. Cell supernatants were collected at the indicated time points. Virus titers were determined by TCID₅₀ on MDCK cells (means ± SD from three independent experiments), and the expressions of PHB1 and viral NP proteins were detected by western blot. (C) The effect of PHB1 on SeV replication. HEK293T cells were transfected with Flag-PHB1 or the Flag empty vector and infected with SeV at an MOI of 1.0. Cell RNAs were collected at 12 and 24 hpi, the mRNA levels of the SeV M segment were detected by qRT-PCR, and the expression of the Flag-PHB1 protein was detected by western blot. (D–F) The effect of PHB1 on VSV replication. (D) HEK293T cells were transfected with Flag-PHB1 or the Flag empty vector and infected with VSV-GFP at an MOI of 0.1. The fluorescence intensity of GFP was detected by fluorescence microscopy at 12, 24, and 36 hpi. (E) The GFP fluorescence intensities of each group at the indicated time points were statistically analyzed. Scale bar = 1,000 µm. (F) Flow cytometry was applied to detect the GFP fluorescence intensity of each group at 24 hpi. GAPDH was used as a control. (*, P < 0.05; **, P < 0.01; ***, P < 0.001; all by two-tailed Student’s t-test).

Virus-induced IFN-β promotes the protein and mRNA levels of PHB1

To further analyze the role of PHB1 in the virus-triggered innate immune response, the endogenous protein and mRNA levels of PHB1 were determined by western blot and qRT-PCR upon IAV infection. The results revealed that PHB1 protein and mRNA levels were progressively increased with the passage of infection time (Fig. 2A and B). Similarly, increased PHB1 protein and mRNA levels were also observed after infection with SeV (Fig. 2C and D) or VSV-GFP (Fig. 2E and F), consistent with the results of IAV infection. These results collectively illustrated that different virus infections lead to increased endogenous protein and mRNA levels of PHB1.

FIG 2.

IFN-β induced by virus infection promotes the protein and mRNA levels of PHB1. (A–F) PHB1 protein and mRNA levels in (A and B) IAV-infected, (C and D) SeV-infected, and (E and F) VSV-GFP-infected cells. A549 cells were infected with IAV at an MOI of 0.01, and SeV or VSV-GFP at an MOI of 1. Samples were collected at 0, 6, 12, and 24 hpi. Western blot and qRT-PCR were performed to determine the protein and mRNA levels of PHB1, respectively. (G and H) PHB1 protein and mRNA levels in poly(I:C) stimulated cells. Cells were transfected with increasing concentrations of poly(I:C) (0, 50, 100, and 200 ng) for 12 h, and the protein and mRNA levels of PHB1 were detected by western blot and qRT-PCR, respectively. (I and J) PHB1 protein and mRNA levels in IFN-β-treated A549 cells. Cells were treated with increasing concentrations of IFN-β (0, 500, 1,000, and 2,000 U/mL) for 12 h, and the protein and mRNA levels of PHB1 were detected by western blot and qRT-PCR, respectively. (K–N) PHB1 protein and mRNA levels in SeV-infected (K and L) Vero and (M and N) MAVS-deficient MDCK cells. Cells were infected with SeV at an MOI of 1.0, and samples were collected at 0, 6, 12, and 24 hpi. The protein and mRNA levels of PHB1 were detected by western blot and qRT-PCR, respectively. GAPDH was used as a control. The band intensities were quantified by ImageJ, and the relative PHB1 levels (PHB1/GAPDH) are shown. (**, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

The increased protein and mRNA levels of PHB1 during virus infection may be attributed to the virus itself or the virus-induced IFNs. To eliminate the impact of virus infection, protein and mRNA levels of PHB1 in A549 cells were detected after stimulation with polyinosinic-polycytidylic acid (poly(I:C)) (31), and it was revealed that poly(I:C) stimulation also resulted in an increase in the protein and mRNA levels of PHB1 (Fig. 2G and H). Moreover, A549 cells were treated with varying doses of IFN-β, and PHB1 protein and mRNA levels were found to be significantly upregulated with the IFN-β treatment (Fig. 2I and J), indicating that the increase in PHB1 protein and mRNA levels was induced by IFN-β. To further confirm this point, type I IFN gene-deficient Vero cells and MAVS-deficient MDCK cells were infected with SeV (32), and the PHB1 protein and mRNA levels were hardly changed after SeV infection in these cells (Fig. 2K through N), suggesting the critical role of IFN-β in increasing the PHB1 protein and mRNA levels. Taken together, these results revealed that the increased PHB1 protein and mRNA levels were triggered by virus-induced IFN-β.

PHB1 negatively regulates the antiviral innate immune response

Given that multiple viral titers were regulated by PHB1 (Fig. 1) and that PHB1 protein and mRNA levels were sensitive to virus-induced IFN-β (Fig. 2), PHB1 may be involved in the IFN-β signal pathway. To confirm the function of PHB1 in the antiviral innate immune IFN-β signal pathway, the effect of PHB1 on SeV-induced activation of the IFN-β promoter was determined. Human embryonic kidney 293T (HEK293T) cells were co-transfected with luciferase (luc) reporter for the IFN-β promoter (IFN-β-luc), renilla luciferase-TK promoter (pRL-TK), and either si-PHB1 or Flag-PHB1. Subsequently, the cells were stimulated with SeV, and dual-luciferase reporter assays were performed to measure IFN-β promoter activity. The data demonstrated that silencing PHB1 significantly enhanced the IFN-β promoter activity (Fig. 3A), while PHB1 overexpression reduced the IFN-β promoter activity (Fig. 3B), indicating that PHB1 inhibited the activation of IFN-β promoter induced by SeV. Simultaneously, the effect of PHB1 on SeV-triggered interferon-sensitive responsive element (ISRE) promoter activities was also determined. The results revealed that silencing PHB1 significantly enhanced the ISRE promoter activity (Fig. 3C), while PHB1 overexpression reduced its activity (Fig. 3D), indicating that the activation of the ISRE promoter induced by SeV may be directly inhibited by PHB1 or due to suppressed IFN production.

FIG 3.

PHB1 negatively regulates the antiviral innate immune response. (A–D) Effects of PHB1 silencing and overexpression on IFN-β and ISRE promoter activity. HEK293T cells were transfected with pRL-TK and either (A and B) IFN-β-luc or (C and D) ISRE-luc together with (A and C) si-PHB1 or (B and D) Flag-PHB1. After SeV infection, luciferase activities were measured using the luciferase report assay at 12 hpi, with Renilla luciferase used as an internal control. The expression of Flag or PHB1 was determined by western blot. (E) The mRNA levels of IFN-β and ISGs in poly(I:C) stimulated A549 cells treated with si-PHB1 or si-NC. Cells were transfected with si-PHB1 or si-NC, followed by stimulation with poly(I:C) (100 ng) for 6 h. The mRNA levels of the indicated target genes were detected using qRT-PCR. GAPDH was used as a control. (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

Additionally, we examined the effects of PHB1 on the transcription of IFN-β and downstream interferon-stimulated genes (ISGs), including IFIT2, ISG15, IFITM3, and Mx1. A549 cells were transfected with si-PHB1 or si-NC, followed by stimulation with poly(I:C), and the mRNA levels of the above genes were detected by qRT-PCR. The results indicated that silencing PHB1 significantly increased the mRNA transcription levels of IFN-β and ISGs (Fig. 3E). The above results proved that PHB1 suppressed antiviral innate immune responses.

PHB1 negatively regulates the IFN-β signal pathway by targeting IRF3 signaling

It is well known that RNA viruses can be recognized by RIG-I and subsequently activate MAVS, the TBK1/IKK-ε complex, and IRF3 through signal transduction, leading to the production of IFN-β (33, 34). In order to explore the signal molecule that was influenced by PHB1, IFN-β-luc, pRL-TK, Flag-PHB1, and different Flag-tagged signal molecules, RIG-I, MAVS, TBK1, IKK-ε, or IRF3, they were co-transfected into HEK293T cells. IFN-β promoter activities were measured after 24 h transfection by a dual-luciferase reporter assay. The results indicated that IFN-β promoter activities stimulated by the above adaptor molecules were all suppressed by PHB1 (Fig. 4A through E). Moreover, IFN-β promoter activities induced by these adaptor molecules in the absence of PHB1 were determined. Results showed that silencing PHB1 promoted the IFN-β promoter activities induced by IRF3 or its upstream molecules (Fig. 4F through J). In summary, PHB1 specifically targets IRF3 signaling to regulate the IFN-β signaling pathway.

FIG 4.

PHB1 negatively regulates the IFN-β signal pathway by targeting IRF3 signaling. (A–J) The effects of (A–E) PHB1 overexpression or (F-J) PHB1 silencing on the activity of IFN-β promoter induced by adaptor molecules including (A and E) RIG-I, (B and G) MAVS, (C and H) IKK-ε, (D and I) TBK1, and (E and J) IRF3 were examined. HEK293T cells were transfected with IFN-β-luc, pRL-TK, and the indicated plasmids expressing the signal molecules, along with Flag-PHB1 or si-PHB1. Luciferase activities were measured at 24 hpi. The expression levels of PHB1 and each signal molecule were detected by western blot. The data are presented as the mean ± SD from three independent experiments. (K–M) PHB1 co-purified with IRF3. (K and L) The co-purification between PHB1 and IRF3 in transfected cells. HEK293T cells were co-transfected with the indicated plasmids for 24 h. Co-IP was performed using either (K) anti-Flag or (L) anti-HA antibodies, followed by western blot. (M) The co-purification between endogenous PHB1 and IRF3. Co-IP was performed using an anti-IRF3 rabbit antibody or rabbit IgG with or without SeV infection. The endogenous IRF3 and coprecipitated PHB1 were detected using an anti-IRF3 antibody and an anti-PHB1 antibody, respectively. Rabbit IgG was used as the negative control. GAPDH was used as a control. The band intensities were quantified by ImageJ, and the relative levels of PHB1/IRF3 are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

In order to investigate whether PHB1 negatively regulates IFN-β activation via targeting IRF3 signaling, the interaction between PHB1 and IRF3 was determined. HA-IRF3 and Flag-PHB1 were co-transfected into HEK293T cells, and co-immunoprecipitation (co-IP) experiments were performed with anti-Flag or anti-HA antibodies, revealing that IRF3 co-purified with PHB1 (Fig. 4K and L). Additionally, a co-IP assay was performed to confirm the co-purification between endogenous PHB1 and IRF3 in virus-infected or mock-treated A549 cells by using an anti-IRF3 antibody. The results demonstrated that endogenous PHB1 co-purified with IRF3 (Fig. 4M), suggesting that PHB1 may negatively regulate IFN-β activation via targeting IRF3 signaling.

TBK1-IRF3 complex formation, IRF3 dimer formation, and IRF3 phosphorylation are not affected by PHB1

Given that PHB1 negatively regulates the IFN-β signal pathway by targeting IRF3 signaling, we wondered whether the functions of IRF3 were affected by PHB1. IRF3 is phosphorylated by TBK1, and phosphorylated IRF3 subsequently forms the IRF3-IRF3 homodimer and the IRF3-IRF7 heterodimer, which subsequently enter the nucleus to induce IFN-β production (35, 36).

The role of PHB1 in the formation of TBK1-IRF3 complex was investigated. HA-TBK1 and Flag-IRF3, together with Flag-PHB1 or the Flag empty vector, were transfected into HEK293T cells. A competitive co-IP assay revealed that the formation of TBK1-IRF3 complex was not affected by PHB1 (Fig. 5A). Then, HEK293T cells were transfected with either Flag-PHB1 or si-PHB1 and then stimulated with SeV to examine the effect of PHB1 on IRF3 phosphorylation. Both the overexpression and silencing of PHB1 had no significant influence on the phosphorylation levels of IRF3 (Fig. 5B and C). Finally, HEK293T cells were transfected with HA-IRF3 and Flag-IRF3 or Flag-IRF7, together with Flag-PHB1. Anti-HA antibody was applied to perform competitive co-IP assays, and it was observed that the formation of IRF3 or IRF7 dimers with IRF3 was not impaired by PHB1 (Fig. 5D and E). To further confirm the effects of PHB1 on the TBK1-IRF3 complex and the formation of IRF3 dimers, endogenous interactions between IRF3 with TBK1 and IRF7 were determined by co-IP assays using an anti-IRF3 antibody with or without si-PHB1 treatment. The results revealed that the complex formation between IRF3 with TBK1 and IRF7 was not affected by PHB1 (Fig. 5F). Taken together, TBK1-IRF3 complex formation, IRF3 dimer formation, and IRF3 phosphorylation were not affected by PHB1.

FIG 5.

TBK1-IRF3 complex formation, IRF3 dimer formation, and IRF3 phosphorylation were not affected by PHB1. (A) The effects of PHB1 on the formation of the TBK1-IRF3 complex. HEK293T cells were co-transfected with the indicated plasmids for 24 h. Co-IP was performed using an anti-HA antibody, followed by western blotting to detect the expression of the plasmids and coprecipitated proteins. (B and C) The effect of PHB1 on IRF3 phosphorylation. HEK293T cells transfected with (B) Flag-PHB1 or (C) si-PHB1 were infected with SeV for 12 h. The protein and phosphorylation levels of IRF3 were detected by western blot using an anti-IRF3 antibody and an anti-Ser386 phosphorylated IRF3 antibody, respectively. GAPDH served as a control. (D and E) The effects of PHB1 on the formation of IRF3 dimers. HEK293T cells were co-transfected with the indicated plasmids for 24 h. Co-IP was performed using an anti-HA antibody, followed by western blotting to detect the expression of the plasmids and coprecipitated proteins. (F) The effects of endogenous PHB1 knockdown on TBK1-IRF3 and IRF3 dimer formation. HEK293T cells were treated with si-PHB1 or si-NC for 24 h. Co-IP was performed using an anti-IRF3 antibody, followed by western blotting to detect the expression of coprecipitated proteins. GAPDH was used as a control. The relative band intensities were quantified by ImageJ.

PHB1 inhibits the nuclear import of IRF3

IRF3 dimers, once formed, are transported into the nucleus and bind to the IFN-β promoter to activate IFN-β transcription (10, 11). Endogenous PHB1 localization was first determined by confocal microscopy, and it was found that PHB1 can be located outside the mitochondria, though it is still mainly distributed in the mitochondria (Fig. S2). To determine the effect of PHB1 on the nuclear entry of IRF3, A549 cells were transfected with Flag-PHB1 and stimulated with SeV, followed by a nuclear and cytoplasmic fraction experiment. It was revealed that IRF3 translocated into the nuclear fraction upon SeV stimulation, but the distribution of IRF3 in the nucleus fraction was significantly decreased in PHB1 overexpression cells compared to control cells (Fig. 6A). Meanwhile, confocal microscopy was also utilized to visualize the localization of IRF3 in SeV-infected cells with PHB1 overexpression. While IRF3 translocated into the nucleus in the presence of SeV, overexpression of PHB1 substantially impaired the nuclear accumulation of IRF3 (Fig. 6B and C), consistent with the results from the nuclear and cytoplasmic fraction data. To further determine the effect of endogenous PHB1 on the IRF3 nucleus import, A549 cells were treated with si-PHB1 or si-NC and then infected with SeV. Nuclear and cytoplasmic fraction experiments were also performed, and it was indicated that the distribution of IRF3 in the nucleus fraction was significantly increased in si-PHB1-treated cells compared to control cells (Fig. 6D). The localization of IRF3 in SeV-infected si-PHB1-treated cells was also visualized by confocal microscopy, and the results revealed that knockdown of PHB1 resulted in increasing IRF3 nucleus import (Fig. 6E and F). The above results collectively suggest that PHB1 regulates IFN-β by restraining the nuclear import of IRF3.

FIG 6.

PHB1 inhibits the nuclear import of IRF3. The effects of PHB1 (A–C) overexpression or (D–F) knockdown on IRF3 nucleus import. (A, D) Western blot analysis was performed to examine the distribution of IRF3 in cytoplasmic and nuclear fractions in PHB1 (A) overexpression or (D) knockdown cells, with or without SeV infection. Cells were harvested and subjected to nuclear fractionation (Nuc) and cytoplasmic fractionation (Cyt). An anti-IRF3 antibody was used to determine the content of IRF3 in the nuclear and cytoplasmic fractions by western blot. GAPDH and Lamin A/C were used as cytosolic and nuclear controls, respectively. The band intensities were quantified using ImageJ, and the relative levels of IRF3 (IRF3/GAPDH or Lamin A/C) are shown below the images. (B, E) Confocal microscopy analysis of the nucleocytoplasmic distribution of IRF3 in PHB1 (B) overexpression or (E) knockdown cells, with or without SeV infection. (B) A549 cells were transfected with HA-IRF3 and Flag-PHB1 or Flag vectors and infected with SeV for 6 h or not (mock group). HA-IRF3 and Flag-PHB1 were detected by IFA using an anti-HA rabbit antibody and an anti-Flag mouse antibody. (E) A549 cells were transfected with si-PHB1 or si-NC and infected with SeV for 6 h or not (mock group). IRF3 and PHB1 were detected by IFA using an anti-IRF3 rabbit antibody and an anti-PHB1 mouse antibody, followed by immunostaining with 594-conjugated AffiniPure goat anti-rabbit secondary antibodies (red) and Alexa Fluor 488-conjugated AffiniPure goat anti-mouse antibodies (green), respectively. Scale bar = 20 µm. (C, F) The relative nucleus IRF3 distributions in (B, E) were analyzed by ImageJ and subjected to statistical analysis, respectively. (****, P < 0.0001).

PHB1 inhibits the binding of IRF3 to nuclear importin proteins

IRF3 dimers, like other macromolecules, contain a nucleus location signal (NLS) that allows them to be transported from the cytoplasm into the nucleus in a manner that depends on the importin family proteins (37) and may be regulated by PHB1. To verify this hypothesis, the interactions between IRF3 and importin α1, importin α3, importin α5, or importin α7 were determined by co-IP assays. IRF3 was revealed to coprecipitate with importin α1 and importin α5, consistent with the previous study (Fig. 7A) (16, 38). To investigate the role of PHB1 in the coprecipitation between IRF3 and importins, HEK293T cells were co-transfected with HA-importin α1/importin α5 and Flag-IRF3, together with increasing amounts of Flag-PHB1. The co-IP assays revealed that the formation of IRF3-importin α1 and IRF3-importin α5 complexes was inhibited by PHB1 in a dose-dependent manner (Fig. 7B and C). Similarly, the formation of IRF3-importin α1 and IRF3-importin α5 complexes was promoted by treatment with si-PHB1 (Fig. 7D). Thus, PHB1 may weaken the binding of IRF3 to importin α1 and importin α5, subsequently resulting in decreased nuclear import of activated IRF3.

FIG 7.

PHB1 disrupts the formation of IRF3-importin α1 and IRF3-importin α5 complexes. (A) The complex formation between IRF3 and importin α in transfected cells. HEK293T cells were co-transfected with Flag-IRF3 and HA-importin α1/α3/α5/α7 for 24 h. Co-IPs were performed using an anti-Flag antibody. (B and C) The effects of PHB1 on the complex formation between exogenous IRF3 and importin α1 or importin α5. HEK293T cells were co-transfected with Flag-IRF3 and (B) HA-importin α1 or (C) HA-importin α5, along with increasing amounts of Flag-PHB1 (0, 0.3, and 1.0 µg) for 24 h. Co-IPs were performed using an anti-HA antibody, followed by western blotting to detect the expression of plasmids and coprecipitated proteins. The band intensities were quantified by ImageJ, and the relative levels of IRF3/importins are shown. (D) The effects of PHB1 on the complex formation between endogenous IRF3 and importin α1 or importin α5. HEK293T cells were treated with si-PHB1 or si-NC for 24 h, and co-IPs were performed using an anti-IRF3 antibody, followed by western blot to detect the expression of plasmids and coprecipitated proteins. The band intensities were quantified by ImageJ, and the relative levels of IRF3/importins are shown. (E) The co-purification between importin α1 and importin α5 with GFP-IRF3-NLS. HEK293T cells were co-transfected with the indicated plasmids for 24 h. Co-IP was performed using an anti-HA antibody, followed by western blot to detect importin α1 or importin α5 and GFP-IRF3-NLS with the anti-HA and anti-GFP antibodies, respectively. (F) The co-purification between PHB1 and IRF3 or its truncations in transfected cells. HEK293T cells were co-transfected with the indicated plasmids for 24 h. Co-IP was performed using an anti-GFP antibody, followed by western blot to detect PHB1 with the anti-Flag and detect IRF3 or its truncations with anti-GFP antibodies. GAPDH was used as a control.

The cargo proteins, including IRF3, are recognized through the NLS region, and it is doubtful whether PHB1 interacts with the NLS of IRF3. GFP-tagged IRF3 and its truncations containing NLS (64-131) (GFP-IRF3-NLS) or deleting NLS (GFP-IRF3_ΔNLS) were constructed. Subsequently, GFP-IRF3-NLS was co-transfected with HA-importin α1 or importin α5 into cells. Co-IP assays were performed to confirm that IRF3-NLS coprecipitated with importin α1 or importin α5. (Fig. 7E). Then, we detected the interaction between PHB1 and IRF3-NLS, and HEK293T cells were co-transfected with GFP-IRF3 or its truncations. The results demonstrated that IRF3 contaning the NLS can coprecipitate with PHB1 (Fig. 7F). In summary, PHB1 inhibits the binding of IRF3 to importin α1 and importin α5 by coprecipitating with IRF3-NLS.

The PHB domain of PHB1 plays a dominant role in the inhibition of IFN-β production

PHB1 can be divided into three domains: the N-terminal transmembrane domain, the PHB domain, and the C-terminal coiled-coli domain (20). To explore the pivotal domain of PHB1 in regulating the production of IFN-β, three truncations of PHB1 were constructed (Fig. 8A). HEK293T cells were co-transfected with IFN-β-Luc, pRL-TK, and either Flag-PHB1 or PHB1 truncations, and dual-luciferase reporter assays were performed to detect the effect of different PHB1 truncations on the IFN-β promoter activities induced by SeV. It was shown that the expression of PHB1 and its truncations, except the ΔPHB domain, significantly reduced the virus-induced IFN-β promoter activities (Fig. 8B), which indicates the critical role of the PHB domain in regulating IFN-β production. Subsequently, PHB1 and its truncations were transfected into A549 cells and infected with PR8 H1N1 virus to determine the effect of the PHB domain on virus titers. The results indicated that PHB1 truncations containing the PHB domain facilitated PR8 virus titers (Fig. 8C). Flag-PHB1 or PHB1 truncations were co-transfected with HA-IRF3 or not into HEK293T cells to investigate the key domains of PHB1 that coprecipitated with IRF3. The co-IP assays indicated that the PHB domain containing truncations can coprecipitate with exogenous or endogenous IRF3 (Fig. 8D and E), further proving that the PHB domain is the key domain of PHB1. Collectively, the PHB domain of PHB1 plays a pivotal role in inhibiting IFN-β production.

FIG 8.

The PHB domain of PHB1 plays a dominant role in inhibiting IFN-β production. (A) The schematic of full-length PHB1 and PHB1 mutants. (B) Effects of PHB1 mutants on IFN-β promoter activity. HEK293T cells were transfected with pRL-TK, IFN-β-luc, PHB1 mutants, or the Flag vector. After 24 hpi, the cells were infected with SeV or not, and the luciferase report assay was used to measure the luciferase activities. (C) Effects of PHB1 mutants on the virus titers of the PR8 H1N1 virus. A549 cells transfected with PHB1 or PHB1 mutants were infected with the PR8 H1N1 virus at an MOI of 0.01. Cell supernatants were collected at the indicated time points. Virus titers were determined by TCID₅₀ on MDCK cells (means ± SD from three independent experiments). (D and E) The co-purification between PHB1 mutants and IRF3. HEK293T cells were co-transfected with Flag-PHB1 or PHB1 mutants (D) with HA-IRF3 or (E) not for 24 h. Co-IP was performed using an anti-Flag antibody, followed by western blot to detect PHB1 or PHB1 mutants and IRF3 using anti-Flag, anti-HA, or anti-IRF3 antibodies, respectively. (ns, P > 0.05; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

DISCUSSION

In this study, we found that the IFN-β promoter activities stimulated by RIG-I, MAVS, TBK1, IKK-ε, or IRF3 were all restrained by PHB1 overexpression (Fig. 4). RIG-I and MAVS serve as upstream adaptor molecules for both IFN-β and NF-κB signal pathways (33, 39). We mainly explored how PHB1 affects the production of IFN-β induced by viruses, but the interaction between PHB1 and the NF-κB signal pathway was not investigated. However, previous studies have shown that overexpression of PHB1 in epithelial cells reduces the activation of NF-κB induced by TNF-α (40, 41), suggesting a potential role for PHB1 in regulating the NF-κB-mediated signal pathway. PHB1 protein and mRNA levels were upregulated in response to IFN-β production triggered by virus infection and poly(I:C) stimulation. Simultaneously, no obvious changes in PHB1 protein and mRNA levels were observed in SeV-infected Vero and MAVS-deficient MDCK cells, indicating that the increased PHB1 protein and mRNA levels were induced by IFN-β (Fig. 2). However, the mechanism underlying the induction of PHB1 by IFN-β and its specific targeting of IRF3 nucleus import during virus infection remains unknown. It is possible that PHB1 expression is regulated by transcription factors involved in the IFN-β signaling pathways. By exploring the PHB1 promoter sequence, we identified binding sites for known transcription factors involved in IFN-β expression (42 – 44), such as STAT1 and P53 (Fig. S3), which may contribute to the increased PHB1 protein and mRNA levels after virus infection and poly(I:C) stimulation. Further exploration of the role of PHB1 in innate immunity can reinforce our understanding of host antiviral effects.

Once the IRF3-IRF3 homodimer and IRF3-IRF7 heterodimer are formed, IRF3 is transported into the nucleus and subsequently functions in activating the IFN production pathway (45, 46). The amino acid sequences corresponding to the nuclear import recognition signal on protein cargo are known as NLS. In the case of IRF3, the NLS residues are located within amino acids 64–131, and KR77/78 and the RK86/87 clusters together constitute the bipartite NLS of IRF3 (46, 47). Our study proved that the NLS (64-131) of IRF3 was the key domain interacting with PHB1, importin α1, and importin α5 (Fig. 7), indicating that PHB1 restrained the nucleus import of IRF3. However, it remains unclear whether the two key basic amino acid clusters KR77/78 and RK86/87 were the specific sites for the interaction between PHB1 and IRF3. As a macromolecular protein, IRF3 enters the nucleus with the assistance of the nuclear transport protein importin α (38, 48). Previous studies have suggested that nucleus import of IRF3 is inhibited by weakening the binding of IRF3 with importin α3 or importin α4 (19, 49). However, importin α1 also plays an essential role in binding with IRF3 and facilitating its translocation into the nucleus (16). In our study, we found that PHB1 interacted with IRF3, impairing its binding to importin α1 and importin α5 (Fig. 7), thereby suppressing the translocation of IRF3. Collectively, IRF3 may form complexes with different importin proteins in vivo and exhibit different preferences under various conditions caused by different virus infections. Further investigation into the mechanism of IRF3 binding with importins will promote an understanding of the IRF3 nuclear translocation process.

PHB1 and its homologous subunit PHB2 constitute the PHB complex, which is located in various cellular components and implicated in diverse biological processes (20), so that PHB1 cannot be knocked out completely by CRISPR-Cas9 technology in our study. The Prohibitin complex is mainly located in the mitochondria, and PHB2 acts as an inner mitochondrial membrane mitophagy receptor (50, 51), indicating an interaction between the Prohibitin complex and mitophagy. Although PHB1 indirectly interacts with LC3-II, the functional LIR domain (amino acids 121–124) responsible for mitophagy in PHB2 is conserved in PHB1 (51). This conservation suggests that PHB1 may also share a similar function in mitophagy as PHB2. Simultaneously, the activation of MAVS triggers IFN responses, and distinct mitophagy pathways can be harnessed by viruses to attenuate type I IFN responses (52, 53). Collectively, PHB1 may facilitate mitophagy to degrade MAVS and subsequently suppress the production of IFN-β. Meanwhile, PHB1 has also been reported to restrain mitochondrial DNA release and the subsequent activation of the cGAS-STING signal pathway by binding to mitochondrial membrane proteins (54), providing an alternative explanation that sheds light on the relationship between PHB1 and IFN-β signal pathway. Based on the cellular localization of PHB1, it is possible that PHB1 regulates type-I interferon production through both the RIG-I-MAVS and cGAS-STING pathways, which could be further explored.

Here, we have uncovered a previously unknown function of PHB1 that is associated with the host’s antiviral innate immune responses. PHB1 protein and mRNA levels were upregulated by virus-induced IFN-β, and PHB1 interacted with importin α1 or importin α5 to restrain its binding ability to phosphorylated IRF3, impeding the nucleus import of IRF3 and subsequently inhibiting the production of IFN-β, thereby promoting virus replication (Fig. 9). Taken together, PHB1 serves as a negative regulator for the host to prevent excessive immune and inflammatory responses induced by viruses, which facilitates the understanding of negative regulation mechanisms of the host’s innate immunity.

FIG 9.

Proposed model for the role of PHB1 in the IFN-β signal pathway. RNA viral infections induce IFN-β production and subsequently increase the mRNA and protein levels of PHB1. In return, PHB1 restrains the IFN-β signal pathway by inhibiting the nucleus import of IRF3, ultimately facilitating virus replication.

MATERIALS AND METHODS

Cells and viruses

Madin-Darby canine kidney (MDCK) cells, African green monkey kidney (Vero) cells, and MAVS-deficient MDCK cells, kindly provided by Dr. Anding Zhang (Huazhong Agricultural University, China), were maintained in Dulbecco’s modified Eagle’s medium (Gibco, New York, USA). HEK293T and A549 were maintained in Roswell Park Memorial Institute-1640 medium and Ham’s F12 nutrient medium (F12) (HyClone, Beijing, China), respectively. All media were supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech, Germany), and cells were cultured at 37°C in a humidified atmosphere with 5% CO₂. All the cell lines listed above were purchased from the American Type Culture Collection (Manassas, VA, USA).

Influenza A/Puerto Rico/8/1934 (PR8, H1N1) and SeV were preserved in our laboratory. The recombinant VSV-GFP was a gift from Harbin Veterinary Research Institute (Harbin, China).

Plasmids and small interfering RNAs

For the construction of p3XFlag-CMV-PHB1 (Flag-PHB1), the full-length cDNA of PHB1 (GenBank accession number NM_001281496) was amplified by PCR and then cloned into the vector p3XFlag-CMV (Flag) digested by EcoRI/KpnI. The PHB1 truncations (PHB1-ΔC, PHB1-ΔN, PHB domain, and ΔPHB domain) were constructed by PCR using PrimerSTAR (R010Q; TaKaRa, Tokyo, Japan). IRF3 truncations GFP-IRF3-NLS and GFP-IRF3_ΔNLS were inserted into the pEGFP-N1 or pcDNA3.1 vectors. The PCR primer sequences used in this study are listed in Table 1. Flag-RIG-I, -MAVS, -TBK1, -IKKε, and -IRF3 expression plasmids were kindly provided by Professor Zhengfan Jiang (Peking University, Beijing, China). The IFN-β-luc and Renilla control of pRL-TK plasmids were gifts from Professor Ping Qian (Huazhong Agricultural University, Wuhan, China). The luc reporter plasmid for the ISRE promoter (ISRE-luc) was constructed by our laboratory. siRNAs targeting PHB1 (si-PHB1) were used to knock down PHB1, and the si-PHB1-3 sequence used in the study was as follows: 5′-CAGAAGCGGUGGAAGCCAATT-3′; a nontarget siRNA (si-NC) was used as a negative control. All the siRNAs used in this study were synthesized by GenePhama (GenePhama, Shanghai, China).

TABLE 1.

Primers used for PCR

Name	Sequences (5′ to 3′)
PHB1-F	CGGAATTCAATGGCTGCCAAAGTGTTTGAGT
PHB1-R	GGGGTACCGACTGGGGCAGCTGGAGGAGCAC
PHB1-ΔN-F	CGGAATTCAATGCGATTCCGTGGAGTGCAG
PHB1-ΔN-R PHB1-ΔC-F	GGGGTACCGACTGGGGCAGCTGGAGGAGCAC CGGAATTCAATGGCTGCCAAAGTGTTTGAGT
PHB1-ΔC-R	CGGAATTCGACAGATGTGTCAAGGACACGTCATCC
PHB domain-F PHB domain-R ΔPHB domain-M-F ΔPHB domain-M-R	CGGAATTCAATGCGATTCCGTGGAGTGCAG GGGGTACCGACAGATGTGTCAAGGACACGTCATCC GCTGTCATCTTTGACACCTTCGGGAAGGAGTTCACA CTCCTTCCCGAAGGTGTCAAAGATGACAGCTCTGTG
IRF3-NLS-F	CCCTCGAGATGTATGTTCCCGGGAGGGATAAGC
IRF3-NLS-R IRF3-ΔNLS-M-F IRF3-ΔNLS-M-F	CGGAATTCGACTGCCTCCACCATTGGTGTCCGGA CACTGGTGCAACTTCTGATACCCAGGAAGAC TATCAGAAGTTGCACCAGTGGCCTCGGCCCAGGCCT

Antibodies and reagents

Antibodies used for western blot, immunoprecipitation, and indirect immunofluorescence assays included the following: anti-Flag mouse monoclonal antibody (F3165; Sigma, St. Louis, MO, USA), anti-HA and -GAPDH mouse monoclonal antibodies (PMK013C and PMK043F; PMK Bio, Wuhan, China), anti-NP rabbit polyclonal antibody (GTX125989; GeneTeX, Irvine, CA, USA), anti-IRF3 rabbit monoclonal antibody (11904; CST, Boston, MA, USA), anti-GFP rabbit monoclonal and anti-Ser386 phosphorylated IRF3 rabbit polyclonal antibodies (AE078 and AP0091; ABclonal, Wuhan, China), anti-PHB1 rabbit polyclonal antibody (ab28172; Abcam, Boston, MA, USA), anti-PHB1 mouse monoclonal antibody (60092-1-Ig; Proteintech, Wuhan, China), anti-TOMM20 rabbit polyclonal antibody (11802-1-AP; Proteintech), anti-LaminA/C rabbit polyclonal antibody (10298-1-AP; Proteintech), HRP goat anti-rabbit IgG (H + L) and HRP goat anti-mouse IgG (H + L) (AS014 and AS003; ABclonal), HRP goat anti-rabbit IgG HCS and HRP goat anti-mouse IgG HCS (A25222 and A25112; Abbkine, Wuhan, China), HRP mouse anti-rabbit IgG LCS and HRP goat anti-mouse IgG LCS (A25022 and A25012; Abbkine), and Alexa Fluor 488-conjugated Affinipure goat anti-rabbit and Alexa Fluor 594-conjugated Affinipure goat anti-mouse secondary antibodies (SA00006-2 and SA00006-3; Proteintech). The small-molecule compounds used in this study were DAPI (C1002; Beyotime, Shanghai, China), poly(I:C) (31852-29-6; Sigma, and human IFN-β proteins (10704-HNAS; Sino Biological Inc., Beijing, China).

Transfection

Transfections were performed using Lipofectamine 2000 (11668019; Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions (55). Plasmids or siRNAs and Lipofectamine were diluted in equal volumes with Opti-MEM, respectively, and incubated for 5 min at room temperature. The diluted Lipofectamine and the diluted plasmids or siRNAs were mixed and incubated for 20 min at room temperature. Then, the mixtures were added to the cells and incubated for 6 h, after which the cells were cultured in fresh medium supplemented with 10% FBS.

Virus infection and virus titration

Cells transfected with plasmids or siRNAs were infected with viruses (IAV, JEV, VSV-GFP, and SeV) for 1 h and washed three times with PBS (SH30256.01; HyClone, Shanghai, China). The medium was replaced with either F12 or 1640 medium and incubated in a 37℃, 5% CO₂ cell incubator. The cell supernatants and cells were collected at different time points. Viral supernatants were serially diluted and added to each well, with eight replicates for each dilution. The TCID₅₀ was calculated at 72 hpi using the Reed-Muench method (56).

Co-IP and western blot assay

HEK293T cells were transfected with the indicated plasmids for 24 h and then washed with cold PBS. Cells were lysed with cell lysis buffer (P0013; Beyotime) containing a complete protease inhibitor cocktail (B14001; Biotool, South San Francisco, CA, USA) at 24 to 48 hpi. The lysates were pretreated with 20 µL of magnetic beads (HY-K0202; MCE, Shanghai, China) for 1 h at 4°C, and then the beads were removed by centrifugation. Next, 2 to 3 µg of the indicated antibody was added to the pretreated lysates and incubated at 4°C for overnight. Magnetic beads were added to the lysates and incubated at 4°C for another 2 h with rotation. The magnetic beads were collected by centrifugation and washed five times with lysis buffer. The immunoprecipitated proteins and the remaining cell lysates were subjected to western blot analysis. Images were obtained using an ECL detection system (Tanon-5200; Tanon, Shanghai, China).

IFA and confocal microscopy analysis

Briefly, cells were fixed with 4% paraformaldehyde for 10 min, treated with 0.2% Triton X-100 for 10 min, and then incubated with 1% bovine serum albumin for 1 h at room temperature. Then, samples were incubated with the indicated primary antibody for 2 h at room temperature or overnight at 4°C, followed by incubation with the appropriate Alexa Fluor-conjugated secondary antibody, and stained with DAPI to visualize the nucleus. Images were acquired using confocal microscopy (LSM880; Carl Zeiss, Oberkochen, Germany).

Flow cytometry assay

HEK293T cells were transfected with Flag-PHB1 or Flag empty vector for 24 h and infected with VSV-GFP at amultiplicity of infection (MOI) of 0.1. At 24 hpi, the cells were fixed with 4% formaldehyde for 10 min, washed twice with PBS, and subjected to the detection of the fluorescence intensity of GFP by a flow cytometer (Cytoflex LX; Elementar, UK).

Luciferase reporter assay

pRL-TK (10 ng/well), IFN-β-luc or ISRE-luc (0.5 µg/well), and the target plasmid (less than 1 µg/well) were transfected into HEK293T cells in 12-well plates. To stimulate these promoters’ luciferase activity, the RIG-I, MAVS, TBK1, IKKε, and IRF3 expression plasmids (0.25 µg/well) were co-transfected or infected with SeV. At 12 or 24 hpi, cells were lysed in 100 µL of 1× passive lysis buffer. The luciferase activity and Renilla activity were measured using a Dual-Luciferase Assay Kit (E1910; Promega, Madison, WI, USA) according to the manufacturer’s instructions. All experiments were performed in triplicate and repeated at least three times.

qRT-PCR

Cells were lysed with TRIzol reagent (Invitrogen, Waltham, MA, USA), and total RNA was extracted according to the manufacturer’s instructions. Then, the RNA was reversely transcribed into cDNA using reverse transcriptase (AMV XL; TaKaRa, Tokyo, Japan). Real-time PCR (ViiA7; ABI, USA) was performed using FastStart Universal SYBR green master (Roche). The PCR conditions were as follows: 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 15 s at 95°C, and 1 min at 60°C. The mRNA levels of the target genes were normalized to the housekeeping gene GAPDH. The primer sequences used for qRT-PCR are shown in Table 2.

TABLE 2.

Primers used for qRT-PCR

Name	Sequences (5′ to 3′)
GAPDH-F	GCTAAGGCTGTGGGCAAGG
GAPDH-R	GGAGGAGTGGGTGTCGCTG
PHB1-F	TGTCATCTTTGACCGATTCCG
PHB1-R SeV-M-F	CTGGCACATTACGTGGTCGAG GTGATTTGGGCGGCATCT
SeV-M-R	GATGGCCGGTTGGAACAC
IFN-β-F IFN-β-R	GCTCCTGTGGCAATTGAATGG TTGGCCTTCAGGTAATGCAG
ISG15-F	TGGACAAATGCGACGAACC
ISG15-R IFIT2-F IFIT2-R IFITM3-F IFITM3-R Mx1-F Mx1-R	GCCCGCTCACTTGCTGCTT GGTCTCTTCAGCATTTATTGGTG TGCCGTAGGCTGCTCTCCA GGGACAGGAAGATGGTTGG CACTGGGATGACGATGAGC CCGAGGGAGACAGGACCAT CGTGGCCTTTCCTTCCTCC

Nuclear and cytoplasmic fractionation

A total of 10⁶ A549 cells were collected and washed with cold PBS, then lysed with 100 µL of cytoplasmic extraction buffer [10 mM HEPES, 10 mM KCl, 2 mM Mg(Ac)₂, 3 mM CaCl₂, 340 mM sucrose, 1 mM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF), pH 7.9] on ice for 20 min, followed by the addition of NP-40 (Amresco, Solon, OH, USA) to a final concentration of 0.25% (vol/vol) on ice for 2 min. The samples were then vortexed for 15 s and then centrifuged for 10 min at 3,500 × g at 4°C. Supernatants, as the cytoplasmic fraction, were collected and stored at −80°C. Pellets were dissolved in 80 µL nuclear extraction buffer [50 mM HEPES, 500 mM NaCl, 1.5 mM MgCl₂, 0.1% (vol/vol) Triton X-100, 1 mM DTT, and 1 mM PMSF, pH 7.9), incubated on ice for 10 min, and then centrifuged at 14,000 × g for 10 min at 4°C. The supernatants, as the nuclear fraction, were collected and stored at −80°C.

Statistical analysis

The data are presented as the means ± standard deviations (SD) from at least three independent experiments. Statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc.). Statistical significance is calculated using Student’s two-tailed unpaired t-test (ns, P > 0.05; *, P < 0.05; **, P < 0.01; ***, P < 0.00; ****, P < 0.0001).

DATA AVAILABILITY

All data are included within the article.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.00926-23.

Fig. S1. jvi.00926-23-s0001.docx.

Fig. S1 and figure legend.

Fig. S2. jvi.00926-23-s0002.docx.

Fig. S2 and figure legend.

Fig. S3. jvi.00926-23-s0003.docx.

Fig. S3 and figure legend.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.