Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2023 Sep 21;97(10):e01063-23. doi: 10.1128/jvi.01063-23

Genetic signatures associated with the virulence of porcine epidemic diarrhea virus AH2012/12

Qi Peng 1,2,3,#, Baochao Fan 1,3,4,#, Xu Song 1,5,#, Wenlong He 1,5, Chuanhong Wang 1,6, Yongxiang Zhao 1,3, Weilu Guo 1,7, Xue Zhang 1,3,8, Shiyu Liu 1,3,8, Jie Gao 1,3, Kemang Li 1,3, Baotai Zhang 1,9, Jinzhu Zhou 1,3, Yunchuan Li 1,3, Rongli Guo 1,3, Bin Li 1,3,4,✉
Editor: Tom Gallagher10
PMCID: PMC10617547  PMID: 37732788

ABSTRACT

Porcine epidemic diarrhea virus (PEDV) is a highly pathogenic swine coronavirus causing severe diarrhea and high mortality to piglets. PEDV strain AH2012/12 isolated from a diarrheal piglet has been passaged in vitro for over 102 passages. Viral infection assay revealed that PEDV AH2012/12-P102 (the 102nd passage of AH2012/12) showed an enhanced fusogenicity than the wild-type AH2012/12. Animal experiments demonstrated that AH2012/12-P102 is an attenuated PEDV strain as shown by the evidence of no mortality, extremely low virus shedding, and no sign of diarrhea in the AH2012/12-P102 challenged piglets. Compared with AH2012/12, AH2012/12-P102 had two obvious deletions in the genome, one deletion is in the S1 gene and the second deletion contains the carboxy-terminus of the S2 gene and the start codon of ORF3. Using the reverse genetic system of PEDV, we generated a series of recombinant PEDVs with deletions based on the deletion in the genome of AH2012/12-P102. Viral infection assays indicated that the second deletion could enhance the fusogenicity of PEDV AH2012/12. Animal experiments showed that the first deletion could reduce the virulence but not fully attenuate AH2012/12, but the second deletion could attenuate PEDV AH2012/12 in vivo. Further animal experiments indicated that the recombinant PEDV with deleted carboxy-terminus of S gene induced higher IgG, IgA, neutralization antibodies, and protection effects against virus challenge than the killed vaccine. Collectively, our data demonstrated two genetic features associated with the virulence of PEDV AH2012/12 and provided a promising method for the development of attenuated vaccine candidates for PEDV.

IMPORTANCE

Porcine epidemic diarrhea (PED) caused by PED virus (PEDV) remains a big threat to the swine industry worldwide. Vaccination with live attenuated vaccine is a promising method to prevent and control PED, because it can elicit a more protective immunity than the killed vaccine, subunit vaccine, and so on. In this study, we found two obvious deletions in the genome of a high passage of AH2012/12. We further confirmed the second deletion which contains seven amino acids at the carboxy-terminus of the S2 gene and the start codon of ORF3 can reduce its pathogenicity in vivo. Animal experiments indicated that the recombinant PEDV with deleted carboxy-terminus of S gene showed higher IgG, IgA, neutralization antibodies, and protection effects against virus challenge than the killed vaccine. These data reveal that the engineering of the carboxy-terminus of the S2 gene may be a promising method to develop live attenuated vaccine candidates of PEDV.

KEYWORDS: PEDV, reverse genetics, S gene, pathogenicity, fusogenicity

INTRODUCTION

Porcine epidemic diarrhea (PED) is a highly contagious swine enteric disease, which causes up to 100% mortality in pigs under the age of 1 week old. The causative agent of PED is the PED virus (PEDV). Since late 2010, highly virulent PEDVs emerged in China and swept most of the pig farms in China (1). Except for China, variant PEDVs also spread to other Asian countries, including North and South America, and Europe, causing significant economic losses to the swine industry worldwide (2, 3). During the first year of PED outbreaks in the USA, about 10% of the piglets (seven million) were dead because of PED (4, 5). Until now, PED is still one of the most important swine diseases affecting the swine industry in the world (6, 7).

The causative agent, PEDV, belongs to the alphacoronavirus genus in the family of Coronaviridae (8). The genome of PEDV is approximately 28 kb which contains at least seven open reading frames (ORFs), encoding pp1a, pp1ab, spike (S), ORF3, envelope (E), membrane (M), and nucleocapsid (N) proteins (9). The pp1a and pp1ab are cleaved to yield 16 nonstructural proteins (nsp1 to nsp16) which are essential for genomic replication, transcription, translation, and viral protein processing (10). PEDV S protein is a type I membrane glycoprotein and can bind to specific cellular receptors to initiate early infection steps (11, 12). The S protein was divided into S1 and S2 subunits based on its functional domains (13). The S1 subunit is responsible for interaction with the host receptor to initiate virus infection and contains important neutralization epitopes (10, 14). The S2 subunit contains a fusion peptide to mediate virus-cell membrane fusion during virus entry and is responsible for the trypsin-enhanced virus infection in cell culture (15). The pathogenicity of PEDV is involved in multiple viral genes and the S gene is reported as one of the virulence genes. A previous study by Wang et al. suggested that S gene is the necessary determinant for the virulence of PEDV (16). Hou et al. demonstrated that deletion of 197 amino acids in the N-terminal of S could attenuate PEDV PC22A, but recombinant PEDV with this deletion could not elicit sufficient neutralization antibodies (17). The ORF3 of PEDV encodes the ion channel and is the only accessory protein for PEDV (18). Identification of virulence factors is valuable for rational design of live attenuated vaccines for PEDV, but only a small portion of virulent sites of PEDV were reported until now (17, 19, 20).

In this study, we passaged one variant PEDV strain AH2012/12 in vitro for over 102 passages and obtained one attenuated PEDV strain, AH2012/12-P102. The genomic comparison analysis revealed two different residue deletions located on the S gene. Using the reverse genetic system in our laboratory, we found that the S2 gene is also associated with the virulence of PEDV, and the seven-amino-acid deletion in the carboxy-terminus of S gene and disrupt ORF3 could reduce the virulence of PEDV AH2012/12 in vivo. And the recombinant PEDV with deleted carboxy-terminus of S exhibited the potential as a candidate strain for attenuated vaccine.

RESULTS

Characterization of PEDV AH2012/12 and its high passage, AH2012/12-P102

Serial passaging virus in vitro is a commonly used method to attenuate PEDV. The PEDV strain, AH2012/12, has been passaged in Vero cells for over 102 passages. Then, we compared the complete genome sequences of AH2012/12 with AH2012/12-P102 to identify genetic characteristics associated with the pathogenicity of PEDV AH2012/12 (Table 1). Compared with AH2012/12, two distinct continuous nucleotide deletions were observed in the PEDV genome, a six-nucleotide-deletion in the S1 subunit gene and a carboxy-terminal deletion in the S2 subunit which disrupts the start codon of ORF3 gene (Fig. 1A and B). Moreover, PEDV AH2012/12-P102 shows distinct biological characteristics with AH2012/12 in Vero cell. As shown in Fig. 1C and D, PEDV AH2012/12-P102 formed extremely large plaques than AH2012/12 in Vero cell culture. The one-step growth curves also indicated these two viruses exhibit different growth kinetics in Vero cell culture (Fig. 1E). AH2012/12-P102 rapidly reached its highest infectious titer (105.9 TCID50/mL) at 36 h post-infection (hpi). Although AH2012/12 strain reached the highest infectious titer (105.6 TCID50/mL) at 48 hpi. These results indicated that the high passage, AH2012/12-P102, was highly adapted to and replicated more efficiently in Vero cells.

TABLE 1.

Amino acid and nucleotide changes between AH2012/12 and AH2012/12-P102

Genomic region Nucleotide a Amino acid b
Position AH2012/12 AH2012/12P102 Position AH2012/12 AH2012/12P102
5′UTR (1–292) − c − − − − −
ORF1a (293–12,646) − − − − − −
ORF1b (12,601–20,637) − − − − − −
Spike (20,634–24,791) 20,797–20,802 TTGGTG Deletion 55–57 IGE K
21,695 T A 354 D E
21,811 C T 393 P L
21,986 C T − − −
22,932 T C 767 S P
23,294 T G 887 S R
24,691 G T 1353 C F
24,769–24,789 TTGAAAAGGT
CCACGTGCAGT 		Deletion 1,379–1,385 FEKVHVQ Deletion
ORF3 d / / / / / /
Envelope (25,443–25,673) − − − − − −
Membrane (25,681–26,361) − − − − − −
Nucleocapsid (26,373–27,698) 27,321 T G 317 S A
27,417 G A 349 V I
27,689 T A − − −
3′UTR (27,699–28,032) 27,819 C T − − −
Open in a new tab
a

The nucleotide position was corresponding to PEDV strain AH2012/12 (GenBank accession no. KU646831).

b

Synonymous mutations were not shown. The amino acid position is corresponding to each respective open reading frame.

c

No nucleotide or amino acid change occurred.

d

ORF3 was deleted in the genome of PEDV AH2012/12-P102.

Fig 1.

Fig 1

Open in a new tab

Characterization of wild-type PEDV AH2012/12 and its 102nd passage strain, AH2012/12-P102. (A) Schematic diagram of the PEDV AH2012/12-P102 genome. (B) Comparison of the partial nucleotide sequence of S gene between parental PEDV AH2012/12 and AH2012/12-P102. (C) and (D) Comparison of the plaque diameter and morphology between PEDV AH2012/12 and AH2012/12-P102 in Vero cells. Properly diluted PEDV AH2012/12 and AH2012/12-P102 were incubated with monolayer Vero cells in 12-well plates for 1.5 h, then the plates were washed two times with PBS and overlaid with 1.5% methylcellulose containing 50% 2 × DMEM, 5 µg/mL trypsin, and 37.5 µg/mL pancreatin. At 48 hpi, the cells were subjected to 0.1% crystal violet staining. Quantification of the diameter of each virus was performed in 21 random plaques. Data are expressed as mean ± SD. An unpaired Student’s t test was used to evaluate the statistical significance. Red arrows indicated representative plaques. (E) Growth kinetics of PEDV AH2012/12 and AH2012/12-P102 in Vero cells. Vero cells infected with 0.1 MOI of PEDV AH2012/12 or AH2012/12-P102 were harvested at indicated time points, then the samples were subjected to determination of the infectious titer of PEDV by TCID50.

Evaluation of the pathogenicity of PEDV AH2012/12-P102

Two-day-old piglets were chosen to assess the pathogenicity of PEDV AH2012/12-P102 by orally inoculating with AH2012/12-P102, AH2012/12, or Dulbecco’s modified Eagle’s medium (DMEM), respectively. Two and three piglets died at 1 and 2 days post-challenge (dpc) in AH2012/12 challenged group, respectively (Fig. 2A). All the piglets in AH2012/12 group displayed severe diarrheal symptoms at 1 dpc (Fig. 2B and C). Virus shedding analysis revealed that virus nucleotide acid could be detected within 1 day post-infection (dpi) and increased at 2 dpc. At necropsy, transparent, thin-walled, and gas-distended intestines were observed in AH2012/12 challenged piglets (Fig. 2D). Hematoxylin-eosin (H&E) and immunohistochemistry (IHC) examinations revealed severe villous atrophy in the intestines and the PEDV N antigen was distributed in the epithelial cells of the small intestines (Fig. 2E). However, no piglets died in AH2012/12-P102 challenged group, and almost no virus could be detected by real-time quantitative (RT-qPCR) in the intestines. Necropsy analysis revealed that no changes in the intestines between AH2012/12-P102-challenged group and the piglets in the mock group. These results demonstrated that PEDV strain AH2012/12-P102 is an attenuated PEDV strain.

Fig 2.

Fig 2

Open in a new tab

Evaluation of the pathogenicity of PEDV AH2012/12 and AH2012/12-P102. (A) Survival rate of piglets. (B) Detection of viral RNA in fecal swabs by RT-qPCR. (C) Evaluation of fecal consistency of piglets. (D) Representative clinical sign and gross examination of challenged piglets. (E) H&E staining and IHC analysis of small intestines of challenged piglets. Red arrows indicated damaged intestinal villus. Black arrows indicated the PEDV antigen detected by IHC.

Construction and characterization of recombinant PEDVs

The genomic comparison showed two distinct nucleotide deletions in the PEDV AH2012/12-P102 genome (Table 1). To evaluate whether these deletions are responsible for the virulence reduction in PEDV attenuated strain AH2012/12-P102, we constructed four recombinant viruses, including rAH2012/12, rAH2012/12-δS1, rAH2012/12-δS2, and rAH2012/12-δS1S2, using the reverse genetic system of AH2012/12. PEDV rAH2012/12 is the original infectious clone of the wild-type PEDV AH2012/12. PEDV rAH2012/12-δS1 and rAH2012/12-δS2 are infectious clones with deletion in the S1 gene and the carboxy-terminal of the S2 gene, respectively. PEDV rAH2012/12-δS1S2 is the infectious clone with both deletions (Fig. 3A). After the construction of the recombinant BAC plasmids with CRISPR/Cas9 technology, the recombinant BAC plasmids were transfected into Vero cells to rescue the recombinant viruses. The recombinant viruses were successfully recovered from Vero cell culture as the evidence of cytopathic effects in Vero cells. As shown in Fig. 3B and C, the recombinant PEDVs can react with PEDV S polyclonal antibody, and sequencing results also confirmed the expected deletions in the genome, indicating the successful recovery of the recombinant viruses.

Fig 3.

Fig 3

Open in a new tab

Construction and identification of recombinant PEDVs. (A) Strategy to construct recombinant PEDVs by CRISPR/Cas9 technology. (B) Identification of the recombinant PEDVs by Sanger sequencing. The shaded region indicates the gene was deleted in the AH2012/12-P102 genome. (C) Identification of the recombinant PEDVs by IFA. Monolayers of Vero cells in 24-well plates were infected with corresponding PEDV at 0.1 MOI, then the plates were incubated at 37°C for 1.5 h. After washing the plates with PBS two times, the plates were added with 500 µL of DMEM containing 5 µg/mL trypsin and 37.5 µg/mL pancreatin. At 24 hpi, the samples were collected for indirect immunofluorescence assay (IFA). The cell nuclei were stained with 0.01% 4′,6-diamidino-2-phenylindole (DAPI). Scale bar, 100 µm.

After obtaining the recombinant viruses, we biologically characterized the recombinant PEDVs in Vero cells. Unexpectedly, we found the deletion in the carboxy-terminus of the S2 gene showed a stronger fusogenicity than the parental strain rAH2012/12 and rAH2012/12-δS1. As shown in Fig. 4A and B, the recombinant PEDVs with amino acid deletions in the C-terminal of the S2 gene can form extremely larger (about 2.5-fold) plaques than the other two viruses. Immunofluorescence assay (IFA) results also indicate that more cell nuclei (about fourfold) in a single syncytium of the recombinant viruses with deletion in the carboxy-terminal of S gene than in other recombinant viruses (Fig. 4C and D). Growth kinetics showed that all the recombinant viruses reached the highest infectious titer (about 105.42 TCID50/mL) at 48 hpi, but recombinant PEDVs with deletion in the carboxy-terminus showed slightly higher titer before 24 hpi (Fig. 4E).

Fig 4.

Fig 4

Open in a new tab

Characterization of the recombinant PEDVs in vitro. (A) Comparison of the plaque morphology of recombinant PEDVs in Vero cells. Monolayers of Vero cells in 12-well plates were infected with 10-fold serial diluted virus stocks. After absorption at 37°C for 1.5 h, the plates were washed two times with PBS and overlaid with 1.5% methylcellulose containing 50% 2 × DMEM, 5 µg/mL trypsin, and 37.5 µg/mL pancreatin. At 48 h post-infection (hpi), the cells in plates were fixed with 4% formaldehyde and stained with 0.1% crystal violet. Arrows indicate the representative plaques induced by PEDV in Vero cells. (B) Comparison of the plaque diameter of different recombinant viruses under a microscope at 48 hpi. ****, P < 0.0001; ns, no significance. (C) Observation of the representative syncytium from different recombinant viruses in Vero cells at 24 hpi. Scale bar, 100 µm. (D) Comparison of the cell number of each syncytium from different recombinant viruses in Vero cells at 24 hpi. ****, P < 0.0001; ns, no significance. (E) Monolayers of Vero cells in 12-well plates were infected with a multiplicity of infection of 0.1 of each virus. After incubation of the plates at 37°C for 1.5 h, the plates were washed two times with PBS and added with 1 mL of DMEM containing 5 µg/mL trypsin and 37.5 µg/mL pancreatin. The samples were collected at indicated time points for titration of the infectious titer of the virus with 50% tissue culture infectious doses (TCID50).

Comparison of the virulence of the recombinant PEDVs

To determine whether the two separate deletions are involved in the virulence reduction of PEDV AH2012/12-P102, 30 2-day-old piglets were divided into five groups with six pigs per group. The piglets were orally inoculated with 2 × 105 TCID50 of each corresponding virus (rAH2012/12, rAH2012/12-δS1, rAH2012/12-δS2, and rAH2012/12-δS1S2) or mock-inoculated with DMEM. A portion of piglets in rAH2012/12-challenged group started to display diarrhea at 12 h post-challenge (hpc) and all the piglets showed severe diarrhea accompanied by lethargy and dehydration after 1 dpc during the study (Fig. 5A). In rAH2012/12-δS1-challenged group, one piglet exhibited moderate diarrhea symptoms with semiliquid feces within 1 dpc and another piglet had pasty feces during 12–24 hpc, but all the piglets showed severe diarrhea at 2 dpc. The mortalities of piglets in rAH2012/12 and rAH2012/12-δS1 challenged groups are both 100% (Fig. 5B and C). The rectal swabs collected from the challenged piglets were subjected to viral RNA extraction and RT-qPCR. The highest fecal RNA was detected at 2 dpc in rAH2012/12 and rAH2012/12-δS1 challenged groups, but the virus shedding of rAH2012/12-δS1 group (5.299 ± 0.4503 log10 GE/mL) is lower than rAH2012/12 group (6.505 ± 1.699 log10 GE/mL). However, very low viral RNA from the fecal swabs in rAH2012/12-δS2 and rAH2012/12-δS1S2 challenged groups (Fig. 5D). However, the piglets in rAH2012/12-δS2, rAH2012/12-δS1S2, and mock inoculation group showed normal and occasionally pasty feces, and no piglet was dead (Fig. 5E). Cytokines including IFN-λ, IFN-α, and IL-6 in the small intestines were detected by RT-qPCR. These results indicated that both attenuated PEDV and virulent PEDV can upregulate proinflammatory cytokine IL-6. The attenuated virus can promote the expression of IFN-λ but not IFN-α, which demonstrated that the type III interferon plays a key role in the attenuated virus infection (Fig. S1). Collectively, these results indicated that PEDV rAH2012/12 and rAH2012/12-δS1 are virulent, but rAH2012/12-δS2 and rAH2012/12-δS1S2 are attenuated PEDV strains. But the virulent PEDVs showed a different phenotype in regulation of type III interferon with attenuated PEDVs.

Fig 5.

Fig 5

Open in a new tab

Evaluation of the pathogenicity of recombinant PEDVs in 2-day-old piglets. Representative clinical sign of challenged piglets (A). Necropsy analysis of the small intestine of the piglets inoculated with recombinant PEDVs (B), and survival rate (C), virus shedding (D), and fecal consistency scores (E) of the inoculated piglets.

Histologic lesion observation and immunofluorescence assays

Gross examination showed that the infected piglets in both rAH2012/12 and rAH2012/12-δS1 challenged groups exhibited transparent, thin-walled intestines containing yellow watery contents (Fig. 5B). On the other hand, there were no evident lesions that could be observed in inoculated piglets in the rAH2012/12-δS2 and rAH2012/12-δS1S2 challenged groups. By microscopic examination, obvious histologic lesions, including severely and extensively scattered, disrupt and fusion villi of all small intestines, in the rAH2012/12 and rAH2012/12-δS1 challenged groups (Fig. 6). Compared with the mock inoculation group, the piglets in the rAH2012/12-δS2 and rAH2012/12-δS1S2 challenged groups showed no evident histologic changes in the small intestine (Fig. 6). To further characterize the pathogenicity of the recombinant viruses, the sections of the small intestines were subjected to IFA with anti-PEDV N monoclonal antibody. As shown in Fig. 7, the PEDV antigen was mostly distributed in the jejunum and ileum of the rAH2012/12 and rAH2012/12-δS1 infected piglets. However, no PEDV antigen was detected in the rAH2012/12-δS2 and rAH2012/12-δS1S2 challenged groups (Fig. 7). These results indicated that rAH2012/12-δS2 and rAH2012/12-δS1S2 are attenuated PEDV strains.

Fig 6.

Fig 6

Open in a new tab

Histopathological examination of the intestines of piglets challenged or mock-challenged with recombinant PEDVs. Different fragments of small intestines, including duodenum, jejunum, ileum, cecum, colon, and rectum were collected and trimmed for H&E staining. Scale bar, 100 µm.

Fig 7.

Fig 7

Open in a new tab

Detection of PEDV N antigen in different segments of the small intestines of piglets challenged or mock-challenged with recombinant PEDVs. PEDV N was labeled with red fluorescence and cell nuclei (blue) were stained with DAPI. Scale bar, 50 µm.

Immunogenicity evaluations of rAH2012/12-δS2 based vaccine candidates

Five-day-old piglets were immunized with vaccines at days 0 and 14, then the serum IgG, IgA, and neutralization titer were tested at 14 (first immunization) and 28 (second immunization) days post-immunization, respectively (Fig. 8A through C). The piglets immunized with the recombinant PEDV with deleted C-terminal of S2 (L-rAH2012/12-δ2) showed higher IgG, IgA, and neutralization antibodies than the killed vaccine (K-rAH2012/12) at first and second immunization. The results from the challenged studies showed that both the vaccines immunized groups showed a lower fecal score and virus shedding than the mock group, and the L-rAH2012/12-δ2 group exhibited the lowest fecal scores and viral load of fecal swabs (Fig. 8D and E).

Fig 8.

Fig 8

Open in a new tab

Challenge the piglets with virulent AH2012/12 strain after immunization with killed or attenuated vaccine. Serum samples were collected at 14 days after the primary and booster immunization to determine the levels of PEDV-S-protein-specific IgG (A), IgA antibodies (B), and neutralizing antibodies (C) against PEDV strain AH2012/12. The fecal scores (D), and viral shedding (E) in the feces after challenging the virulent PEDV strain AH2012/12. Gross lesions of the intestine and H&E staining, scale bar, 100 µm (F), and antigen detection of PEDV by immunofluorescent (G) of ultrathin-sectioned jejunums collected from mock, killed vaccine, and attenuated vaccine group, scale bar, 50 µm. Virus load in the jejunum segments from different groups of piglets (H).

At 6 dpc, two piglets were randomly selected from each group for necropsy examination. Necropsy analyses of the piglets showed thin wall intestine, and undigested yellow watery contents in the mock-immunized piglets, and fallen-off intestinal villi also can be seen in H&E staining sections in mock-immunized group (Fig. 8F). Immunofluorescence for PEDV-N confirmed the presence of virus in the cytoplasm of epithelial cells on atrophied villi in the jejunum segments of the control piglets, but only a small fraction of virus-positive cells was detected in the jejunum segments of the L-rAH2012/12-δ2 and K-rAH2012/12 immunized piglets (Fig. 8G). The viral loads in jejunum segments also exhibited high virus copies with about 108.1 genomic copies/g in mock piglets, low virus copies with about 105.9 genomic copies/g in K-rAH2012/12 immunized piglets, and the lowest virus copies with about 104.0 genomic copies/g in L-rAH2012/12-δ2 immunized piglets (Fig. 8H). These data suggested that both killed vaccine and attenuated vaccine can improve the performance of the piglets, but the rAH2012/12-δS2 based attenuated vaccine candidate showed a better immune protection against a virulent PEDV challenge.

DISCUSSION

Since late 2010, the re-emerging PED has decimated most swine farms in China, causing serious economic losses (21). PED is still one of the most important swine diseases worldwide (22). Vaccination is one of the most effective methods to control and prevent PED. Generally, live attenuated virus vaccines tend to elicit protective immunity more efficiently than inactivated virus vaccines, subunit vaccines, or DNA vaccines. Traditionally, continuing passaging virus in vitro is commonly used to develop live attenuated vaccine candidates, such as CV777, DR13, and AJ1102-R attenuated PEDV vaccines. However, unexpected mutations in the PEDV genome may compromise the immunogenicity of the virus during serially passaging PEDV in vitro (23). On the other hand, serially passaging of the virus in vitro is a time-consuming and labor-intensive procedure, so identifying the virulence factor is valuable for the rational design of live attenuated vaccine candidates.

Accumulated evidence has proved that the PEDV S gene is one of the virulent genes, especially the S1 subunit. Wang et al. constructed a recombinant attenuated PEDV strain with the backbone of a virulent PEDV strain BJ2011C substituted S gene from an avirulent PEDV strain, CHM2013 (16). Chen et al. showed that a PEDV attenuated strain, FJzz1, was achieved by serially passaging it in vitro for over 200 passages, and the S gene accounts for 74% of aa mutations (24).

Jengarn et al. reported a classical PEDV strain AVCT12, which also had nucleotide-deletion in the S gene and losses start codon of ORF3 (25), but whether the nucleotide-deletion is associated with the pathogenicity is unknown. Like PEDV AVCT12, we also found a same nucleotide deletion in the carboxy-terminus of the S2 subunit of PEDV AH2012/12-P102. But whether this nucleotide deletion was associated with the pathogenicity of PEDV is unknown. In our study, animal experiments confirmed that this site deletion can attenuate PEDV strain as showed by the evidence that (i) very low virus RNA shedding titer in feces (ii), no diarrhea-like symptoms in the challenged piglets, and (iii) almost no histopathology changes in the small intestines. Because spike protein is located on the surface of virion and is essential for virion assembly. Using the rabbit anti-PEDV S polyclonal antibody, we have performed indirect fluorescence assay using a confocal microscope when the recombinant PEDVs infected Vero cells for 8 h, the results indicated that less recombinant PEDVs with carboxy-terminus deletion of S2 in the cytoplasm than the recombinant PEDVs without the deletion, demonstrating the deletion in the carboxy-terminus of S2 may alter the assembly efficacy of virion (Fig. S2). So, we hypothesize that the low assembly efficacy may generate defective virions, which result in attenuating the virus in vivo. Previous studies have suggested that the carboxy-terminal of alphacoronavirus is responsible for the intracellular sorting of spike protein (26, 27). Lacking sorting signal of spike protein resulting in lower assembly efficacy in ERGIC. Second, intensive fusion in the rAH2012/12-δS2 and δS1S2 recombinant viruses causes significant intracellular membrane rearrangements, which may conversely interfere virion budding and egress process. The neutralization epitopes of PEDV are mainly located in the S1 subunit; thus, the changes in the S2 subunit may have no impact on the antigenicity of PEDV. So, live attenuated PEDV vaccine candidates can be obtained by simply deletion of the carboxy-terminus of the S2 subunit. As in this study, the immunogenicity of live attenuated rAH2012/12-δS2 vaccine was evaluated. Compared with the conventional inactivated vaccine, piglets immunized with rAH2012/12-δS2 induced higher levels of IgG, IgA, and neutralizing antibodies, as well as better protective effect. Among them, the improvement of IgA, the mucosal antibody level may be the key to high protective effect against lethal challenges (28). In addition, it should be noted that in the immunization of piglets with attenuated vaccine, we give priority to the immune route of intramuscular injection. Due to the low colonization ability of rAH2012/12-δS2 in the intestinal tract, the degree of immune response activated by oral pathway may be limited. The future oral attenuated vaccine needs to balance the demand between high colonization ability and low pathogenicity.

Compared to the parental rAH2012/12, the PEDV strain rAH2012/12-δS2 can form larger plaques in Vero cells, which indicates this deletion in the C-terminal of the S gene can enhance the fusogenicity of PEDV. The syncytium formation in infected cells is usually triggered as a result of the binding between S on the infected cells' surface and its receptor on adjacent cells. PEDV rAH2012/12-δS2 and δS1S2 are the recombinant PEDV with deletion in the carboxy-terminal of S2 protein. The carboxy-terminal of S2 protein was responsible for the intracellular sorting of spike protein. Lacking of sorting signal renders more spike proteins on the cell surface, which results in extensive cell-to-cell fusion. We also observed that the deletion in the carboxy-terminus of the S gene result in the loss of start codon of ORF3. ORF3 is a nonessential protein for the replication of PEDV, but can interact with many host factors to involve in many biological functions, such as endoplasmic reticulum, inhibiting type I interferon expression, enhancing cell autophagy, and so on. (29 – 31). Several studies have confirmed that ORF3 is not associated with the pathogenicity of PEDV (32, 33). Beall et al. also employed a reverse genetic system based on a US virulent PEDV strain PC22A to demonstrate ORF3 is not a virulent gene (34). We discovered that deletion of seven amino acids and loss of ORF3 start codon could attenuate PEDV, because only deletion of ORF3 can not attenuate PEDV, so the deletion in the spike protein may contribute to the attenuation of PEDV AH2012/12.

In summary, one attenuated PEDV strain, AH2012/12-P102, was obtained by serially passaging in vitro and showed distinct biological characteristics with its parental strain, including growth kinetics and plaque morphology. Compared with AH2012/12, PEDV strain AH2012/12-P102 had two obvious distinct deletions in the genome. We further found that the deletion in the carboxy-terminus of spike protein and disrupt ORF3 contributes to virulence reducing and enhancing fusogenicity. And the animal experiments indicated that the piglets immunized with the recombinant PEDV with deleted carboxy-terminus of S gene showed higher IgG, IgA, neutralization antibodies, and protection effect against virus challenge than the killed vaccine of parent strain. This study adds to our understanding of the pathogenicity of PEDV and provides valuable information for the rational design of live attenuated PEDV vaccine candidates.

MATERIALS AND METHODS

Cells, viruses, and antibodies

Vero cells (ATCC no. CCL-81) were cultured in DMEM containing 10% fetal bovine serum (Tianhang Biotech, Hangzhou, China). PEDV AH2012/12 strain (GenBank accession no. KU646831) and the 102nd passage of AH2012/12 (AH2012/12-P102) (GenBank accession no. ON262797) were propagated in Vero cell culture supplemented with 5 µg/mL trypsin (Sigma) and 37.5 µg/mL pancreatin (Sigma). Rabbit anti-PEDV spike protein polyclonal antibody was a gift kindly provided by Dr. Huixin Lin from Nanjing Agricultural University. Mouse anti-PEDV N protein monoclonal antibody was produced in our laboratory.

Construction of recombinant BACs

Recombinant BACs containing mutant PEDV genomes were constructed with the CRISPR/Cas9 technology as previously reported (35). Briefly, overlapping PCRs with forwarding primers (sgRNA-delF and sgRNA-delR for nucleotide deletion in S1, and sgRNA-de2F and sgRNA-de2R for nucleotide deletion in C-terminal of S gene) and a constant reverse primer scaffold oligo were performed to construct sgRNA templates. Then the PEDV AH2012/12 genomic cDNA in BAC plasmid was cleaved by incubation in a mixture containing 5 µg recombinant BAC plasmid, 5 µL of Cas9 nuclease (NEB), 10 µg sgRNAs, and 5 µL of 10 × NEBuffer 3.1 at 37°C for 2.5 h. The cleaved BAC plasmid was purified with a DNA Cycle Pure Kit (Omega Bio-Tek), then homologous recombinations using an Infusion Clone Kit (TaKaRa) were performed by incubation of the purified BAC plasmid with DNA fragments containing expected deletions at 50°C for 30 min. Finally, 10 µL of the reaction mixture was transformed into DH10B (Biomed) and the recombinant BAC plasmids were verified by sequencing. The primer sequences in this study are shown in Table 2.

TABLE 2.

Primer sequences used in this study

Primer ID Sequence (5′−3′)
PEDV-25F ATCTTCTGGCGTAATTCCACA
PEDV-25R CACCTTACCATGCACCAAAGT
PEDV-30F GCAGATTTAGAGCAGCGTTCA
PEDV-30R GGTGACAAGTGAAGCACAGAT
PEDV-N-F CCTCCGTTATAGGACTCGTACT
PEDV-N-R TTGGAATGATTGGCTTTTCAGA
Scaffold oligo AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
sgRNA-delF TTCTAATACGACTCACTATAGGCTTCTTTCCCTATATTAAGTTTTAGAGCTAGA
sgRNA-delR TTCTAATACGACTCACTATAGGGCTCAGTAGCAAATACATGTTTTAGAGCTAGA
S1-upF GAAGGCTTCTTTCCCTATAT
S1-downR ATTGGGCTCAGTAGCAAATA
S1-upR TAGGTAGATAACCGCCCAGT
S1-downF GAATTGACACCCTGGTTTTTAGGTAGATAACCGCCCAGT
sgRNA-de2F TTCTAATACGACTCACTATAGGTTAACATCGATGTAATCTGTTTTAGAGCTAGA
sgRNA-de2R TTCTAATACGACTCACTATAGGTGACCATTACATCACTTTGTTTTAGAGCTAGA
S2-upF CAACTACCAGAAGTAATCCCAGA
S2-downR GCAACGAAAGAGTTGCCAAAA
S2-upR ACATCTTTGACGACTGTGTCAAGCTTCGTAAGGTTGAAGTCTA
S2-downF GACACAGTCGTCAAAGATGT
IFN-λ3-F TTGGCCCAGTTCAAGTCTCT
IFN-λ3-R GAGCTGCAGTTCCAGTCCTC
IFN-α-F TTCTGCACTGGACTGGATC
IFN-α-R TCTGTGGAAGTATTTCCTCACAG
IL-6-F CTGGCAGAAAACAACCTGAACC
IL-6-R TGATTCTCATCAAGCAGGTCTCC
Open in a new tab

Rescue of the recombinant PEDVs

Rescue of the recombinant virus was conducted as previously described (36). Confluent Vero cells in six-well culture plates were transfected with 6 µg recombinant BAC plasmids per well using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. At 6 h post-transfection, the cells were washed two times with DMEM and supplemented with 2 mL/well of DMEM containing 5 µg/mL trypsin (Sigma) and 37.5 µg/mL pancreatin (Sigma). Then, the plates were incubated in a 37°C, 5% CO2 incubator to facilitate the recovery of recombinant viruses. The cells were observed daily under a microscope to confirm the successful virus recovery.

Confirmation of rescued PEDVs

The recombinant PEDVs were confirmed by RT-PCR and sequencing. Briefly, the total RNA was extracted from virus-infected Vero cells using a HiPure RNA extraction kit and transcribed into cDNA using a reverse transcription kit (Vazyme Biotech, Nanjing, China). The nucleotide deletion in the S1 region was confirmed by PCR and sequencing with primer sets PEDV-25F and PEDV-25R. Verification of the nucleotide deletion in the carboxy-terminus of the S gene was carried out by PCR and sequencing with primer sets PEDV-30F and PEDV-30R.

Growth kinetics

Monolayers of Vero cells in 12-well plates were infected with a multiplicity of infection (MOI) of 0.1 of each virus. After incubation of the plates at 37°C for 1.5 h, the plates were washed two times with phosphate-buffered saline (PBS) and added with 1 mL of DMEM containing 5 µg/mL trypsin and 37.5 µg/mL pancreatin. The samples were collected at indicated time points for titration of the infectious titer of the virus with 50% tissue culture infectious doses (TCID50). Each time point was performed in triplicates and the growth curves were drawn based on the infectious titer of each time point.

Plaque morphology analysis

Monolayers of Vero cells in 6- or 12-well plates were infected with 10-fold serial diluted virus stocks. After absorption at 37°C for 1.5 h, the plates were washed two times with PBS and overlaid with 1.5% methylcellulose containing 50% 2 × DMEM, 5 µg/mL trypsin, and 37.5 µg/mL pancreatin. At 48 hpi, the cells in plates were fixed with 4% formaldehyde and stained with 0.1% crystal violet.

Indirect immunofluorescence assay

Vero cells in 24-well plates were infected with PEDV at 0.1 MOI, then the plates were incubated at 37°C for 1.5 h. After washing the plates with PBS two times, the plates were added with 500 µL of DMEM containing 5 µg/mL trypsin and 37.5 µg/mL pancreatin. At 24 hpi, the samples were collected for indirect IFA. The primary antibody was rabbit anti-PEDV S polyclonal antibody with a dilution of 1:500. The secondary antibody was goat Anti-Rabbit IgG H&L antibody (Abcam) with a dilution of 1:500. The cell nuclei were stained with 0.01% 4′,6-diamidino-2-phenylindole (DAPI).

Evaluation of the pathogenicity of AH2012/12-P102

A total of 15 2-day-old piglets which were farrowed from PEDV seronegative sows were randomly allocated into three groups with five piglets per group (AH2012/12, AH2012/12-P102, and mock group). Each challenged group was housed separately and orally inoculated with 2 mL of DMEM containing 2 × 105 TCID50 of the corresponding virus. The piglets in the mock-challenged group were orally inoculated with 2 mL of DMEM. After the challenge, the clinical signs were daily recorded and rectal swabs of piglets were daily collected for quantification of the virus shedding by RT-qPCR. Upon the piglets showing a sign of death or at the end of the study, the piglets were euthanized and the intestines were fixed in 10% formaldehyde solution for H&E staining and immunohistochemistry analysis.

Experimental design to evaluate the pathogenicity of the recombinant viruses

Two-day-old piglets (n = 30) from PEDV-negative sows were randomly assigned into five groups with six piglets per group (rAH2012/12, rAH2012/12-δS1, rAH2012/12-δS2, rAH2012/12-δS1S2, and mock group). The piglets in each group were orally inoculated with 2 mL of DMEM containing 2 × 105 TCID50 of corresponding recombinant virus and the piglets in the mock group were inoculated with 2 mL of DMEM. After inoculation, the clinical symptom of piglets was daily recorded, and fecal consistency was evaluated as follows: 0 (solid), 1 (pasty), 2 (semiliquid), and 3 (liquid). The rectal swabs were also daily collected for evaluation of virus shedding. The piglets were euthanized at the end of the study or showed signs of death. The intestines from the piglets were harvested for pathological examinations.

Challenging of the piglets after immunization rAH2012/12 or rAH2012/12-δS2 based vaccine candidates

A total of 15 5-day-old piglets which were farrowed from PEDV seronegative sows were randomly allocated into three groups with five piglets per group (K-rAH2012/12, L-rAH2012/12-δS2, and mock group). K-rAH2012/12 was prepared according the previously described method with containing 106.0 TCID50/mL antigens (37). L-rAH2012/12-δS2 was prepared by centrifuging to remove cell fragments and contains the same amount of antigens as K-rAH2012/12. The three groups were immunized intranasal with 2 mL of K-rAH2012/12, L-rAH2012/12-δS2, or PBS, respectively. And the immunization was strengthened once after 2 weeks. Serum samples were collected on days 14 and 28 after the first immunization to detect of S-protein-specific antibodies by ELISA and PEDV-neutralizing antibodies (28).

To evaluate the effect of protection against virus challenge with the vaccines, on day 14 after booster immunization, all piglets in the three groups were each challenged orally with strain AH2012/12 (passage 10) at 1.0 × 106.0 TCID50 (20 mL). Then piglets were monitored daily for clinical signs of disease, including diarrhea and vomiting. Rectal swabs were collected for scoring fecal denseness (scores: 0 normal; 1 pasty stool; 2 semiliquid diarrhea; and 3 liquid diarrhea) and for enumerating fecal viral RNA shedding by RT-qPCR as described before (38). At necropsy, intestinal tissues and contents were grossly evaluated. Fresh jejunums were collected, one portion detected the viral RNA shedding by RT-qPCR, and another portion of jejunums was fixed in 10% neutral buffered formalin for histopathology and immunofluorescence.

Pathological examination, IHC staining, and IFA of intestine sections

The intestines were trimmed and fixed in 10% formaldehyde. Then the fixed samples were sent for pathological examination. The sections were also subjected to IHC or IFA by a commercial company, Boerfu, Ltd. (Ezhou, China). Mouse anti-PEDV N antibody was used as the primary antibody for IHC staining or IFA. IHC was performed as the following procedures. The selected intestinal tissue sections were incubated with mouse anti-PEDV-N antibody (1:500) for 30 min at 37°C. The sections were then incubated with biotinylated goat anti-mouse IgG secondary antibody (Boster, China). The SABC Elite complex (Boster) was used to probe biotin which was conjugated with IgG secondary antibody. Finally, the samples were visualized with a 3,3′-diaminobenzidine (DAB) chromogen kit (Dako, Denmark).

Quantitative real-time PCR

The total RNA was extracted from rectal swabs and intestinal segments and transcribed into cDNA using a reverse transcription kit (Vazyme Biotech, Nanjing, China). SYBR Green-based quantitative real-time PCR was performed to quantify PEDV N gene transcripts using SYBR green PCR master mix (Vazyme Biotech, Nanjing, China) in an ABI 7500 real-time PCR system (Applied Biosystems).

Statistical analysis

The data sets, including plaque size, virus shedding, viral load in jejunum, fecal consistency scores, and cellular cytokines in this study, were subjected to statistical analysis. Data are expressed as mean ± standard deviation (SD) and analyzed with software GraphPad Prism version 7.00. Unpaired Student t tests were used to evaluate the statistical difference between the two groups. Statistical differences between groups were considered as statistically significant when the P value was lower than 0.05 (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

ACKNOWLEDGMENTS

This work was funded by the National Key Research and Development Program of China (Grant no. 2021YFD1801104), the National Natural Science Foundation of China (Grant nos. 32272996, 32202823, and 32202787), the China Postdoctoral Science Foundation (Grant no. 2022M711398), the Natural Science Foundation of Jiangsu Province (Grant nos. BK20190003, BK20221432, and BK20210158), the Jiangxi Provincial Natural Science Foundation (Grant no. 20232BAB215001), the Jiangsu Agricultural Science and Technology Innovation Fund (Grant no. CX(21)2038), and the Exploration and Innovation Project of Jiangsu Academy of Agricultural Sciences (Grant no. ZX(21)1217).

B.L., Q.P., B.F., and X.S. conceived and coordinated the whole study. Q.P. prepared the original manuscript. Q.P., B.F., B.L., J.Z., and Y.L. revised the manuscript. Q.P. and W.H. constructed the recombinant viruses and performed viral infection assays. Q.P., B.F., X.S., W.H., C.W., W.G., X.Z., S.L., Y.Z., J.G., K.L., B.Z., and R.G. participated in the animal experiments. Q.P., C.W. and X.Z. conducted viral RNA extraction. Q.P. performed the RT-qPCR. Q.P., B.F., and B.L. analyzed the data. All author read and approved the final manuscript.

The authors declare no competing interests.

Contributor Information

Bin Li, Email: libinana@126.com.

Tom Gallagher, Loyola University Chicago, Maywood, Illinois, USA .

ETHICAL APPROVAL

The ethical committee of the Jiangsu Academy of Agricultural Sciences has approved the animal study protocol of this research (NKYVET 2017-0122). All procedures involved in piglets were in accordance with the Care and Use Guidelines of Experimental Animals.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/jvi.01063-23.

Supplemental material. jvi.01063-23-s0001.pdf.

Figures S1 and S2.

Click here for additional data file. (371KB, pdf)
DOI: 10.1128/jvi.01063-23.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

  • 1. Li W, Li H, Liu Y, Pan Y, Deng F, Song Y, Tang X, He Q. 2012. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg Infect Dis 18:1350–1353. doi: 10.3201/eid1808.120002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Wang D, Fang L, Xiao S. 2016. Porcine epidemic diarrhea in China. Virus Res 226:7–13. doi: 10.1016/j.virusres.2016.05.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Hanke D, Pohlmann A, Sauter-Louis C, Höper D, Stadler J, Ritzmann M, Steinrigl A, Schwarz B-A, Akimkin V, Fux R, Blome S, Beer M. 2017. Porcine epidemic diarrhea in Europe: in-detail analyses of disease dynamics and molecular epidemiology. Viruses 9:177. doi: 10.3390/v9070177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Jung K, Saif LJ. 2015. Porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis. Vet J 204:134–143. doi: 10.1016/j.tvjl.2015.02.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Schulz LL, Tonsor GT. 2015. Assessment of the economic impacts of porcine epidemic diarrhea virus in the United States. J Anim Sci 93:5111–5118. doi: 10.2527/jas.2015-9136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Antas M, Woźniakowski G. 2019. Current status of porcine epidemic diarrhoea (PED) in European pigs. J Vet Res 63:465–470. doi: 10.2478/jvetres-2019-0064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Wang Q, Vlasova AN, Kenney SP, Saif LJ. 2019. Emerging and re-emerging coronaviruses in pigs. Curr Opin Virol 34:39–49. doi: 10.1016/j.coviro.2018.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Song D, Park B. 2012. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines. Virus Genes 44:167–175. doi: 10.1007/s11262-012-0713-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Kocherhans R, Bridgen A, Ackermann M, Tobler K. 2001. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23:137–144. doi: 10.1023/a:1011831902219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Thiel V, Ivanov KA, Putics Á, Hertzig T, Schelle B, Bayer S, Weißbrich B, Snijder EJ, Rabenau H, Doerr HW, Gorbalenya AE, Ziebuhr J. 2003. Mechanisms and enzymes involved in SARS coronavirus genome expression. J Gen Virol 84:2305–2315. doi: 10.1099/vir.0.19424-0 [DOI] [PubMed] [Google Scholar]
  • 11. Liu C, Tang J, Ma Y, Liang X, Yang Y, Peng G, Qi Q, Jiang S, Li J, Du L, Li F, Perlman S. 2015. Receptor usage and cell entry of porcine epidemic diarrhea coronavirus. J Virol 89:6121–6125. doi: 10.1128/JVI.00430-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Fu F, Li L, Shan L, Yang B, Shi H, Zhang J, Wang H, Feng L, Liu P. 2017. A spike-specific whole-porcine antibody isolated from a porcine B cell that neutralizes both genogroup 1 and 2 PEDV strains. Vet Microbiol 205:99–105. doi: 10.1016/j.vetmic.2017.05.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. de Haan CAM, Haijema BJ, Schellen P, Wichgers Schreur P, te Lintelo E, Vennema H, Rottier PJM. 2008. Cleavage of group 1 coronavirus spike proteins: how furin cleavage is traded off against heparan sulfate binding upon cell culture adaptation. J Virol 82:6078–6083. doi: 10.1128/JVI.00074-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Li C, Li W, Lucio de Esesarte E, Guo H, van den Elzen P, Aarts E, van den Born E, Rottier PJM, Bosch B-J, Perlman S. 2017. Cell attachment domains of the porcine epidemic diarrhea virus spike protein are key targets of neutralizing antibodies. J Virol 91:e00273-17. doi: 10.1128/JVI.00273-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Tan Y, Sun L, Wang G, Shi Y, Dong W, Fu Y, Fu Z, Chen H, Peng G, Dutch RE. 2021. The trypsin-enhanced infection of porcine epidemic diarrhea virus is determined by the S2 subunit of the spike glycoprotein. J Virol 95:e02453-20. doi: 10.1128/JVI.02453-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wang D, Ge X, Chen D, Li J, Cai Y, Deng J, Zhou L, Guo X, Han J, Yang H, Pfeiffer JK. 2018. The S gene is necessary but not sufficient for the virulence of porcine epidemic diarrhea virus novel variant strain BJ2011C. J Virol 92:e00603-18. doi: 10.1128/JVI.00603-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hou Y, Lin C-M, Yokoyama M, Yount BL, Marthaler D, Douglas AL, Ghimire S, Qin Y, Baric RS, Saif LJ, Wang Q. 2017. Deletion of a 197-amino-acid region in the n-terminal domain of spike protein attenuates porcine epidemic diarrhea virus in piglets. J Virol 91:e00227-17. doi: 10.1128/JVI.00227-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wang K, Lu W, Chen J, Xie S, Shi H, Hsu H, Yu W, Xu K, Bian C, Fischer WB, Schwarz W, Feng L, Sun B. 2012. PEDV ORF3 encodes an ion channel protein and regulates virus production. FEBS Lett 586:384–391. doi: 10.1016/j.febslet.2012.01.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Ge F-F, Kang L-S, Shen L-P, Shen H-X, Yang D-Q, Li X, Ju H-B, Zhao H-J, Wang J. 2022. Pathogenicity and immunogenicity of a serially passaged attenuated genotype 2C porcine epidemic diarrhea virus cultured in suspended vero cells. Front Microbiol 13:864377. doi: 10.3389/fmicb.2022.864377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Deng X, Buckley AC, Pillatzki A, Lager KM, Faaberg KS, Baker SC, Pfeiffer JK. 2020. Inactivating three interferon antagonists attenuates pathogenesis of an enteric coronavirus. J Virol 94:e00565-20. doi: 10.1128/JVI.00565-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Sun R-Q, Cai R-J, Chen Y-Q, Liang P-S, Chen D-K, Song C-X. 2012. Outbreak of porcine epidemic diarrhea in suckling piglets, China. Emerg Infect Dis 18:161–163. doi: 10.3201/eid1801.111259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Sun D, Wang X, Wei S, Chen J, Feng L. 2016. Epidemiology and vaccine of porcine epidemic diarrhea virus in China: a mini-review. J Vet Med Sci 78:355–363. doi: 10.1292/jvms.15-0446 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Hou Y, Wang Q. 2019. Emerging highly virulent porcine epidemic diarrhea virus: molecular mechanisms of attenuation and rational design of live attenuated vaccines. Int J Mol Sci 20:5478. doi: 10.3390/ijms20215478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chen P, Zhao X, Zhou S, Zhou T, Tan X, Wu X, Tong W, Gao F, Yu L, Jiang Y, Yu H, Yang Z, Tong G, Zhou Y. 2021. A virulent PEDV strain FJzz1 with genomic mutations and deletions at the high passage level was attenuated in piglets via serial passage in vitro. Virol Sin 36:1052–1065. doi: 10.1007/s12250-021-00368-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Jengarn J, Wongthida P, Wanasen N, Frantz PN, Wanitchang A, Jongkaewwattana A. 2015. Genetic manipulation of porcine epidemic diarrhoea virus recovered from a full-length infectious cDNA clone. J Gen Virol 96:2206–2218. doi: 10.1099/vir.0.000184 [DOI] [PubMed] [Google Scholar]
  • 26. Schwegmann-Wessels C, Al-Falah M, Escors D, Wang Z, Zimmer G, Deng H, Enjuanes L, Naim HY, Herrler G. 2004. A novel sorting signal for intracellular localization is present in the S protein of a porcine coronavirus but absent from severe acute respiratory syndrome-associated coronavirus. J Biol Chem 279:43661–43666. doi: 10.1074/jbc.M407233200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Hou Y, Meulia T, Gao X, Saif LJ, Wang Q, Gallagher T. 2019. Deletion of both the tyrosine-based endocytosis signal and the endoplasmic reticulum retrieval signal in the cytoplasmic tail of spike protein attenuates porcine epidemic diarrhea virus in pigs. J Virol 93:e01758-18. doi: 10.1128/JVI.01758-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Song X, Qian J, Wang C, Wang D, Zhou J, Zhao Y, Wang W, Li J, Guo R, Li Y, Zhu X, Yang S, Zhang X, Fan B, Li B, He B. 2023. Correlation between the IgG/IgA antibody response against PEDV structural protein and virus neutralization. Microbiol Spectr 11:e0523322. doi: 10.1128/spectrum.05233-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Zou D, Xu J, Duan X, Xu X, Li P, Cheng L, Zheng L, Li X, Zhang Y, Wang X, Wu X, Shen Y, Yao X, Wei J, Yao L, Li L, Song B, Ma J, Liu X, Wu Z, Zhang H, Cao H. 2019. Porcine epidemic diarrhea virus ORF3 protein causes endoplasmic reticulum stress to facilitate autophagy. Vet Microbiol 235:209–219. doi: 10.1016/j.vetmic.2019.07.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Kaewborisuth C, Koonpaew S, Srisutthisamphan K, Viriyakitkosol R, Jaru-Ampornpan P, Jongkaewwattana A. 2020. PEDV ORF3 independently regulates IκB kinase β-mediated NF-κB and IFN-β promoter activities. Pathogens 9:376. doi: 10.3390/pathogens9050376 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Guo X, Zhang M, Zhang X, Tan X, Guo H, Zeng W, Yan G, Memon AM, Li Z, Zhu Y, Zhang B, Ku X, Wu M, Fan S, He Q. 2017. Porcine epidemic diarrhea virus induces autophagy to benefit its replication. Viruses 9:53. doi: 10.3390/v9030053 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhang Y-H, Li H-X, Chen X-M, Zhang L-H, Zhao Y-Y, Luo A-F, Yang Y-R, Zheng L-L, Chen H-Y. 2022. Genetic characteristics and pathogenicity of a novel porcine epidemic diarrhea virus with a naturally occurring truncated ORF3 gene. Viruses 14:487. doi: 10.3390/v14030487 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Lu Y, Huang W, Zhong L, Qin Y, Liu X, Yang C, Wang R, Su X, Du C, Mi X, Wang H, He Y, Zhao W, Chen Y, Wei Z, Ouyang K. 2021. Comparative characterization and pathogenicity of a novel porcine epidemic diarrhea virus (PEDV) with a naturally occurring truncated ORF3 gene coinfected with PEDVs possessing an intact ORF3 gene in piglets. Viruses 13:1562. doi: 10.3390/v13081562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Beall A, Yount B, Lin C-M, Hou Y, Wang Q, Saif L, Baric R. 2016. Characterization of a pathogenic full-length cDNA clone and transmission model for porcine epidemic diarrhea virus strain PC22A. mBio 7:e01451–15. doi: 10.1128/mBio.01451-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Peng Q, Fang L, Ding Z, Wang D, Peng G, Xiao S. 2020. Rapid manipulation of the porcine epidemic diarrhea virus genome by CRISPR/Cas9 technology. J Virol Methods 276:113772. doi: 10.1016/j.jviromet.2019.113772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Peng Q, Zhang X, Fan B, Li Y, Zhao S, Guo W, He W, Zhao Y, Ni Y, Liu M, Fei R, Li B. 2022. Evaluation of the transcriptional regulatory efficacy of transcription regulatory sequences of porcine epidemic diarrhea virus. Vet Microbiol 267:109376. doi: 10.1016/j.vetmic.2022.109376 [DOI] [PubMed] [Google Scholar]
  • 37. Xu X, Du L, Fan B, Sun B, Zhou J, Guo R, Yu Z, Shi D, He K, Li B. 2020. A flagellin-adjuvanted inactivated porcine epidemic diarrhea virus (PEDV) vaccine provides enhanced immune protection against PEDV challenge in piglets. Arch Virol 165:1299–1309. doi: 10.1007/s00705-020-04567-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Fan B, Yu Z, Pang F, Xu X, Zhang B, Guo R, He K, Li B. 2017. Characterization of a pathogenic full-length cDNA clone of a virulent porcine epidemic diarrhea virus strain AH2012/12 in China. Virology 500:50–61. doi: 10.1016/j.virol.2016.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material. jvi.01063-23-s0001.pdf.

Figures S1 and S2.

Click here for additional data file. (371KB, pdf)
DOI: 10.1128/jvi.01063-23.SuF1

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES