Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) |
Mfn-2 | NCBI Gene | Gene ID: 170731 | MFN2 ENSMUSG00000029020 |
| Gene (human) |
MFN-2 | NCBI Gene | Gene ID: 9927 | MFN2 ENSG00000116688 |
| Genetic reagent (M. musculus) | Mfn2 R400Q knock-in mice | DornLab | Knock-in mice generated with point mutation in position 400 | |
| Genetic reagent (M. musculus) | Mfn2 T105M knock-in mice | DornLab | Knock-in mice generated with point mutation in position 105 | |
| Genetic reagent (M. musculus) | Mfn2 M376V knock-in mice | DornLab | Knock-in mice generated with point mutation in position 376 | |
| Genetic reagent (M. musculus) | C57BL/6J mice | C57Bl/6 | The Jackson Laboratory: 000664 |
C57Bl/6 |
| Cell line H9c2 (rat myoblast) |
Cardiomyoblast | ATCC | CRL-1446 | Rat embryonic cardiomyoblast |
| Cell line Mfn1/Mfn2 null (M. musculus) |
Mfn1 and Mfn2 double knock out MEFs | ATCC | CRL-2993 | Murine embryonic fibroblasts |
| Cell line DRG neuronal cells |
Adult mouse dorsal root ganglion | From 8- to 12-week-old C57BL/6J using enzymatic dissociation. | Franco et al., 2020 | |
| Cell line mouse embryonic fibroblast |
MEFs WT | From E.14.5 pups from C57BL/6J using enzymatic dissociation | https://pubmed.ncbi.nlm.nih.gov/18265203/ | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Adenovirus Mito-Ds-Red2 |
Signagen | Cat# 12259 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Adenovirus Cre-recombinase |
Vector Biolabs | Cat# 1794 | |
| Transfected construct (human adenovirus type5 dE1/E3) | Ad-MFN2T105M | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-MFN2R94Q | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-MFN2R400Q | DornLab | Human adenovirus type 5 (dE1/E3), with Mfn2R400Q | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-MFN2K109A | DornLab | Rocha et al., 2018 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-MFN2M376A | DornLab | Rocha et al., 2018 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-MFN2WT | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-hFRETMFN22WT | DornLab | Rocha et al., 2018 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-hFRETMFN2R94Q | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-hFRETMFN2K109A | DornLab | Human adenovirus type 5 (dE1/E3), with Mfn2K109A | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-hFRETMFN2M376A | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-hFRETMFN2T105M | DornLab | Franco et al., 2022 | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-LC3-GFP | DornLab | Human adenovirus type 5 (dE1/E3), with LC3 for autophagy | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-mCherry-Parkin | Gift from Dr. Åsa Gustafsson | N/A | |
| Transfected construct (human adenovirus type 5 dE1/E3) | Ad-mitoQC | DornLab | Human adenovirus type 5 (dE1/E3), with mitoQC for mitophagy | |
| Antibody | Anti-Mfn-2 (mouse monoclonal) | Abcam | Cat# ab56889 | 1:1000 |
| Antibody | Anti-COX-IV (rabbit polyclonal) | Abcam | Cat# ab16056 | 1:1000 |
| Antibody | Anti-GAPDH (mouse monoclonal) | Abcam | Cat# ab82245 | 1:3000 |
| Antibody | Anti-β-actin (unconjugated monoclonal) | Proteintech | Cat# 66009-1 | 1:3000 |
| Antibody | Goat anti-rabbit IgG | Thermo Fisher | Cat# 31460 | 1:3000 |
| Antibody | Peroxidase-conjugated anti-mouse IgG | Cell Signaling | Cat# 7076S | 1:3000 |
| Sequence-based reagent | mMFN2R400Q knock-in mouse (forward) | DornLab | Knock-in mice generated with point mutation in position 400 | GGCATGTATGTGTAGGTCAGAG |
| Sequence-based reagent | mMFN2 R400Q knock-in mouse (reverse) | DornLab | Knock-in mice generated with point mutation in position 400 | CCCAGCTCCTCTGATTTGA |
| Sequence-based reagent | mMFN2 R400Q knock-in mouse (sequencing) | DornLab | Knock-in mice generated with point mutation in position 400 | CAGGTCTCCTTCCACCTTTAC |
| Sequence-based reagent | mMFN2 T105M knock-in mouse (forward) | DornLab | Knock-in mice generated with point mutation in position 105 | TGTTTACTTTGGAAGTAGGCAGTCT |
| Sequence-based reagent | mMFN2 T105M knock-in mouse (reverse) | DornLab | Knock-in mice generated with point mutation in position 105 | TTGTTCTTGGTGTCCCACTCTGA |
| Sequence-based reagent | mMFN2 T105M knock-in mouse (sequencing) | DornLab | Knock-in mice generated with point mutation in position 105 | TCGATGCTTAATGAGTGCTGCTGG |
| Sequence-based reagent | mMFN2 M376V knock-in mouse (forward) | DornLab | Knock-in mice generated with point mutation in position 376 | GTCCGGGCCAAGCAGATTGCAGAGGCCGTTCGTCTCATCATGGATTCCCTGCACATCGCAGCTCAGGAGCAGCGGTGAGA |
| Sequence-based reagent | mMFN2 M376V knock-in mouse (reverse) | DornLab | Knock-in mice generated with point mutation in position 376 | GGTAGTAAAGAGCCTTTCTAGCTGAT |
| Sequence-based reagent | mMFN2 M376V knock-in mouse (sequencing) | DornLab | Knock-in mice generated with point mutation in position 376 | TTTCGAGAGGCAGTTTGAGGTAA |
| Commercial assay or kit | GTPase-Glo Assay | Promega | Cat# V7681 | |
| Chemical compound, drug | Mitofusin agonist TAT-MP-1 |
Thermo Fisher | Franco A et al., Nature 2016 | |
| Chemical compound, drug | Mitofusin antagonist TAT-MP-1 |
Thermo Fisher | Franco A et al., Nature 2016 | |
| Chemical compound, drug | L-Glutamine | Gibco | Cat# 25030-149 | |
| Chemical compound, drug | Goat serum | Jackson ImmunoResearch | Cat# 005-000121 | |
| Chemical compound, drug | Doxorubicin | Sigma | 44583 | |
| Chemical compound, drug | Glutaraldehyde | Electron Microscopy Science | Cat# 16216 | |
| Chemical compound, drug | MitoTracker Green | Thermo Fisher | Cat# M7514 | |
| Chemical compound, drug | FCCP | Thermo Fisher | Cat# C2920 | |
| Chemical compound, drug | Calcein AM | Thermo Fisher | Cat# C3100MP | |
| Chemical compound, drug | Hematoxylin-eosin | Sigma | Cat#: GHS116 & HT110116 | |
| Chemical compound, drug | TUNEL | Promega | Cat#: G3250 | |
| Chemical compound, drug | Hoechst | Thermo Fisher | Cat# H3570 | |
| Chemical compound, drug | MitoTracker Orange | Thermo Fisher | Cat# M7510 | |
| Chemical compound, drug | Tetramethylrhodamine ethyl ester | Thermo Fisher | Cat# T-669 | |
| Chemical compound, drug | MitoSOX Red | Thermo Fisher | Cat# M36008 | |
| Software, algorithm | ImageJ | A. Schneider | https://imagej.net/Sholl_Analysis | |
| Software, algorithm | Partek Flow | https://www.partek.com/partek-flow/ | N/A | |
| Software, algorithm | FlowJo 10 software | https://www.flowjo.com/solutions/flowjo/downloads/ | N/A |