Skip to main content
Reproduction & Fertility logoLink to Reproduction & Fertility
. 2023 Oct 11;4(4):e230021. doi: 10.1530/RAF-23-0021

Presence of KREMEN receptors for DKK1 in the preimplantation bovine embryo

Thiago Fernandes Amaral 1,2, Yao Xiao 3, Surawich Jeensuk 1,4, Tatiane Silva Maia 1, Camila J Cuellar 1, Chloe A Gingerich 1, Tracy L Scheffler 1, Peter J Hansen 1,✉
PMCID: PMC10620448  PMID: 37582174

Abstract

The WNT inhibitory protein DKK1 has been shown to regulate the development of the preimplantation embryo to the blastocyst stage. In cattle, DKK1 increases the number of trophectoderm cells that are the precursor of the placenta. DKK1 can affect cells by blocking WNT signaling through its receptors KREMEN1 and KREMEN2. Here it was shown that the mRNA for KREMEN1 and KREMEN2 decline as the embryo advances in development. Nonetheless, immunoreactive KREMEN1 was identified in blastocysts using western blotting. DKK1 also decreased the amount of immunoreactive β-catenin in blastocysts, as would be expected if DKK1 was signaling through a KREMEN-mediated pathway. Thus, it is likely that KREMEN1 functions as a receptor for DKK1 in the preimplantation bovine embryo.

Lay summary

DKK1 is a molecule produced by the lining of the womb (uterus) that regulates the development of the early embryo. Here it was shown that a substance that responds to DKK1 called KREMEN1 is found in the embryos of cattle. In other cells, joining of DKK1 to KREMEN1 results in reduction in amounts of a protein called β-catenin. For the present study, it was shown that DKK1 treatment also reduced β-catenin in the cattle, which suggests that DKK1 can regulate the cattle embryo by attaching to KREMEN1.

Keywords: DKK1, KREMEN1, WNT signaling, preimplantation embryo

Introduction

The WNT signaling system is a complex system of 19 ligands, 13 receptors, and a variety of soluble inhibitors and activators (Kawano & Kypta 2003, Pan et al. 2022) that together regulate cell–cell communication to coordinate pluripotency, cell polarity and movement, lineage commitment and cell proliferation (Steinhart & Angers 2018, Hayat et al. 2021). The preimplantation embryo undergoes development in an environment rich in components of the WNT signaling pathway. In the cow, for example, both the embryo and endometrium express genes for WNT ligands, inhibitory proteins, receptors, and coreceptors (Denicol et al. 2013, Tríbulo et al. 2017b, 2018a, Sang et al. 2021). WNT signaling pathway proteins can transmit information through several signaling pathways. The central effector of the canonical signaling pathway is β-catenin (CTNNB1), a protein that modulates gene expression upon translocation to the nucleus after WNT activation but that also serves as a constitutive protein for adherens junctions involved in cell–cell adhesion (Fleming et al. 2001). Activation of the canonical pathway is achieved by binding of a WNT ligand to the membrane receptor, frizzled (FZD), and coreceptor, low-density lipoprotein receptor-related protein 5 (LRP5) and LRP6, to activate dishevelled and block the CTNNB1 destruction complex (van Amerongen & Nusse 2009, Hayat et al. 2021). Noncanonical signaling pathways include the planar cell polarity and WNT/Ca2+ pathways (Hayat et al. 2021).

In the cow, canonical WNT signaling is inhibitory to development to the blastocyst stage since chemical activators of the pathway added at day 4 or 5 after fertilization inhibit development (Denicol et al. 2013, Tríbulo et al. 2017a, Xiao et al. 2021a). Other WNTs considered capable of activating noncanonical WNT signaling pathways like WNT5A, WNT7A, and WNT11 increase the proportion of embryos that become blastocysts (Tríbulo et al. 2017a,b, 2018b, Jeensuk et al. 2022). In vivo, detrimental effects of canonical WNT signaling on development are likely to be alleviated by endometrial secretion of dickkopf WNT signaling pathway inhibitor 1 (DKK1). This glycoprotein antagonizes the canonical WNT signaling pathway by binding to the WNT coreceptors LRP5/6 and the transmembrane proteins kringle-containing transmembrane protein (KREMEN) 1 and 2 to induce LRP5/6 endocytosis and prevent stabilization and subsequent nuclear translocation of CTNNB1 (Mao et al. 2002). DKK1 is highly expressed in the endometrium at day 5 of pregnancy when the embryo first transits from the oviduct to uterus (Tríbulo et al. 2018a). In fact, DKK1 is more highly expressed in the endometrium than in any other tissue examined in cattle (Fang et al. 2020).

DKK1 blocked the deleterious effect of chemical WNT activators on development to the blastocyst stage (Denicol et al. 2013, Tríbulo et al. 2017b). In addition, treatment of embryos with DKK1 beginning at day 5 of development promoted the development of the trophectoderm in the resulting blastocysts (Denicol et al. 2013, Amaral et al. 2022). Recent evidence indicates that actions of DKK1 from day 5 to 7 of development can program subsequent placental function so that trophoblast elongation at day 15 is enhanced (Tríbulo et al. 2019a) and circulating concentrations of pregnancy-associated glycoproteins are elevated at day 160 of gestation (Amaral et al. 2022). Consequences of DKK1 actions on the preimplantation embryo can persist into the postnatal period because calves derived from DKK1-treated embryos were reported to have either lower (Tríbulo et al. 2017c) or higher birth weights (Amaral et al. 2022) and lower growth rates after birth than those of calves from control embryos (Amaral et al. 2022).

Effects of DKK1 on trophectoderm development vary between species. DKK1 reduced the number of trophectoderm (TE) cells in mice (Xie et al. 2008) but chemical depletion of CTNNB1 reduced TE formation in the human (Krivega et al. 2015). The reason for variation between species is not known but could involve differences in signal transduction systems between species. While KREMEN1 and KREMEN2 are recognized as DKK1 receptors for inhibition of canonical WNT signaling, DKK1 can also regulate cell function through signaling pathways independent of canonical WNT signaling. One such pathway involves binding of DKK1 to glypican 4/6 homolog Knypek to regulate gastrulation movements (Caneparo et al. 2007). Moreover, DKK1 can bind to cytoskeleton-associated protein 4 and activate phosphatidylinositol 3-kinase/AKT signaling to promote cell proliferation in human pancreatic and lung tumor cells (Kimura et al. 2016).

The objective of the current series of experiments was to evaluate whether the bovine preimplantation embryo possesses capacity for DKK1 to signal through KREMEN1 and KREMEN2. Results indicate a reduction of mRNA abundance for KREMEN1 and KREMEN2 as the embryo advances in development. Early in development, KREMEN1 mRNA is more abundant than that of KREMEN2. Despite the decline in transcript abundance, immunoreactive KREMEN1 is present in the blastocyst-stage embryo. Moreover, DKK1 reduces immunoreactive CTNNB1 in the embryo. Thus, the bovine embryo likely possesses the ability to signal through KREMEN1/2.

Materials and methods

Embryo production

All experiments were performed with bovine embryos produced in vitro from oocytes derived from abattoir-sourced ovaries following procedures described previously (Tríbulo et al. 2019b) with slight modifications. Immature cumulus–oocyte complexes (COC) were collected by cutting visible follicles (2–8 mm in diameter) on the ovarian surface with a scalpel and vigorously rinsing the ovary in a beaker filled out with 100 mL of oocyte washing medium (Minitube USA, Verona, WI, USA). Group of ten COC were matured in vitro in 50 μL microdrops of maturation medium (BO-IVMTM, IVF Bioscience, Falmouth, UK) covered with mineral oil (Minitube USA) for 22 h at 38.5°C and 5% (v/v) CO2 in a humidified atmosphere. Following maturation, up to 300 COC were rinsed in HEPES–Tyrode’s albumin lactate pyruvate (TALP) medium and incubated with frozen-thawed sperm (1 x 106/mL) from three different bulls that had been previously purified with PureSperm® 40/80 (Nidacon, Mölndal, Sweden). Separate pools of sperm from various bulls were used for each replicate. The COC were fertilized (day 0) in a medium consisting of 1.7 mL in vitro fertilization Tyrode’s albumin lactate pyruvate supplemented with 20 μM penicillamine, 10 μM hypotaurine, and 7 nM epinephrine for 16–18 h at 38.5°C and 5% (v/v) CO2 in a humidified air atmosphere. After fertilization, presumptive zygotes were treated and vortexed with hyaluronidase (2500 U/mL) in HEPES–TALP to remove cumulus cells, rinsed three times in HEPES–TALP, and cultured in groups of up to 30 in 50 μL microdrops of synthetic oviduct fluid–bovine embryo 2 (SOF-BE2) covered with mineral oil in a benchtop incubator (WTA, Cravinhos, SP, Brazil) with a humidified atmosphere in the culture chamber of 5% (v/v) O2, 5% (v/v) CO2 and the balance N2. Cleavage rate was measured at day 3.

Developmental changes in expression of KREMEN1 and KREMEN2

Oocytes and embryos were produced as described above. A total of six to seven individual oocytes or embryos were harvested at each of the following stages: matured oocyte (22 h after initiation of maturation); 2-cell stage ((28–32 h post insemination (hpi)); 3- to 4- cell stage (44–48 hpi); 5- to 8- cell stage (50–54 hpi); 9- to 16- cell stage (72 hpi); morula (120 hpi) and blastocyst (168 hpi). These embryos were produced in a single embryo production replicate. Cumulus cells were removed from matured oocytes by vortexing for 5 min in HEPES–TALP containing 2500 U/mL hyaluronidase. Denuded matured oocytes and embryos were rinsed in diethyl pyrocarbonate-treated Dulbecco’s phosphate-buffered saline (DPBS) that contained 0.2% (w/v) polyvinylpyrrolidone (DPBS–PVP) and then incubated in acid Tyrode’s solution (Sigma-Aldrich) for 2–5 min until the zona pellucida was dissolved. The embryo was then rinsed in DPBS–PVP again.

Embryos at the stages listed above were transferred individually into 200 μL nuclease-free PCR tubes (Bio-Rad) containing 1 μL of the resuspension buffer supplied in the CellsDirect One-Step qRT-PCR Kit (Thermo Fisher). After transfer of the embryo, the collection tube was placed in liquid nitrogen for snap freezing and then stored at −80°C for subsequent analyses.

Gene expression of KREMEN1 and KREMEN2 was determined by the specific-target preamplification real-time quantitative PCR procedure for single embryos as described by Xiao et al. (2021b) using the CellsDirect One-Step qRT-PCR Kit (Thermo Fisher). Primer sequences are shown in Table 1. The housekeeping genes were GAPDH, and YWHAZ.

Table 1.

Primers used in the experiments.

Gene GenBank ID Sequences (5′– 3′) Size (bp)
Forward Reverse
KREMEN1 XM_024977816.1 TGTGGAAACGACCCTGATTAC CAGAGTGTCGAAGACGATGAC 126
KREMEN2 XM_024985113.1 TCAAGGCCAAAGGACAAGAG TTTGGGCAGTAGTCCAGAAC 101
GAPDH NM_001034034.2 ACCCAGAAGACTGTGGATGG CAACAGACACGTTGGGAGTG 175
YWHAZ XM_005215615.1 GCATCCCACAGACTATTTCC GCAAAGACAATGACAGACCA 120

Western blotting for KREMEN1

Blastocysts at day 7.5 of development were harvested from culture medium, washed in DPBS–PVP and treated with prewarmed acid Tyrode’s solution for 5 min to remove the zona pellucida. Embryos were then stored at −80°C until western blotting. Groups of either 45 or 103 blastocysts (pooled from four different embryo production replicates) in 5 µL DPBS–PVP were transferred to 5 µL loading buffer consisting of 5% (v/v) β-mercaptoethanol in 2× Laemmli sample buffer (Bio-Rad), heated at 95°C for 5 min, cooled on ice for 1 min, and stored at −80°C.

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis was performed using 5% (w/v) acrylamide stacking gel (37.5 : 1 acrylamide/0.8% (w/v) bisacrylamide, 0.5 M Tris–HCl pH 6.8, H2O, 0.15% (w/v) ammonium persulfate, and 0.1% (v/v) tetramethylethylenediamine (TEMED) and 10% (w/v) acrylamide separating gel (37.5 : 1 acrylamide/0.8% (w/v) bisacrylamide, 1.5 M Tris–HCl pH 8.8, 0.13% (w/v) ammonium persulfate, and 0.07% (v/v) TEMED). Conditions for electrophoresis were 60 V for 20 min followed by 125 V for 80–90 min at room temperature. Proteins were transferred to 0.45 µm nitrocellulose blotting membranes (GE Healthcare Life Sciences) at 4°C at 500 mA for 1 h. The membranes were stained for total protein using Revert™ 700 Total Protein Stain (LI-COR, Lincoln, NE, USA). The membranes were then blocked using StartingBlock™ TBS blocking buffer (Thermo Fisher Scientific) at 4°C for 1 h and incubated overnight with 1 μg/mL rabbit polyclonal IgG anti-KREMEN1 (Abcam, ab211285). The antibody was generated against a synthetic peptide corresponding to 18 amino acids near the carboxy terminus of the protein, in a region distinct from KREMEN2. As a negative control, proteins from 30 blastocysts were subjected to western blotting and incubated with 2 μg/mL rabbit immunoglobulin G (IgG) at 4°C. After incubation, membranes were washed with 0.1% (v/v) Tween 20 in TBS (Tris-buffered saline, 20 mM Tris base containing 140 mM NaCl, pH 7.6), and then incubated in 100 ng/mL of IRDye® 800CW donkey anti-rabbit IgG (H+L; LI-COR) at 4°C for 1 h. Images for anti-KREMEN and for total protein were acquired by scanning membranes using the Odyssey® DLx Imaging System (LI-COR) and with analysis performed by Image Studio™ version 3.2 (LI-COR).

Effects of DKK1 on amounts of CTNNB1 in blastocysts

Embryos were treated with either recombinant human DKK1 (R&D Systems) or vehicle (DPBS containing 1 mg/mL essentially fatty acid-free BSA (Sigma-Aldrich)) on day 5 of culture. Human DKK1 is 89.5% identical to bovine DKK1 (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Treatments were applied by removing 5 µL medium from each drop and adding 5 µL 1000 ng/mL recombinant human DKK1 (R&D Systems) or vehicle. Thus, the final concentration of DKK1 was 100 ng/mL. This concentration was effective at altering embryo function in other experiments (Denicol et al. 2013, Tríbulo et al. 2017b, 2019a, Amaral et al. 2022). At day 7.5, blastocysts were harvested for immunolabeling of total CTNNB1 by either immunofluorescent localization or by western blotting.

Procedures for immunofluorescence are as follows. Embryos were rinsed in DPBS containing 0.2% (w/v) PVP and then fixed in DPBS containing 4% (w/v) paraformaldehyde at room temperature for 15 min. Embryos were permeabilized for 30 min in 0.3% (v/v) Triton X-100 in DPBS and incubated for 1 h at room temperature in blocking buffer consisting of DPBS containing 5% (w/v) bovine serum albumin (BSA). Embryos were then incubated with primary antibody at 4˚C overnight. The primary antibody was 1 μg/mL rabbit polyclonal IgG anti-CTNNB1 (Abcam, ab32572) diluted in blocking buffer. After incubation, embryos were washed three times for 5 min each in washing buffer (0.05% Tween 20 (v/v) in DPBS containing 0.2% (w/v) PVP) and then incubated with 2 μg/mL goat anti-rabbit IgG conjugated to Alexa Fluor Plus 555 (Thermo Fisher) diluted in blocking buffer. Embryos were then incubated with 1 μg/mL Hoechst 33343 for 1 h at room temperature in the dark. Following another three washings, embryos were mounted on glass slides with a coverslip using SlowFade Gold antifade reagent (ThermoFisher). Mounted embryos were observed with a 40× objective using a Zeiss Axioplan 2 epifluorescence microscope (Zeiss) and Zeiss filter sets 02 (4′,6′-diamidino-2-phenylindole) and 03 (rhodamine). Digital images of individual embryos were acquired using AxioVision software (Zeiss) and a high-resolution black and white Zeiss AxioCam MRm digital camera, with a uniform exposure time, light intensity and gains for each replication. A total of 74 individual blastocysts produced from 4 replicates were analyzed. Quantification of intensity of labeling in the entire blastocyst was measured using ImageJ software (U.S. National Institutes of Health, Bethesda, MD, USA) with the threshold feature. The area encompassing the entire embryo was selected and the mean intensity obtained using the Measure Analysis feature of ImageJ.

For western blotting, a total of six pools of 25 blastocysts for each treatment were analyzed using procedures described earlier. The primary antibody, 500 ng/mL, was rabbit monoclonal IgG anti-total CTNNB1 (recombinant anti-beta catenin E-247 – ChIP Grade, Abcam, ab32572). Rabbit IgG, at 2 μg/mL, was used as negative control.

Statistical analysis

Data were subjected to analysis of variance using the GLM procedure of the Statistical Analysis System, version 9.4 (SAS Institute, Cary, NC, USA). Treatment and replicate were included in the model. For gene expression, differences between individual stages were determined by Tukey’s mean separation test. Data on effects of CTNNB1 as determined by western blotting were analyzed with total protein per lane as a covariate.

Results

Developmental changes in expression of KREMEN1 and KREMEN2

Changes in RNA transcript abundance of KREMEN1 and KREMEN2 during development from the matured oocyte to blastocyst stage are shown in Fig. 1. There was a large decline in transcript abundance for KREMEN1 after the 9- to 16-cell stage so that amounts of mRNA were lower at morula and the blastocyst stages than those at earlier stages of development (P < 0.0001). Expression of KREMEN2 was consistently low although there was a slight but nonsignificant increase in amounts of mRNA at the 9- to 16-cell and morula stages (i.e. after embryonic genome activation). Prior to the morula stage, transcript abundance for KREMEN1, as expressed by fold-change relative to the geometric mean of housekeeping genes, was greater than that for KREMEN2. Thereafter amounts were similar for the two genes.

Figure 1.

Figure 1

Presence of mRNA for KREMEN1 and KREMEN2 and immunoreactive KREMEN1 in the bovine embryo. A. Developmental changes in expression of KREMEN1 and KREMEN2. Expression was assessed in individual oocytes or embryos by qRT-PCR (n = 6–7 per stage) and is expressed relative to the geometric mean of reference genes GAPDH, YWHAZ, and SDHA. Data are presented as least-squares means ± s.e.m.KREMEN1 expression was affected by stage of development (P < 0.001). In particular, analysis by mean separation test indicated expression was lower for the morula and blastocyst than at earlier stages (P < 0.0001). KREMEN2 expression was not significantly different between stages. B. Western blotting for KREMEN1 in blastocysts. Western blotting was performed with pools of either 45 or 103 embryos.

Detection of KREMEN1 in blastocysts by western blotting

Immunoreactive KREMEN1 was identified in two separate pools of blastocysts by western blotting (Fig. 1B). The estimated molecular weight of 48 kDa is close to the predicted molecular weight of 52 kDa. There was no specific labeling when anti-KREMEN1 was replaced by rabbit IgG (results not shown).

Regulation of CTNNB1 abundance by DKK1 in blastocysts

The mechanism by which DKK1 inhibits KREMEN-dependent WNT signaling is by blocking WNT-dependent accumulation of CTNNB1. Two experiments were conducted to test whether DKK1 reduced CTNNB1 in the bovine embryo. In the first, embryos were treated with DKK1 at day 5 and amounts of immunoreactive CTNNB1 were determined in individual blastocysts at day 7.5 using immunofluorescent labeling. Representative images of immunolocalization of CTNNB1 are shown in Fig. 2A. The protein was localized primarily in the plasma membrane. No nuclear labeling was observed. Quantification of immunofluorescence indicated that DKK1 reduced (P = 0.0202) intensity of immunolabeling of CTNNB1 (Fig. 2B).

Figure 2.

Figure 2

Effects of DKK1 on immunolabeling for CTNNB1. Embryos were treated from day 5 to 7.5 of development with 0 or 100 ng/mL DKK1. The amount of CTNNB1 in blastocysts was determined by immunolabeling and western blotting. (A) Representative images of blastocysts treated with vehicle or 100 ng/mL DKK1 and labeled for CTNNB1 (red). (B) Quantification of CTNNB1 fluorescent intensity. Data are a violin plot of results from individual embryos. Horizontal lines delineate quartiles. Amounts of CTNNB1 were lower (P = 0.0202) for embryos treated with DKK1. (C) Western blotting for CTNNB1 using pools of 25 blastocysts. Red bands represent total protein and green represents immunolabeled CTNNB1 (V, vehicle; D, DKK1). (D) Results of quantification of CTNNB1 fluorescent intensity as determined by western blotting. Data are least-squares means ± s.e.m. with total protein as a covariate. DKK1 lowered (P = 0.0326) immunoreactive CTNNB1.

The second experiment was conducted similarly except that amounts of immunoreactive CTNNB1 were determined by western blotting. As shown in Fig. 2C, the estimated molecular weight of immunoreactive CTNNB1 (97 kDa) was close to the predicted molecular weight (86 kDa). Analysis of the fluorescent intensity of the immunoreactive band of CTNNB1 indicated that DKK1 reduced (P = 0.0326) amounts of CTNNB1 (Fig. 2D).

Discussion

Results shown here indicate that KREMEN1 is present in the preimplantation embryo despite the large decline in mRNA abundance for KREMEN1 after the 9- to 16-cell stage. Immunoreactive KREMEN1 detected in the blastocyst could represent protein largely formed before the loss of mRNA. NLR family pyrin domain containing 5 is another example of a gene transcribed in the oocyte that results in protein persisting to the blastocyst stage (Tong et al. 2000). Alternatively, de novo translation persists through the blastocyst stage despite the reduction in mRNA. Experiments did not allow a determination of whether KREMEN2 is also present in the embryo. This is because the antibody to KREMEN1 is predicted to not cross-react with KREMEN2 and an antibody specific for KREMEN2 was unavailable.

Further support for the idea that DKK1 functions through effects mediated by KREMEN was the finding that, as expected, DKK1 reduced amounts of immunoreactive CTNNB1 in the blastocyst. The reduction in CTNNB1 was observed by immunofluorescent analysis as well as by western blotting. A similar reduction in CTNNB1 in the blastocyst by DKK1 was observed earlier by immunolocalization (Tríbulo et al. 2017b). A striking finding, also observed earlier in embryos (Tríbulo et al. 2017b) and bovine embryonic stem cells (Xiao et al. 2021c), was that CTNNB1 was localized immunochemically to the the plasma membrane but not to the nucleus. This observation is inconsistent with the idea that canonical WNT signaling requires nuclear translocation of CTNNB1 (van Amerongen & Nusse 2009, Hayat et al. 2021). One possibility is that nuclear CTNNB1 is not of high enough abundance to be detected by immunofluorescent techniques. Another is that DKK1 actions on the embryo involve disruption of functions of CTNNB1 in the plasma membrane. Indeed, membrane CTNNB1 is involved in regulation of differentiation (Goichberg et al. 2001). DKK1 can also regulate cell–cell adhesion through actions involving redistribution of membrane CTNNB1 (Johansson et al. 2019).

An important unanswered question is when transcription of KREMEN1 is first initiated in the embryo. The endometrium of the cow continues to express DKK1 past the period of blastocyst formation. Indeed, endometrial expression of DKK1 is increased at day 17 after ovulation in pregnant cows as compared to nonpregnant cows (Cerri et al. 2012), suggesting an important role for the protein in either the embryo or endometrium. To our knowledge, there is no report on expression of KREMEN by the fetal placenta.

In conclusion, the bovine preimplantation embryo contains transcripts for the prototypical DKK1 receptors KREMEN1 and KREMEN2. Moreover, KREMEN1 is present in the blastocyst-stage embryo. Given the observation that DKK1 can act to reduced amounts of CTNNB1 in the blastocyst, an event dependent upon KREMEN, it is likely that KREMEN1 is a functional receptor for |DKK1 in the preimplantation embryo.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the study reported.

Funding

Research was supported by NIH R01 HD088352, USDA-NIFA 2017-67015-264552, and the L.E. ‘Red’ Larson Endowment.

Author contribution statement

Experiments were conceived and designed by TFA and PJH. Experimental procedures were conducted by TFA, YX, SJ, TSM, CC, CAG, and TLS. Data analysis was performed by TFA and PJH. The first draft of the paper was written by TFA.

Acknowledgements

The authors thank Florida Beef Inc. for donation of ovaries and Eddie Cummings for technical assistance.

References

  1. Amaral TF Gonella-Diaza A Heredia D Melo GD Estrada-Cortés E Jensen LM Pohler K & Hansen PJ. 2022Actions of DKK1 on the preimplantation bovine embryo to affect pregnancy establishment, placental function, and postnatal phenotype†. Biology of Reproduction 107945–955. ( 10.1093/biolre/ioac128) [DOI] [PubMed] [Google Scholar]
  2. Caneparo L Huang YL Staudt N Tada M Ahrendt R Kazanskaya O Niehrs C & Houart C. 2007Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/β-catenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek. Genes and Development 21465–480. ( 10.1101/gad.406007) [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Cerri RL Thompson IM Kim IH Ealy AD Hansen PJ Staples CR Li JL Santos JE & Thatcher WW. 2012Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. Journal of Dairy Science 955657–5675. ( 10.3168/jds.2011-5114) [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Denicol AC Dobbs KB McLean KM Carambula SF Loureiro B & Hansen PJ. 2013Canonical WNT signaling regulates development of bovine embryos to the blastocyst stage. Scientific Reports 31266. ( 10.1038/srep01266) [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Fang L, Cai W, Liu S, Canela-Xandri O, Gao Y, Jiang J, Rawlik K, Li B, Schroeder SG, Rosen BD, et al. 2020Comprehensive analyses of 723 transcriptomes enhance genetic and biological interpretations for complex traits in cattle. Genome Research 30790–801. ( 10.1101/gr.250704.119) [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fleming TP Sheth B & Fesenko I. 2001 cell adhesion in the preimplantation mammalian embryo and its role in trophectoderm differentiation and blastocyst morphogenesis. Frontiers in Biosciences 6d1000–d1007. ( 10.2741/fleming) [DOI] [PubMed] [Google Scholar]
  7. Goichberg P Shtutman M Ben-Ze’ev A & Geiger B. 2001Recruitment of β-catenin to cadherin-mediated intercellular adhesions is involved in myogenic induction. Journal of Cell Science 1141309–1319. ( 10.1242/jcs.114.7.1309) [DOI] [PubMed] [Google Scholar]
  8. Hayat R Manzoor M & Hussain A. 2021Wnt signaling pathway: a comprehensive review. Cell Biology International 46863–877. ( 10.1002/cbin.11797) [DOI] [PubMed] [Google Scholar]
  9. Jeensuk S Ortega MS Hawryluk B Scheffler TL & Hansen PJ. 2022Actions of WNT family member 5A to regulate developmental competence of the bovine embryo. Biology of Reproduction 107928–944. ( 10.1093/biolre/ioac127) [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Johansson M Giger FA Fielding T & Houart C. 2019Dkk1 controls cell-cell interaction through regulation of non-nuclear β-catenin pools. Developmental Cell 51775–786.e3. ( 10.1016/j.devcel.2019.10.026) [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Kawano Y & Kypta R. 2003Secreted antagonists of the Wnt signalling pathway. Journal of Cell Science 1162627–2634. ( 10.1242/jcs.00623) [DOI] [PubMed] [Google Scholar]
  12. Kimura H, Fumoto K, Shojima K, Nojima S, Osugi Y, Tomihara H, Eguchi H, Shintani Y, Endo H, Inoue M, et al. 2016CKAP4 is a Dickkopf1 receptor and is involved in tumor progression. Journal of Clinical Investigation 1262689–2705. ( 10.1172/JCI84658) [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Krivega M Essahib W & Van de Velde H. 2015WNT3 and membrane-associated β-catenin regulate trophectoderm lineage differentiation in human blastocysts. Molecular Human Reproduction 21711–722. ( 10.1093/molehr/gav036) [DOI] [PubMed] [Google Scholar]
  14. Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Delius H, Hoppe D, Stannek P, Walter C, et al. 2002Kremen proteins are Dickkopf receptors that regulate Wnt/β-catenin signalling. Nature 417664–667. ( 10.1038/nature756) [DOI] [PubMed] [Google Scholar]
  15. Pan C Wang S Yang C Hu C Sheng H Xue X Hu H Lei Z Yang M & Ma Y. 2022Genome-wide identification and expression profiling analysis of Wnt family genes affecting adipocyte differentiation in cattle. Scientific Reports 12489. ( 10.1038/s41598-021-04468-1) [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Sang L Xiao Y Jiang Z Forde N Tian XC Lonergan P & Hansen PJ. 2021Atlas of receptor genes expressed by the bovine morula and corresponding ligand-related genes expressed by uterine endometrium. Molecular Reproduction and Development 88694–704. ( 10.1002/mrd.23534) [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Steinhart Z & Angers S. 2018Wnt signaling in development and tissue homeostasis. Development 145dev146589. ( 10.1242/dev.146589) [DOI] [PubMed] [Google Scholar]
  18. Tong ZB Gold L Pfeifer KE Dorward H Lee E Bondy CA Dean J & Nelson LM. 2000Mater, a maternal effect gene required for early embryonic development in mice. Nature Genetics 26267–268. ( 10.1038/81547) [DOI] [PubMed] [Google Scholar]
  19. Tríbulo P Leão BCDS Lehloenya KC Mingoti GZ & Hansen PJ. 2017aConsequences of endogenous and exogenous WNT signaling for development of the preimplantation bovine embryo. Biology of Reproduction 961129–1141. ( 10.1093/biolre/iox048) [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Tríbulo P Moss JI Ozawa M Jiang Z Tian XC & Hansen PJ. 2017bWNT regulation of embryonic development likely involves pathways independent of nuclear CTNNB1. Reproduction 153405–419. ( 10.1530/REP-16-0610) [DOI] [PubMed] [Google Scholar]
  21. Tríbulo P Bernal Ballesteros BH Ruiz A Tríbulo A Tríbulo RJ Tríbulo HE Bo GA & Hansen PJ. 2017cConsequences of exposure of embryos produced in vitro in a serum-containing medium to dickkopf-related protein 1 and colony stimulating factor 2 on blastocyst yield, pregnancy rate, and birth weight. Journal of Animal Science 954407–4412. ( 10.2527/jas2017.1927) [DOI] [PubMed] [Google Scholar]
  22. Tríbulo P Siqueira LGB Oliveira LJ Scheffler T & Hansen PJ. 2018aIdentification of potential embryokines in the bovine reproductive tract. Journal of Dairy Science 101690–704. ( 10.3168/jds.2017-13221) [DOI] [PubMed] [Google Scholar]
  23. Tríbulo P Jumatayeva G Lehloenya K Moss JI Negrón-Pérez VM & Hansen PJ. 2018bEffects of sex on response of the bovine preimplantation embryo to insulin-like growth factor 1, activin A, and WNT7A. BMC Developmental Biology 1816. ( 10.1186/s12861-018-0176-2) [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Tríbulo P Rabaglino MB Bo MB Carvalheira LR Bishop JV Hansen TR & Hansen PJ. 2019aDickkopf-related protein 1 is a progestomedin acting on the bovine embryo during the morula-to-blastocyst transition to program trophoblast elongation. Scientific Reports 911816. ( 10.1038/s41598-019-48374-z) [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Tríbulo P Rivera RM Ortega Obando MS Jannaman EA & Hansen PJ. 2019bProduction and culture of the bovine embryo. Methods in Molecular Biology 2006115–129. ( 10.1007/978-1-4939-9566-0_8) [DOI] [PubMed] [Google Scholar]
  26. van Amerongen R & Nusse R. 2009Towards an integrated view of Wnt signaling in development. Development 1363205–3214. ( 10.1242/dev.033910) [DOI] [PubMed] [Google Scholar]
  27. Xiao Y Sosa F Ross PJ Diffenderfer KE & Hansen PJ. 2021aRegulation of NANOG and SOX2 expression by activin A and a canonical WNT agonist in bovine embryonic stem cells and blastocysts. Biology Open 10bio058669. ( 10.1242/bio.058669) [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Xiao Y Sosa F de Armas LR Pan L & Hansen PJ. 2021bAn improved method for specific-target preamplification PCR analysis of single blastocysts useful for embryo sexing and high-throughput gene expression analysis. Journal of Dairy Science 1043722–3735. ( 10.3168/jds.2020-19497) [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Xiao Y Amaral TF Ross PJ Soto DA Diffenderfer KE Pankonin AR Jeensuk S Tríbulo P & Hansen PJ. 2021cImportance of WNT-dependent signaling for derivation and maintenance of primed pluripotent bovine embryonic stem cells†. Biology of Reproduction 10552–63. ( 10.1093/biolre/ioab075) [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Xie H Tranguch S Jia X Zhang H Das SK Dey SK Kuo CJ & Wang H. 2008Inactivation of nuclear Wnt-β-catenin signaling limits blastocyst competency for implantation. Development 135717–727. ( 10.1242/dev.015339) [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Reproduction & Fertility are provided here courtesy of Bioscientifica Ltd.

RESOURCES