Abstract
Gap junction channels in cumulus–oocyte complexes (COCs) enable the transmission and communication of small molecular signals between adjacent cells, such as cAMP. However, the regulation of gap junction function (GJF) by cAMP and the underlying mechanisms involved are not fully clarified. This study investigated the effect of cAMP on connexin 43 (CX43) expression and GJF in ovine COCs using immunofluorescence, quantitative real-time PCR (qRT-PCR), western blotting, and GJF detection. The CX43 was only found in the cumulus cells (CCs) side of ovine COC. The intra-oocyte cAMP showed a significant increase at 30 min, while the intra-CC cAMP exhibited two peaks at 10 min and 1 h during in vitro maturation (IVM). Phosphorylated CX43 protein exhibited an immediate increase at 10 min, and CX43 protein displayed two peaks at 10 min and 1 h during IVM. The duration of pre-IVM exposure to forskolin and IBMX significantly enhanced phosphorylated and total CX43, as well as Gja1 and Creb genes, for 10 min; these effects were counteracted by Rp-cAMP. Both pre-IVM with forskolin and IBMX for 1 h and the GJF and CX43/p-CX43 ratio were elevated. The closure of gap junction channels caused by phosphorylated CX43 to prevent cAMP outflow from oocytes in early IVM of COC. Cyclic AMP upregulated phosphorylated and total CX43 via genomic and non-genomic pathways, but its functional regulation was dependent on the balance of the two proteins. This study provides a new insight into the regulatory mechanism between cAMP and GJF, which would improve IVM in animal and clinical research.
Key Words: ovine cumulus–oocyte complexes, cyclic adenosine monophosphate, connexin 43, protein phosphorylation, gap junctional function
Introduction
Gap junctions, a type of cell membrane channel that exists in close contact sites between adjacent cells, allow the transfer and communication of ions and metabolites between cells, which is crucial for maintaining the normal physiological function of mammalian follicles (1, 2). Connexin 43 (CX43), encoded by the gap junction α-1 (Gja1) gene, represents a major connexin widely expressed in mammalian follicles. CX43 homologous or heterologous gap junction channels formed between follicular somatic cells or somatic cells and oocytes mediate complex message exchange between cells and are necessary for granulosa cell proliferation, differentiation, and oocyte growth and maturation during follicular development (3, 4, 5). In addition, the coupling and dissociation of gap junctions are dynamic processes regulated bidirectionally by CX43 expression or phosphorylation modification. It has been reported that the knockout of the Gja1 gene in mice damages the normal structure and growth of follicles (6), and CX43 phosphorylation induces the closure of gap junction channels between adjacent cells in rats (7).
Oocytes in antral follicles are always in meiotic arrest before the onset of the gonadotropin surge, and the increased intra-oocyte cAMP is considered the key factor in maintaining this state (8, 9). Although oocytes can synthesize cAMP on their own, the peripheral cumulus cells (CCs) serve as the primary source of intra-oocyte cAMP, which is transmitted through gap junction channels (10). A rapid increase in pre-ovulatory gonadotropin levels can induce transient phosphorylation of CX43 and temporary closure of CC–oocyte gap junctions in goats (11). Blocking gap junctions with specific blockers in mice (12) and rats (13), or artificially separating the somatic compartment from the oocytes of intact hamster follicles (14), can lead to oocyte germinal vesicle breakdown (GVBD). Therefore, it is speculated that gonadotropin-induced gap junction closure prevents inhibitors in CCs from reaching oocytes, eventually leading to meiotic resumption (15, 16). However, this hypothesis is not fully considered. Various studies have shown that administration with follicle-stimulating hormone (FSH) in goats (17) or luteinizing hormone (LH) in rats (18) results in a transient increase in the amount of phosphorylated CX43 protein in cumulus–oocyte complexes (COCs). The intra-oocyte cAMP level is elevated immediately after stimulation with FSH (17) or LH (19) alone for 30 min or 60 min, respectively. Considering that gap junction channel closure may lag behind CX43 protein phosphorylation, the above findings also provide a new starting point for reinterpreting the correlation of gap junction dynamic changes with meiosis resumption.
Gap junction channels allow the free transmission and communication of small molecules like cAMP between follicular cells (20). Indeed, cAMP also has an impact on connexin expression and gap junction function (GJF) in porcine prepubertal settings (21). Previous studies have shown that the treatment of COCs with cAMP modulators could prolong bovine CC–oocyte GJF (22, 23, 24), enhance gap junction coupling in sheep CCs (25), stimulate intra-CC cAMP synthesis, CX43 accumulation, and phosphorylation on specific sites during in vitro maturation (IVM) (18, 26, 27). As mentioned previously, CX43 accumulation or phosphorylation modification can either enhance or attenuate follicular cell GJF, respectively. This complexity underscores the intricate and currently unknown nature of the synergistic regulation involving cAMP, CX43 protein expression, phosphorylation modification, and alterations in GJF during the process of follicular development.
cAMP is a crucial intracellular second messenger that interacts with the regulatory subunits of cAMP-dependent protein kinase (PKA), leading to the activation of PKA activity. Subsequently, it regulates downstream target gene transcription or protein phosphorylation through genomic or non-genomic pathways (28, 29). PKA exhibits a direct relation with FSH-mediated CX43 phosphorylation in rat granulosa cells (27). The Creb signal is associated with PKA-stimulated CX43 synthesis in rat granulosa cells (30). These findings shed light on the potential mechanism by which PKA is involved in the accumulation and functionality of CX43 in granulosa cells. Nevertheless, the specific impact of cAMP on GJF in sheep COCs during IVM remains unclear.
The objective of our experiments was to explore a potential connection between intrafollicular cAMP and CC–oocyte GJF during follicular development. The present study primarily aimed to identify the location of CX43 protein in immature ovine COCs, assess the dynamic changes of cAMP and CX43 in ovine COCs during conventional IVM, and investigate how cAMP influenced CX43 expression and CC–oocyte GJF to gain insights into its role in ovine follicular development. We hypothesize that cAMP-mediated enhancement of ovine CC–oocyte GJF might be achieved by its differential regulation of CX43 expression and phosphorylation.
Materials and methods
Chemicals and reagents
All chemicals utilized in this study were sourced from Sigma-Aldrich, unless otherwise specified. Rp-cAMP was obtained from Apoptosis and Epigenetics Company (B9004).
COC collection
Ovaries were collected from healthy, nonpregnant sheep (small-tailed Han sheep, weighing 25–35 kg, n = 60) at various stages of the estrous cycle. These ovaries were obtained from a commercial abattoir and transported to the laboratory in saline containing penicillin (10 U/mL) and streptomycin (10 µg/mL) at a temperature of 35–37°C within 2 h. Immature COCs from antral follicles measuring 2–6 mm in size were obtained by slicing and then placed in tissue culture medium (TCM–199, Gibco, 31100–027) supplemented with heparin sodium (Sigma, PHR8927, 0.1 mg/mL), gentamicin (Sigma, E003632, 0.05 mg/mL), sodium bicarbonate (Sigma, S5761, 2.2 g/mL), and bovine serum albumin (Solarbio, BSA; A8010, 1 mg/mL) until transferred into IVM or pre-IVM medium. Only COCs surrounded by multiple layers of compact CCs were used for the experiments. All animals were nonpregnant and studies carried out in vitro were subjected to the same culture conditions and treatments. All animals were cared for and handled following specific protocols approved by the Animal Welfare and Research Ethics Committee of the Inner Mongolia Agricultural University, China (approval no: NND2022001).
In vitro maturation and pre-IVM
Immature COCs were extracted from aspirated follicular fluid and cultured in TCM–199 supplemented with 0.2 mg/mL sodium pyruvate (Sigma, P5280), 2.35 mg/mL HEPES (Sigma, H6147), 10% fetal bovine serum (FBS, Clack, FB25015), 0.02 IU/mL follicle-stimulating hormone (FSH, Ningbo Second Hormone Factory, Ningbo, China), 0.12 IU/mL luteinizing hormone (LH, Ningbo Second Hormone Factory, Ningbo, China), and 1 µg/mL 17 β-estradiol (Wako, 058–04043) for IVM periods. Immature COCs were also cultured in VitroMat containing 4 mg/mL fatty acid-free bovine serum albumin, with or without 100 µM forskolin (FSK), 500 µM 3-isobutyl-1-methyxanthine (IBMX), and Rp-cAMP duringpre-IVM periods. About 10–100 COCs were placed into four-well petri dishes containing 500 µL of maturation medium, covered with mineral oil, and maintained under 5% CO2 at 39°C. The COCs were cultured in IVM or pre-IVM for various durations according to each experimental design and then collected for mRNA or protein expression analyses and GJF detection.
Immunofluorescence analysis
Paraffin-embedded sections of immature COCs were processed as previously described (31). A group of 50–60 immature COCs was collected, fixed with 4% paraformaldehyde (Solarbio, P1110) at 4°C for 12 h, and subsequently processed. After fixation, the COCs were dehydrated in 70%, 95%, and 100% alcohol at room temperature for 30 min, followed by incubation in xylene for 30 min. The COCs were then embedded in soft wax and hard wax, respectively. These paraffin blocks were cut into 5-µm thick sections, blocked with 5% normal donkey serum (Jackson ImmunoResearch Laboratories, 017-000-121), and incubated with anti-CX43 (1:100, Thermo Fisher, monoclonal, 13–8300) for 1 h at 37°C, followed by detection using Alexa Fluor® 555 donkey anti-mouse secondary antibody (1:800, Abcam, 150110) for 1 h at 37°C. The sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, 2 µg/mL, Abcam, ab104139). Images were captured using the Nikon C2 confocal microscope (Nikon, Tokyo, Japan) and analyzed using NIS-Elements software. Antibody specificity was verified (Supplementary Fig. 1, see section on supplementary materials given at the end of this article).
Enzyme-linked immunosorbent assay
After culturing a group of ten COCs for IVM, CCs were separated from oocytes, and both were transferred in 100 µL of 0.1 M HCl. Subsequently, cAMP concentrations in the CCs and oocytes were determined by ELISA using the cAMP ELISA kit (Cayman, 581001) according to the manufacturer’s protocol.
Western blotting
Immature COCs were cultured in standard IVM or pre-IVM medium with or without FSK, IBMX, and Rp-cAMP for varying durations. Total proteins were extracted from 50 COCs using radioimmunoprecipitation assay (RIPA) buffer (CWBIO, CW2333S) containing 1% phenylmethylsulfonyl fluoride (Roche, 22525322) for 30 min on ice, followed by centrifugation. Protein concentration was determined using a bicinchoninic acid assay (Thermo Fisher, 23227). The lysates were heated at 100°C for 5 min, cooled on ice, and then centrifuged at 12,000 rpm for 5 min. Equal amounts of proteins (20 µg) were loaded per lane in SDS-PAGE (4% stacking gel and 10% resolving gel) and transferred onto a nitrocellulose membrane (Pall Corporation, 66485). The membrane was blocked with 3% BSA for 1 h at room temperature. Following blocking, the membranes were incubated with primary antibodies, including mouse anti-α-tubulin antibody (1:10,000, Sigma, monoclonal, T5168), mouse anti-CX43 (1:1000, Abcam, monoclonal, ab79010), and rabbit anti-p-CX43 (1:1000, Signalway Antibody, polyclonal, 12564), overnight at 4°C. After primary antibody incubation, the membranes were incubated with secondary antibodies, specifically donkey anti-rabbit (1:10,000, Abcam, ab175772) and donkey anti-mouse (1:10,000, ab175782, Abcam), for 1 h at room temperature. Images were captured using the ChemiDocTM XRS+ system (Odyssey; LI-COR Biosciences).
Quantitative real-time polymerase chain reaction
Immature COCs were cultured in pre-IVM medium with or without FSK, IBMX, and Rp-cAMP for 10 min. Total RNA was extracted from 50 COCs using the Supermicroscale RNA Mini kit (Mei5 Biotechnology, Co., Ltd, MF789, Beijing, China). cDNA was synthesized using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa, RR047A) following the manufacturer’s protocol. Quantitative RT-PCR was conducted using the Bio-Rad CFX96 Real-Time PCR System (Bio-Rad Laboratories), with β-actin serving as the internal control. The primer sequences used for qRT-PCR are listed in Table 1. cDNA samples were amplified under the following cycling conditions: initial denaturation for 30 s at 95°C, followed by 40 cycles of 95°C for 5 s, annealing at 72°C for 5 s, and extension at 60°C for 15 s. The relative expression of Gja1 and Creb was calculated using the 2–∆∆Ct method (32).
Table 1.
Primers used for quantitative real-time PCR.
| Primer | Sequence (5′→3′) | Length (bp) | Accession number |
|---|---|---|---|
| β-actin | F: CCATCGGCAATGAGCGGT R: CGTGTTGGCGTAGAGGTC |
146 | NM_001009784.3 |
| Gja1 | F: TCGTGTCGTTGGTGTCTCTTG R: GAGGAGCAGCCATTGAAATAAGC |
175 | XM_004011159.4 |
| Creb | F: ATAGTGTAACCGATTCCCAGA R: CTGTATTGCTCCTCCTTGGGT |
229 | XM_015093513.2 |
β-actin, beta-actin; Creb, cyclic adenosine monophosphate response element–binding protein; F, forward; Gja1, gap junction protein alpha 1; R, reverse.
Assessment of CC–oocyte GJF
The assessment of GJF between the oocyte and the CCs was conducted as previously described (33). A batch of 100 immature COCs was cultured in pre-IVM medium with or without FSK, IBMX, and Rp-cAMP for 1 h. A 3% (w/v) solution of Lucifer yellow (LY, Sigma, L0259) in 5 mM lithium chloride was pressure-injected into the oocytes. A semiquantitative GJF index was calculated based on the scores (34). Briefly, intra-CC LY levels were assigned as +2 when the dye was transferred to the entire cumulus layers, +1 when the dye was transferred to a few CC layers, and 0 when there was minimal or no dye transfer to the CCs.
Statistical analysis
Statistical analyses were conducted using GraphPad Prism 5.0 (GraphPad Software). The data were analyzed using Student’s t-test for comparisons between two groups and one-way ANOVA with Tukey’s test for comparisons among multiple groups. The results are presented as the mean ± s.e.m. from three independent experiments (n = 3). P < 0.05 were considered statistically significant.
Results
Localization of CX43 protein in ovine COCs
The localization of CX43 protein in immature COCs was detected using a novel COCs paraffin section technique developed in our laboratory (31). The findings revealed exclusive CX43 expression in CCs, with no detectable CX43 expression in oocytes (Fig. 1). The absence of CX43 protein in oocytes suggests its possible involvement in the formation of the gap junction self-channel at the CC side. Supporting evidence confirming CX43 expression as punctate staining in COCs is shown in Supplementary Fig. 2.
Figure 1.
Localization of CX43 in immature ovine COCs. Immature ovine COCs section samples were stained for CX43 using an Alexa 555-conjugated secondary antibody (green) and nucleus using DAPI (blue). A represents the CX43 and DAPI in combination; A1 and A2 represent CX43 and DAPI, respectively; A3 represents the COC morphology in normal light; B, B1, B2, and B3 represent the negative comparison of A, A1, A2, and A3, respectively.
Dynamic changes in cAMP, p-CX43, and CX43 levels in ovine COCs during IVM
Initially, cAMP levels in CCs and oocytes from the same COCs were measured at various time points within 8 h of conventional IVM using ELISA. The results showed a significant increase in intra-oocyte cAMP levels at 30 min, followed by a continuous decrease to the lowest value at 6 h, significantly different from 0 h (P < 0.05, Fig. 2A). Intra-CC cAMP levels peaked at 10 min and 1 h after culture, respectively, significantly higher than at 0 h (P < 0.05, Fig. 2B). CAMP levels rapidly decreased after 1 h of culture in both compartments, CCs and oocytes. Subsequently, the western blotting technique was employed to assess dynamic changes in CX43 protein and its phosphorylation levels within a 2-h timeframe within COCs. The results showed an immediate increase in phosphorylated CX43 protein at 10 min, significantly higher than at 0 h (P < 0.01, Fig. 2C). After 30 min of culture, it decreased to the basal level similar to that at 0 h. However, CX43 protein in COCs exhibited two peaks at 10 min and 1 h, respectively, significantly different from 0 h (P < 0.05, Fig. 2D).
Figure 2.
The kinetic changes in cAMP, p-CX43, and CX43 in ovine COCs during IVM. Immature COCs were cultured in standard IVM for 10 min, 30 min, 1 h, 2 h, 4 h, 6 h,and 8 h, and then cAMP in oocytes (A) and CCs (B) were, respectively, measured. Different letters indicate significantly different (P < 0.05; one-way ANOVA). Immature COCs were cultured in standard IVMfor 10 min, 30 min, 1 h, and 2 h, and then CX43 phosphorylation (C) and total protein (D) were measured. Data are representative of three independent experiments. **P < 0.01, *P < 0.05.
Modulation of intra-COC p-CX43 and CX43 expression by cAMP
To eliminate potential interference from hormones (gonadotropin and estradiol) and serum, defined pre-IVM media containing cAMP modulators (100 µM FSK and 500 µM IBMX) were used. The intra-COC cAMP level was then detected at two time points: 0 h and 10 min of pre-IVM. The results revealed that the exposure to FSK and IBMX significantly increased the intra-COC cAMP level at 10 min compared to 0 h (P < 0.05, Fig. 3A). The cAMP level in the FSK and IBMX treatment group was approximately six times higher than that in the untreated group at 10 min (Fig. 3A). Next, the effect of cAMP on the protein level and phosphorylation of CX43 in COCs at 10 min afterpre-IVM was determined using western blotting. The findings demonstrated that the treatment with FSK and IBMX led to a significant increase in both the phosphorylation and protein expression of CX43. This effect was effectively attenuated by the administration of Rp-cAMP, a specific inhibitor of PKA (Fig. 3B and C). Treatment with FSK and IBMX also significantly increased the transcript expression of Gja1 and Creb genes in ovine COCs compared to the control (P < 0.05, Fig. 3D and E).
Figure 3.
Effect of forskolin and IBMX on p-CX43 and CX43 in COCs during pre-IVM. (A) Immature COCs were treated with or without 100 µM FSK and 500 µM IBMX in pre-IVM for 0 and 10 min, and then cAMP were measured. A and B are significantly different (* P < 0.05; one-way ANOVA) between time points within the FSK and IBMX treatment. Means with a non-common letter (x) represents the lack of difference between time points within the control treatment. Asterisks indicate means that are significantly different (* P < 0.05; t-test) between pre-IVM treatments at that time point. Immature COCs were treated with or without FSK, IBMX, and Rp-cAMP in pre-IVM for 10 min, and then phosphorylation (B) and total protein of CX43 (C) were measured (* P < 0.05, **P < 0.01; one-way ANOVA). Immature COCs were treated with or without FSK and IBMX in pre-IVM for 10 min and the Gja1 (D) and Creb (E) mRNA were examined (*P < 0.05, **P < 0.01; t-test). FSK, forskolin.
Role of cAMP in CC–oocyte GJF
To further ascertain whether CC–oocyte GJF depends on cAMP signaling, the transfer of LY dye from the oocytes to their peripheral cumulus vestment was used to measure GJF integrity after 1 h in pre-IVM medium with or without FSK, IBMX, and Rp-cAMP (Fig. 4A). The GJF remained significantly (P < 0.05, P < 0.01, Fig. 4B) higher in COCs exposed to FSK and IBMX treatment for 1 h compared to those in the control and treatment with FSK and IBMX combined with Rp-cAMP. This suggests that the specific PKA inhibitor effectively blocked CC–oocyte GJF enhancement by cAMP. Next, the effect of cAMP on CX43 phosphorylation and protein expression was examined after 1 h in pre-IVM medium with or without FSK, IBMX, and Rp-cAMP. Treatment with FSK and IBMX led to a significant increase in the phosphorylation of CX43 (P < 0.01, Fig. 4C) and protein expression (P < 0.001, Fig. 4D), as well as the ratio of CX43/p-CX43 compared to the untreated group (Fig. 4E). This effect could be reversed by the administration of Rp-cAMP, indicating that cAMP has a differential effect on CX43 phosphorylation and protein expression.
Figure 4.
cAMP prolongs CC–oocyte GJF. The functional coupling between oocyte and CCs was assessed after injection of lucifer yellow dye. As shown in the representative images (A), gap junctions were classified as closed (A1), partial (A2), or open (A3), and scored as 0, 1, and 2, respectively, and the gap junction index was calculated. A total of 300 oocytes were used in these experiments (threereplicates per group). (B) Immature COCs were treated with or without FSK, IBMX, and Rp-cAMP in pre-IVM for 1 h and then GJF was assessed (*P < 0.05, **P < 0.01; one-way ANOVA). Immature COCs were treated with or without FSK, IBMX, and Rp-cAMP in pre-IVM for 1 h and then CX43 phosphorylation (B), CX43 protein (C), and the ratio of total protein to phosphorylation (E) were measured (*P < 0.05, **P < 0.01, and ***P < 0.001; one-way ANOVA). FSK, forskolin.
Discussion
In previous studies, it has been demonstrated that intra-COC cAMP and CX43 interact to play a role in follicular development (25, 33, 35). However, the precise mechanisms through which cAMP regulates CX43 expression and subsequent GFJ remain unclear. In this study, we provide evidence that cAMP can induce CX43 phosphorylation or its expression through non-genomic and genomic pathways, respectively. Stimulation with cyclic AMP leads to an increase in cumulus–oocyte GJF. This increase can be attributed to the more significant impact of cAMP on CX43 protein expression compared to its phosphorylation, as observed under the specific experimental conditions used in this investigation. Additionally, it is worth considering that cyclic guanosine monophosphate (cGMP) plays a role in regulating CX43 phosphorylation and protein expression by inhibiting the degradation of cAMP in oocytes, primarily through the action of phosphodiesterase PDE3A, which can be counteracted by cGMP. These results provide valuable mechanistic insights into the processes underlying IVM and in vivo follicular development in ovine oocytes.
In this study, we first identified the location of the CX43 protein in immature sheep COCs using a novel paraffin section technique developed in our laboratory (31). The results revealed that the CX43 protein was exclusively present in the cumulus compartment of sheep COCs. This finding is consistent with previous studies conducted in mice (36), bovines (37), humans (38), and sheep (39), which reported the presence of CX43 in GCs at all stages of follicular development but not in oocytes. Interestingly, a recent study in goats (17) reported CX43 localization in granulosa cells, the zona pellucida, and theca cells during the development of antral follicles. Although our study did not examine the localization of the CX43 protein in the sheep zona pellucida, our results align with the previous findings. Another study suggested the presence of CX43 protein in immature porcine oocytes, with dynamic changes duringIVM, and hypothesized the transportation of intra-CC CX43 to oocytes to form oocyte–CC gap junction channels (40). This indicates potential differences in the expression pattern of CX43 in porcine COCs compared to other species like sheep.
Subsequently, we investigated the dynamic changes in cAMP, CX43 protein, and phosphorylation during IVM in sheep COCs. We measured intra-CC and intra-oocyte cAMP levels at various time points within an 8-h period of conventional IVM. Our results revealed a significant increase in intra-oocyte cAMP content at 30 min, followed by a continuous decrease. In contrast, intra-CC cAMP levels exhibited two peaks at 10 min and 1 h, respectively. These observations are consistent with previous studies reporting transient increases in intra-oocyte cAMP when mouse COCs were treated with FSH or LH alone for 30 min or 1 h (16, 19). Another study showed that FSH, alone or in combination with LH, could significantly elevate intra-CC cAMP content in mouse or sheep COCs for 1 h (41, 42). These results align with our findings in a conventional IVM system, which included both FSH and LH. Given that CX43 was exclusively located in the cumulus compartment of sheep COCs rather than oocytes, we used COCs instead of CCs and monitored dynamic changes in CX43 protein and phosphorylation simultaneously to avoid potential interference caused by artificially separating cumulus and oocytes. Our results revealed a significant increase in CX43 phosphorylation at 10 min after IVM, with CX43 peaking twice at 10 min and 1 h, respectively (43). This rapid adjustment in intercellular gap junction channel numbers due to the short half-life of CX43 protein is consistent with similar studies demonstrating that treatment with FSH, alone or in combination with LH, for 10 min could increase CX43 protein levels in rat (44) and mice (45) granulosa cells and induce CX43 phosphorylation in mouse and rat (16, 18). These findings suggest that gonadotropins regulate inter-somatic cell or CC–oocyte GJF by binding to their specific receptors located on CCs and mural granulosa cells within developing follicles.
The temporary closure of gap junction channels in mouse COCs during the early stages of oocyte meiosis is attributed to the transient phosphorylation of CX43. This process is believed to be induced by gonadotropins, leading to the phosphorylation of gap junction proteins in both granulosa cells and CCs. Consequently, there is a reduction in the transfer of molecules, including cAMP, between these cells and between CCs and the oocyte (16). Our findings suggest that the intra-oocyte cAMP level exhibits a significant increase within 30 min, followed by a continuous decrease until reaching its lowest point at 6 h. In contrast, the intra-CC cAMP level exhibits two peaks at 10 min and 1 h. The closure of gap junction channels due to phosphorylation at 10 min prevents molecular transfer between CCs and oocytes, halting the flow of cAMP synthesized by the oocytes to CCs. This results in the gradual accumulation of cAMP within the oocytes, which decreases upon channel opening at 30 min. This dynamic pattern is consistent with previous studies showing a sharp decrease in the gap junction between the oocyte and CCs within the first 10 min of culture during FSH-induced COC maturation, followed by stability for 40 min and a subsequent return to initial levels at 60 min. Additionally, there is a noticeable surge in cAMP levels in mouse oocytes approximately 30 min after FSH stimulation (46). Furthermore, intra-oocyte cAMP continuously decreases from 30 min to 6 h, possibly related to the decrease in CX43 phosphorylation at 30 min and the increase in total protein at 1 h, as both processes could restore CC–oocyte GJF, causing cAMP to flow out of oocytes and triggering meiosis resumption. This finding supports the notion that a decrease in intra-oocyte cAMP is necessary for meiosis resumption, as indicated by the dynamic curve of sheep IVM oocytes (47). Interestingly, the dynamic variation curves of intra-COC CX43 and cAMP, which exhibited similarities, raise questions about whether and how cAMP is involved in regulating CX43 levels and phosphorylation during sheep COC maturation.
To eliminate potential interference from gonadotropins and serum, we chose a defined pre-IVMsystem in the present study, containing only cAMP modulators (FSK and IBMX). Several studies have reported that FSK and IBMX, either alone or in combination, significantly increased intra-oocyte cAMP concentration in various species, including mice (48), bovines (49), rats (50), pigs (51), and sheep (52). Similarly, we found that intra-COC cAMP levels were significantly upregulated after treatment with the same concentration of FSK and IBMX for 10 min. Subsequently, there was an increase observed in CX43 gene and protein expression, along with phosphorylation modification. The primary effector of cAMP is PKA, a specific serine/threonine kinase. In its inactive state, PKA exists as a tetrameric holoenzyme composed of a dimer of regulatory (R) subunits and two catalytic (C) subunits. When two cAMP molecules bind to each R subunit, a conformational change occurs, releasing the active C subunit (53). Rp-cAMP, which is a cAMP analog, acts as a potent competitive antagonist of cAMP-induced activation of both PKA I and II (54). Our findings demonstrated that FSK and IBMX significantly increased the phosphorylation and protein expression of CX43. However, the administration of Rp-cAMP attenuated these effects, indicating the involvement of PKA in cAMP-induced CX43 phosphorylation and overall protein expression. Previous studies have shown that PKA mediates LH-induced CX43 phosphorylation (18). Additionally, inhibition of PKA significantly decreased CX43 phosphorylation stimulated by cAMP (55), and the use of H-89, a specific PKA inhibitor, effectively blocked intra-COC CX43 accumulation (56). Moreover, PKA/Creb has been reported to be involved in the enhancement of Gja1 transcription (30). PKA primarily affects downstream target proteins through two pathways: phosphorylating cytoplasmic target proteins through a non-genomic pathway and/or upregulating Creb, which then initiates target gene transcription after entering the nucleus through a genomic pathway. Therefore, we speculate that gonadotropins upregulate intra-COC cAMP, activate PKA in developing follicles, and synergistically mediate CX43 accumulation and phosphorylation modification through the pathways mentioned above.
The coupling or dissociation of gap junction channels depends on the quantity or phosphorylation of connexins. However, it is still unclear how cAMP synergistically upregulates CX43 accumulation and phosphorylation to promote CC–oocyte GJF. In this study, sheep COCs were treated with or without FSK, IBMX, and Rp-cAMP in pre-IVMfor 1 h, after which we investigated the effects of cAMP on CC–oocyte GJF, CX43 expression, and phosphorylation. Our results showed that the application of cAMP modulators significantly increased the functional gap junction communication capacity between ovine CCs and oocytes. This finding aligns with previous research conducted in cattle, which also observed that treatment with FSK and IBMX for 2 h prolonged the gap in junctional communication between CCs and oocytes duringpre-IVM(57). Additionally, although FSK and IBMX treatment for 1 h increased CX43 total protein and phosphorylated protein levels, the ratio of CX43/p-CX43 also increased significantly. This suggests that under the present experimental conditions, CX43 total protein accumulation occurred at a faster rate than phosphorylation. Throughout follicular development, there is an integration of increasing gap connexins into adjacent follicular somatic cell membranes, leading to the formation of functional gap junction coupling. Connexin phosphorylation, on the other hand, causes the dissociation of these channels. The communication ability of gap junctions between adjacent cells depends on the balance between connexin accumulation and phosphorylation modification. Therefore, it is speculated that cAMP-mediated enhancement of ovine CC–oocyte GJF might be achieved through its differential regulation of CX43 expression and phosphorylation.
In conclusion, CX43 may have a role in the gap junction formation of the cumulus compartment in ovine COCs. The transient phosphorylation of CX43 induced by gonadotropins effectively inhibits the outflow of cAMP from oocytes, thereby preventing the premature onset of meiosis. Additionally, cAMP modulated CX43 expression and function through genomic and non-genomic pathways: CX43 phosphorylation was induced directly by cAMP-activated PKA, which entered the nucleus to upregulate Creb and then initiated gene transcription and translation. The enhanced CC–oocyte GJF appears to be primarily attributed to the stronger positive regulation of CX43 expression rather than its phosphorylation. These findings provide important evidence that cAMP influences CX43 phosphorylation and protein expression, prolonging CC–oocyte GJF. This effect may have significant implications for further elucidating the mechanism of follicular development and promoting the application of IVM and pre-IVMtechniques in livestock reproduction and human infertility.
Supplementary Materials
Declaration of interest
The authors declare no competing interest.
Funding
This work was supported by two from the National Natural Science Foundation of China (no. 32260867 and 31760717) and one from the Huhhot Science & Technology Plan (no. 2020-Ke Ji Xing Meng-National Innovation Center-12).
Author contribution statement
YFZ contributed to data curation, study concept, methodology, manuscript drafting, and software analysis. NE was in charge of the study concept, methodology, manuscript drafting, writing, reviewing, and editing. BXY was responsible for data curation and methodology. XNB and WS were involved in data curation. SG and GFC were in charge of the formal analysis. HJL and GW were responsible for the study concept, funding acquisition, project administration, resources, manuscript writing, reviewing, and editing.
Acknowledgements
The authors thank Boyang Yu and Chenguang Du for their discussions and Li lab members for their comments on manuscript drafting.
References
- 1.El-Hayek S & Clarke HJ. Follicle-stimulating hormone increases gap junctional communication between somatic and germ-line follicular compartments during murine oogenesis. Biology of Reproduction 20159347. ( 10.1095/biolreprod.115.129569) [DOI] [PubMed] [Google Scholar]
- 2.Gingrich J Pu Y Upham BL Hulse M Pearl S Martin D Avery A & Veiga-Lopez A. Bisphenol S enhances gap junction intercellular communication in ovarian theca cells. Chemosphere 2021263128304. ( 10.1016/j.chemosphere.2020.128304) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bus A Szymanska K Pintelon I Leroy JLMR Leybaert L & Bols PEJ. Preservation of connexin 43 and transzonal projections in isolated bovine pre-antral follicles before and following vitrification. Journal of Assisted Reproduction and Genetics 202138479–492. ( 10.1007/s10815-020-01993-2) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gittens JE Mhawi AA Lidington D Ouellette Y & Kidder GM. Functional analysis of gap junctions in ovarian granulosa cells: distinct role for connexin43 in early stages of folliculogenesis. American Journal of Physiology. Cell Physiology 2003284C880–C887. ( 10.1152/ajpcell.00277.2002) [DOI] [PubMed] [Google Scholar]
- 5.Martins-Marques T Ribeiro-Rodrigues T Batista-Almeida D Aasen T Kwak BR & Girao H. Biological functions of connexin43 beyond intercellular communication. Trends in Cell Biology 201929835–847. ( 10.1016/j.tcb.2019.07.001) [DOI] [PubMed] [Google Scholar]
- 6.Ackert CL Gittens JE O'Brien MJ Eppig JJ & Kidder GM. Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse. Developmental Biology 2001233258–270. ( 10.1006/dbio.2001.0216) [DOI] [PubMed] [Google Scholar]
- 7.Sela-Abramovich S Chorev E Galiani D & Dekel N. Mitogen-activated protein kinase mediates luteinizing hormone-induced breakdown of communication and oocyte maturation in rat ovarian follicles. Endocrinology 20051461236–1244. ( 10.1210/en.2004-1006) [DOI] [PubMed] [Google Scholar]
- 8.Straczynska P Papis K Morawiec E Czerwinski M Gajewski Z Olejek A & Bednarska-Czerwinska A. Signaling mechanisms and their regulation during in vivo or in vitro maturation of mammalian oocytes. Reproductive Biology and Endocrinology 20222037. ( 10.1186/s12958-022-00906-5) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Medina-Chavez DA Sanchez-Ajofrin I Peris-Frau P Maside C Montoro V Fernandez-Santos R Garde JJ & Soler AJ. cAMP modulators before in vitro maturation decrease DNA damage and boost developmental potential of sheep oocytes. Animals (Basel) 2021112512. ( 10.3390/ani11092512) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ozturk S. Molecular determinants of the meiotic arrests in mammalian oocytes at different stages of maturation. Cell Cycle 202221547–571. ( 10.1080/15384101.2022.2026704) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Zhang H Wei Q Gao Z Ma C Yang Z Zhao H Liu C Liu J Zhao X & Ma B. G protein-coupled receptor 30 mediates meiosis resumption and gap junction communications downregulation in goat cumulus-oocyte complexes by 17beta-estradiol. Journal of Steroid Biochemistry and Molecular Biology 201918758–67. ( 10.1016/j.jsbmb.2018.11.001) [DOI] [PubMed] [Google Scholar]
- 12.Santiquet NW Greene AF Becker J Barfield JP Schoolcraft WB & Krisher RL. A pre-in vitro maturation medium containing cumulus oocyte complex ligand-receptor signaling molecules maintains meiotic arrest, supports the cumulus oocyte complex and improves oocyte developmental competence. Molecular Human Reproduction 201723594–606. ( 10.1093/molehr/gax032) [DOI] [PubMed] [Google Scholar]
- 13.Sela-Abramovich S Edry I Galiani D Nevo N & Dekel N. Disruption of gap junctional communication within the ovarian follicle induces oocyte maturation. Endocrinology 20061472280–2286. ( 10.1210/en.2005-1011) [DOI] [PubMed] [Google Scholar]
- 14.Racowsky C Baldwin KV Larabell CA DeMarais AA & Kazilek CJ. Down-regulation of membrana granulosa cell gap junctions is correlated with irreversible commitment to resume meiosis in golden Syrian hamster oocytes. European Journal of Cell Biology 198949244–251. [PubMed] [Google Scholar]
- 15.Fan HY & Sun QY. Involvement of mitogen-activated protein kinase cascade during oocyte maturation and fertilization in mammals. Biology of Reproduction 200470535–547. ( 10.1095/biolreprod.103.022830) [DOI] [PubMed] [Google Scholar]
- 16.Cai H, Liu B, Yang T, Yang Y, Xu J, Wei Z, Deng G, Ning G, Li J, Wen J, et al. Involvement of PKCepsilon in FSH-induced connexin43 phosphorylation and oocyte maturation in mouse. Biology Open 20187bio034678. ( 10.1242/bio.034678) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Donfack NJ, Alves KA, Alves BG, Rocha RMP, Bruno JB, Bertolini M, Dos Santos RR, Domingues SFS, De Figueiredo JR, Smitz J, et al. Stroma cell-derived factor 1 and connexins (37 and 43) are preserved after vitrification and in vitro culture of goat ovarian cortex. Theriogenology 201811683–88. ( 10.1016/j.theriogenology.2018.05.001) [DOI] [PubMed] [Google Scholar]
- 18.Granot I & Dekel N. Phosphorylation and expression of connexin-43 ovarian Gap junction protein are regulated by luteinizing hormone. Journal of Biological Chemistry 199426930502–30509. ( 10.1016/S0021-9258(1843842-2) [DOI] [PubMed] [Google Scholar]
- 19.Hubbard CJ. The effects of forskolin and LH on cAMP changes and maturation in the follicle-enclosed oocytes of hamsters. Acta Endocrinologica 1985110413–420. ( 10.1530/acta.0.1100413) [DOI] [PubMed] [Google Scholar]
- 20.Kanaporis G Mese G Valiuniene L White TW Brink PR & Valiunas V. Gap junction channels exhibit connexin-specific permeability to cyclic nucleotides. Journal of General Physiology 2008131293–305. ( 10.1085/jgp.200709934) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bagg MA Nottle MB Armstrong DT & Grupen CG. Effect of follicle size and dibutyryl cAMP on the cAMP content and gap junctional communication of porcine prepubertal cumulus-oocyte complexes during IVM. Reproduction, Fertility, and Development 200921796–804. ( 10.1071/RD08165) [DOI] [PubMed] [Google Scholar]
- 22.Luciano AM Franciosi F Modina SC & Lodde V. Gap junction-mediated communications regulate chromatin remodeling during bovine oocyte growth and differentiation through cAMP-dependent mechanism(s). Biology of Reproduction 2011851252–1259. ( 10.1095/biolreprod.111.092858) [DOI] [PubMed] [Google Scholar]
- 23.Thomas RE Armstrong DT & Gilchrist RB. Bovine cumulus cell-oocyte gap junctional communication during in vitro maturation in response to manipulation of cell-specific cyclic adenosine 3',5'-monophosophate levels. Biology of Reproduction 200470548–556. ( 10.1095/biolreprod.103.021204) [DOI] [PubMed] [Google Scholar]
- 24.Thomas RE Thompson JG Armstrong DT & Gilchrist RB. Effect of specific phosphodiesterase isoenzyme inhibitors during in vitro maturation of bovine oocytes on meiotic and developmental capacity. Biology of Reproduction 2004711142–1149. ( 10.1095/biolreprod.103.024828) [DOI] [PubMed] [Google Scholar]
- 25.Pant D, Reynolds LP, Luther JS, Borowicz PP, Stenbak TM, Bilski JJ, Weigl RM, Lopes F, Petry K, Johnson ML, et al. Expression of connexin 43 and gap junctional intercellular communication in the cumulus-oocyte complex in sheep. Reproduction 2005129191–200. ( 10.1530/rep.1.00434) [DOI] [PubMed] [Google Scholar]
- 26.Sasseville M Gagnon MC Guillemette C Sullivan R Gilchrist RB & Richard FJ. Regulation of gap junctions in porcine cumulus-oocyte complexes: contributions of granulosa cell contact, gonadotropins, and lipid rafts. Molecular Endocrinology 200923700–710. ( 10.1210/me.2008-0320) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Yogo K Ogawa T Akiyama M Ishida-Kitagawa N Sasada H Sato E & Takeya T. PKA implicated in the phosphorylation of Cx43 induced by stimulation with FSH in rat granulosa cells. Journal of Reproduction and Development 200652321–328. ( 10.1262/jrd.17107) [DOI] [PubMed] [Google Scholar]
- 28.Khaksarian M Mostafavi H Soleimani M Karimian SM Ghahremani MH Joghataee MT Khorashadizadeh M Aligholi H Attari F & Hassanzadeh G. Regulation of connexin 43 and microRNA expression via beta2-adrenoceptor signaling in 1321N1 astrocytoma cells. Molecular Medicine Reports 2015121941–1950. ( 10.3892/mmr.2015.3609) [DOI] [PubMed] [Google Scholar]
- 29.Pidoux G & Tasken K. Anchored PKA as a gatekeeper for gap junctions. Communicative and Integrative Biology 20158e1057361. ( 10.1080/19420889.2015.1057361) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Fang WL Lai SY Lai WA Lee MT Liao CF Ke FC & Hwang JJ. CRTC2 and Nedd4 ligase involvement in FSH and TGFbeta1 upregulation of connexin43 gap junction. Journal of Molecular Endocrinology 201555263–275. ( 10.1530/JME-15-0076) [DOI] [PubMed] [Google Scholar]
- 31.Namei E Sun W Pan D Zhao Y Yang B Weng Y Du C Li H Yu B & Subudeng G. The advanced paraffin-section preparation technique based on multiple cumulus-oocyte complexes rather than ovaries in ovine. Reproductive Biology 202121100473. ( 10.1016/j.repbio.2020.100473) [DOI] [PubMed] [Google Scholar]
- 32.Li SH Lin MH Hwu YM Lu CH Yeh LY Chen YJ & Lee RK. Correlation of cumulus gene expression of GJA1, PRSS35, PTX3, and SERPINE2 with oocyte maturation, fertilization, and embryo development. Reproductive Biology and Endocrinology: RB&E 20151393. ( 10.1186/s12958-015-0091-3) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Luciano AM Modina S Vassena R Milanesi E Lauria A & Gandolfi F. Role of intracellular cyclic adenosine 3',5'-monophosphate concentration and oocyte-cumulus cells communications on the acquisition of the developmental competence during in vitro maturation of bovine oocyte. Biology of Reproduction 200470465–472. ( 10.1095/biolreprod.103.020644) [DOI] [PubMed] [Google Scholar]
- 34.Sugimura S Ritter LJ Sutton-McDowall ML Mottershead DG Thompson JG & Gilchrist RB. Amphiregulin co-operates with bone morphogenetic protein 15 to increase bovine oocyte developmental competence: effects on gap junction-mediated metabolite supply. Molecular Human Reproduction 201420499–513. ( 10.1093/molehr/gau013) [DOI] [PubMed] [Google Scholar]
- 35.Burghardt RC Barhoumi R Sewall TC & Bowen JA. Cyclic AMP induces rapid increases in gap junction permeability and changes in the cellular distribution of connexin43. Journal of Membrane Biology 1995148243–253. ( 10.1007/BF00235042) [DOI] [PubMed] [Google Scholar]
- 36.Teilmann SC. Differential expression and localisation of connexin-37 and connexin-43 in follicles of different stages in the 4-week-old mouse ovary. Molecular and Cellular Endocrinology 200523427–35. ( 10.1016/j.mce.2004.10.014) [DOI] [PubMed] [Google Scholar]
- 37.Nuttinck F Peynot N Humblot P Massip A Dessy F & Flechon JE. Comparative immunohistochemical distribution of connexin 37 and connexin 43 throughout folliculogenesis in the bovine ovary. Molecular Reproduction and Development 20005760–66. ( 10.1002/1098-2795(200009)57:1<60::AID-MRD9>3.0.CO;2-6) [DOI] [PubMed] [Google Scholar]
- 38.Wang HX Tong D El-Gehani F Tekpetey FR & Kidder GM. Connexin expression and gap junctional coupling in human cumulus cells: contribution to embryo quality. Journal of Cellular and Molecular Medicine 200913972–984. ( 10.1111/j.1582-4934.2008.00373.x) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Grazul-Bilska AT Redmer DA Bilski JJ Jablonka-Shariff A Doraiswamy V & Reynolds LP. Gap junctional proteins, connexin 26, 32, and 43 in sheep ovaries throughout the estrous cycle. Endocrine 19988269–279. ( 10.1385/ENDO:8:3:269) [DOI] [PubMed] [Google Scholar]
- 40.Lee S Hiradate Y Hoshino Y Ko YG Tanemura K & Sato E. Localization and quantitative analysis of Cx43 in porcine oocytes during in vitro maturation. Zygote 201624364–370. ( 10.1017/S0967199415000271) [DOI] [PubMed] [Google Scholar]
- 41.Moor RM & Heslop JP. Cyclic AMP in mammalian follicle cells and oocytes during maturation. Journal of Experimental Zoology 1981216205–209. ( 10.1002/jez.1402160125) [DOI] [PubMed] [Google Scholar]
- 42.Salustri A Petrungaro S De Felici M Conti M & Siracusa G. Effect of follicle-stimulating hormone on cyclic adenosine monophosphate level and on meiotic maturation in mouse cumulus cell-enclosed oocytes cultured in vitro. Biology of Reproduction 198533797–802. ( 10.1095/biolreprod33.4.797) [DOI] [PubMed] [Google Scholar]
- 43.Solan JL & Lampe PD. Connexin43 phosphorylation: structural changes and biological effects. Biochemical Journal 2009419261–272. ( 10.1042/BJ20082319) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Chen H Zhao L Chu G Kito G Yamauchi N Shigeyoshi Y Hashimoto S & Hattori MA. FSH induces the development of circadian clockwork in rat granulosa cells via a Gap junction protein Cx43-dependent pathway. American Journal of Physiology. Endocrinology and Metabolism 2013304E566–E575. ( 10.1152/ajpendo.00432.2012) [DOI] [PubMed] [Google Scholar]
- 45.Zheng X, Chen J, Yang Y, Pei X, Ma W, Ma H, Hei C, Cai Y, Zhao C, Wang Y, et al. Exogenous luteinizing hormone promotes ovarian survival and function during cryopreservation and transplantation. Biochemical and Biophysical Research Communications 2020526424–430. ( 10.1016/j.bbrc.2020.03.014) [DOI] [PubMed] [Google Scholar]
- 46.Li J Mao G & Xia G. FSH modulates PKAI and GPR3 activities in mouse oocyte of COC in a gap junctional communication (GJC)-dependent manner to initiate meiotic resumption. PLoS One 20127e37835. ( 10.1371/journal.pone.0037835) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Gharibi Sh Hajian M Ostadhosseini S Hosseini SM Forouzanfar M & Nasr-Esfahani MH. Effect of phosphodiesterase type 3 inhibitor on nuclear maturation and in vitro development of ovine oocytes. Theriogenology 201380302–312. ( 10.1016/j.theriogenology.2013.04.012) [DOI] [PubMed] [Google Scholar]
- 48.Urner F Herrmann WL Baulieu EE & Schorderet-Slatkine S. Inhibition of denuded mouse oocyte meiotic maturation by forskolin, an activator of adenylate cyclase. Endocrinology 19831131170–1172. ( 10.1210/endo-113-3-1170) [DOI] [PubMed] [Google Scholar]
- 49.Albuz FK Sasseville M Lane M Armstrong DT Thompson JG & Gilchrist RB. Simulated physiological oocyte maturation (SPOM): a novel in vitro maturation system that substantially improves embryo yield and pregnancy outcomes. Human Reproduction 2010252999–3011. ( 10.1093/humrep/deq246) [DOI] [PubMed] [Google Scholar]
- 50.Dekel N Aberdam E & Sherizly I. Spontaneous maturation in vitro of cumulus-enclosed rat oocytes is inhibited by forskolin. Biology of Reproduction 198431244–250. ( 10.1095/biolreprod31.2.244) [DOI] [PubMed] [Google Scholar]
- 51.Racowsky C. Effect of forskolin on maintenance of meiotic arrest and stimulation of cumulus expansion, progesterone and cyclic AMP production by pig oocyte-cumulus complexes. Journal of Reproduction and Fertility 1985749–21. ( 10.1530/jrf.0.0740009) [DOI] [PubMed] [Google Scholar]
- 52.Buell M Chitwood JL & Ross PJ. cAMP modulation during sheep in vitro oocyte maturation delays progression of meiosis without affecting oocyte parthenogenetic developmental competence. Animal Reproduction Science 201515416–24. ( 10.1016/j.anireprosci.2014.12.012) [DOI] [PubMed] [Google Scholar]
- 53.Kilanowska A Ziolkowska A Stasiak P & Gibas-Dorna M. cAMP-dependent signaling and ovarian cancer. Cells 2022113835. ( 10.3390/cells11233835) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Liu C Ke P Zhang J Zhang X & Chen X. Protein kinase inhibitor peptide as a tool to specifically inhibit protein kinase A. Frontiers in Physiology 202011574030. ( 10.3389/fphys.2020.574030) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Li H Chuang AZ & O'Brien J. Regulation of photoreceptor gap junction phosphorylation by adenosine in zebrafish retina. Visual Neuroscience 201431237–243. ( 10.1017/S095252381300062X) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Hanstein R Trotter J Behl C & Clement AB. Increased connexin 43 expression as a potential mediator of the neuroprotective activity of the corticotropin-releasing hormone. Molecular Endocrinology 2009231479–1493. ( 10.1210/me.2009-0022) [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Li HJ Sutton-McDowall ML Wang X Sugimura S Thompson JG & Gilchrist RB. Extending prematuration with cAMP modulators enhances the cumulus contribution to oocyte antioxidant defence and oocyte quality via gap junctions. Human Reproduction 201631810–821. ( 10.1093/humrep/dew020) [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.

This work is licensed under a 


