Abstract
Because pigs are intermediate or amplifying hosts for several zoonotic viruses, the pig-derived PK-15 cell line is an indispensable tool for studying viral pathogenicity and developing treatments, vaccines, and preventive measures to mitigate the risk of disease outbreaks. However, we must consider the possibility of contamination by type I interferons (IFNs), such as IFNα and IFNβ, or IFN-inducing substances, such as virus-derived double-stranded RNA or bacterial lipopolysaccharides, in clinical samples, leading to lower rates of viral isolation. In this study, we aimed to generate a PK-15 cell line that can be used to isolate viruses from clinical samples carrying a risk of contamination by IFN-inducing substances. To this end, we depleted the IFN alpha and beta receptor subunit 1 (Ifnar1) gene or signal transducer and activator of transcription 2 (Stat2) gene in PK-15 cells using the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 method. Treatment of PK-15 cells lacking Ifnar1 or Stat2 with IFNβ or poly (I:C) resulted in no inhibitory effects on viral infection by a lentiviral vector, influenza virus, and Akabane virus. These results demonstrate that PK-15 cells lacking Ifnar1 or Stat2 could represent a valuable and promising tool for viral isolation, vaccine production, and virological investigations.
Introduction
Type I interferons (IFNs) such IFNα and IFNβ are significant components of innate immunity against viral infections [1, 2]. IFNs exert their biological effects by binding to IFN alpha and beta receptor subunit 1 (IFNAR1) on the cellular surface and subsequently activating Janus kinase 1 (JAK1) and tyrosine kinase 2 [3]. Signal transducer and activator of transcription (STAT) proteins, including STAT1 and STAT2, mediate cytokine responses [4–7]. The JAK–STAT signaling pathway induces the intracellular IFN signaling cascade, which eventually induces the expression of IFN-stimulated genes (ISGs) to generate an antiviral state [3, 8].
Despite the importance of the IFN cascade as the first line of defense against viral infections, its induction can impair the isolation of infectious viruses from clinical samples if there is contamination by IFN-inducing agents such as virus-derived double-stranded RNA (dsRNA) or bacterial lipopolysaccharides. These IFN-inducing agents are recognized by sensor proteins in host cells, such as melanoma differentiation-associated protein 5 [9], retinoic acid-inducible gene-I [10, 11], and Toll-like receptors [12–15], causing IFN production and the subsequent induction of an antiviral state. Vero cells have been widely used to isolate viruses from clinical samples [16]; this is mainly because these cells cannot produce IFNs [17, 18]. However, as Vero cells have been derived from an African green monkey (Cercopithecus aethiops), they may not be optimal for the isolation and replication of viruses from other species.
Pigs, which are essential animals globally, are intermediate or amplifying hosts of several zoonotic viruses, including the influenza virus, Japanese encephalitis virus, Nipah virus, and coronaviruses [19, 20]. Thus, the prevention of viral diseases in pigs is critical for sustainable agriculture. Several life-threatening viral diseases affect pigs, including African swine fever virus, classical swine fever virus [21], porcine circovirus type 2 [22], porcine transmissible gastroenteritis virus [23], porcine parvovirus [24], foot-and-mouth disease virus [25], and pseudorabies virus [26]. Therefore, the development of suitable pig-derived cell lines is critical to isolate these viruses from clinical samples. Isolated viruses can be used for testing their pathogenicity in pigs. Furthermore, isolated viruses may serve as a vaccine seed for preparing an inactivated vaccine or a live-attenuated vaccine. Accordingly, the porcine kidney-derived cell line PK-15 has been used for vaccine development. Unlike Vero cells, which lack IFN production [18, 27], PK-15 cells follow an intact pathway induced by IFNs. Therefore, if the clinical samples contain IFNs or IFN-inducing substances, such as virus-derived dsRNA or bacterial lipopolysaccharides, PK-15 cells produce IFNs upon stimulation, leading to the induction of ISGs and unsuccessful isolation and replication of viruses.
In this study, we sought to knock out Ifnar1 or Stat2 in PK-15 cells to overcome this limitation. We used the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) method to knock out Ifnar1 or Stat2 in PK-15 cells. We compared the replication of influenza A virus (IAV) and Akabane virus (AKAV) between normal and Ifnar1 or Stat2 knockout (k/o) PK-15 cells. PK-15 cells lacking Ifnar1 or Stat2 exhibited robust viral replication in the presence of pig IFNβ. Together, Ifnar1 k/o PK-15 cells could represent a valuable tool for viral isolation, thereby optimizing vaccine production, and virological investigation.
Materials and methods
Plasmids
The psPAX2-IN/HiBiT and pWPI-Luc2 plasmids were kind gifts from Dr. Kenzo Tokunaga [28]. pMD2.G was a gift from Dr. Didier Trono (Cat# 12259; http://n2t.net/addgene:12259; RRID: Addgene_12259), and pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Dr. Feng Zhang (Addgene, Watertown, MA, USA, plasmid #62988; http://n2t.net/addgene:62988; RRID: Addgene_62988). pGP plasmid and pDON-5 Neo-ZsGreen plasmid were described previously [29].
To generate a retroviral vector expressing pig IFNAR1, the coding sequence of pig IFNAR1 was synthesized according to the amino acid sequences deposited in GenBank (Acc. Num. NM_213772.1) with codon optimization to pig cells (Integrated DNA Technologies, Inc., Coralville, IA, USA). The synthesized DNA sequence is summarized in S1 Text. We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB], Ipswich, MA, USA, Cat# R3189L) and BamHI-HF (NEB, Cat# R3136L) using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E. coli (High Efficiency) (NEB, Cat# C2992H) and extracted using the PureYield Plasmid Miniprep System (Promega, Madison, WI, USA, Cat# A1222). The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation, we performed mutagenesis by overlapping PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa, Cat# R050A) together with the primers IFNAR-F (5′-CGTGGGCCCGCGGCCGCGCCACCATG-3′) and W70C-R (5′-GAGCTTGATgCAGTTATCCATTCCAGTGA-3′) to amplify the 5′ fragment and the primers W70C-F (5′-ATGGATAACTGcATCAAGCTCCCTGGATG-3′) and IFNAR1-R (5′-TAACGTCGACGGATCCCTACACTGC-3′) to amplify the 3′ fragment. These fragments were mixed and amplified with the primers IFNAR1-F and IFNAR1-R. The resultant IFNAR1 fragment encoding the W70C mutation was cloned into the pDON-5 Neo-vector as previously described.
Cell culture
Human kidney-derived Lenti-X 293T cells (TaKaRa, Cat# Z2180N) and porcine kidney-derived PK-15 cells (Japanese Collection of Research Bioresources Cell Bank, Cat# JCRB9040) were maintained in Dulbecco’s modified Eagle medium (DMEM; Nacalai Tesque, Kyoto, Japan, Cat# 08458–16) supplemented with 10% fetal bovine serum (FBS) and 1× penicillin–streptomycin (Pe/St; Nacalai Tesque, Cat# 09367–34).
Viruses
IAV (H1N1) strain A/PR/8/34 (American Type Culture Collection, Manassas, VA, USA, Cat# VR-95) was used in this study. IAV was propagated in specific pathogen-free chicken embryonated eggs. AKAV (TS-C2 vaccine strain) was purchased from Kyoto Biken Laboratories (Kyoto, Japan). AKAV was propagated in HmLu-1 cells maintained in DMEM supplemented with 2% FBS and 1% Pe/St. All experiments were performed in a biosafety level 2 facility.
Rescue of HIV-1–based reporter virus
To rescue an HIV-1–based lentiviral vector expressing the luciferase 2 reporter gene, Lenti-X 293T cells were co-transfected with the psPAX2-IN/HiBiT, pWPI-Luc2, and pMD2.G plasmids using TransIT-293 Transfection Reagent (TaKaRa, Cat# V2700) in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific, Waltham, MA, USA, Cat# 31985062). The supernatant was filtered 2 days after transfection.
Design of single guide RNAs (sgRNAs)
Specific sgRNAs targeting pig Ifnar1 and Stat2 were designed using the online CRISPR Design Tool (https://crispr.dbcls.jp). The sequence of sgRNAs used in this study is summarized in Table 1. Two partially complementary oligos were used to generate the sgRNA scaffold. The complementary oligos were mixed and heated at 95°C for 5 min, followed by incubation at room temperature for 1 h for oligo annealing. The annealed oligos were diluted 250-fold with water and used for ligation with the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene, Cat# 62988), which was predigested with BbsI-HF (NEB, Cat# R3539L) using a DNA Ligation Kit (Mighty Mix, TaKaRa, Cat# 6023). The ligated constructs were then transformed in NEB 5-alpha F′ Iq Competent E. coli (High Efficiency). The plasmids were analyzed using a primer (5′-ACTATCATATGCTTACCGTAAC-3′) to verify the sequence.
Table 1. The oligonucleotides used to generate the sgRNA scaffolds.
Oligo name | Sense (5′–3′) | Antisense (5′–3′) |
---|---|---|
Ifnar1-1 | caccgCAGATCTCCTGAAAATGTCG | aaacCGACATTTTCAGGAGATCTGc |
Ifnar1-2 | caccgCAGGAAACAGCACTTCTCCG | aaacCGGAGAAGTGCTGTTTCCTGc |
Ifnar1-3 | caccgCAGCACTTCTCCGTGGTATG | aaacCATACCACGGAGAAGTGCTGc |
Ifnar1-4 | caccgGCTTCACTGCGTGTCGGTAT | aaacATACCGACACGCAGTGAAGCc |
Stat2-1 | caccgTCAGAGGCCAAATGGCGCAG | aaacCTGCGCCATTTGGCCTCTGAc |
Stat2-2 | caccgACAACTTGCGAAAATTCTAT | aaacATAGAATTTTCGCAAGTTGTc |
Generation of PK-15 cells lacking Ifnar1 or Stat2
To generate k/o cells, PK-15 cells were transfected with PX459-Ifnar1-k/o or PX459-Stat2-k/o plasmids using the TransIT-X2 Dynamic Delivery System (TaKaRa, Cat# V6100) according to the manufacturer’s instructions. At 48 h after transfection, cells were treated with 5 μg/mL puromycin (InvivoGen, San Diego, CA, USA, Cat# ant-pr-1). After 1 week of incubation, single-cell clones were sorted in a 96-well plate using a Cell Sorter SH800S (Sony Biotechnology, Inc., San Diego, CA, USA). The single-cell clones were characterized by infection with an HIV-based lentiviral vector.
Infection of PK-15 cells lacking Ifnar1 or Stat2 with lentiviral vectors for screening
Normal PK-15 cells, PK-15 Ifnar1 k/o cells, or PK-15 Stat2 k/o cells were plated (1 × 104 cells/well) in a 96-well plate and treated with 0, 10, or 100 ng/mL pig IFNβ (Kingfisher Biotech, St. Paul, MN, USA, Cat# RP0011S-025). After overnight incubation, cells were infected with an HIV-1–based reporter virus expressing luciferase 2. Two days after infection, cells were lysed using the Britelite plus reporter gene assay system (PerkinElmer, Waltham, MA, USA, Cat# 6066769), and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
Measurement of ISG expression
Normal PK-15 cells, PK-15 Ifnar1 k/o cells, or PK-15 Stat2 k/o cells were plated in a 96-well plate in sextuplicate as previously described and treated with 0 or 100 ng/mL IFNβ. After overnight incubation, total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732) according to the manufacturer’s instructions. Porcine myxovirus resistance 1 (Mx1), interferon-stimulated gene 15 (ISG15), and viperin messenger RNA (mRNA) levels were measured by a qRT–PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min, 95°C for 10 s, and 40 cycles of 95°C for 5 s and 60°C for 34 s. Porcine Mx1, ISG15, and viperin mRNA levels were normalized to those of porcine β-actin, which was used as an endogenous control (ΔΔCt method). The specific sequence primers for ISG mRNA levels were described previously [8]. The primer sets are listed in Table 2.
Table 2. The oligonucleotides used to quantify ISG mRNA levels.
Primer | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
Mx1 | TACGACATCGAATACCAGATCAA | ATGGTCCTGTCTCCTTCGG |
ISG15 | GACTGCATGATGGCATCGGA | TGCACCATCAACAGGACCAT |
Viperin | GGACACTGGTACCTGTCACCTT | TGAAGTGGTAATTGACGCTAGT |
β-actin | TGGATAAGCCTGCAGTCACAG | GCGTAGAGGTCCTTCCTGATGT |
Western blotting
To evaluate ISG15 expression, the pelleted cells were lysed in 2× Bolt LDS sample buffer (Thermo Fisher Scientific, Cat# B0008) containing 2% β-mercaptoethanol (Bio-Rad, Hercules, CA, USA, Cat# 1610710) and incubated at 70°C for 10 min. ISG15 expression was evaluated using SimpleWestern Abby (ProteinSimple, San Jose, CA, USA) with anti-ISG15 rabbit polyclonal antibody (Cell Signaling Biotechnology, Danvers, MA, USA, Cat# 2743S, ×250) and an Anti-Rabbit Detection Module (ProteinSimple, Cat# DM-001). The amount of input protein was visualized using a Total Protein Detection Module (ProteinSimple, Cat# DM-TP01).
Virus replication assay
Normal PK-15, PK-15 Ifnar1 k/o, or PK-15 Stat2 k/o cells were seeded into a 96-well plate at a density of 1 × 104 cells/well and treated with 0 or 100 ng/mL pig IFNβ. After overnight culture, the cells were infected with IAV or AKAV. After incubation at 37°C for 2 h, the cells were washed, and fresh DMEM supplemented with 2% FBS and 1× Pe/St was added to each well with or without 100 ng/mL pig IFNβ. For experiments using IAV, the cells were maintained in DMEM supplemented with 10% FBS, 1× Pe/St, and 1 μg/mL tosylsulfonyl phenylalanyl chloromethyl ketone-treated trypsin (Sigma-Aldrich, St. Louis, MO, USA, Cat# 4352157) [30, 31]. The supernatant was harvested 2 days after infection and mixed with 2× RNA lysis buffer (2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl [pH 7.4], 40% glycerol, and 0.4 U/μL Recombinant RNase Inhibitor [TaKaRa, Cat# 2313A]), as described previously [32]. The replication levels of IAV and AKAV were determined via qRT–PCR using the corresponding primer pairs (Table 3), as described previously [33]. The analysis was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) via One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time). The relative levels of viral RNA were calculated using the ΔΔCt method.
Table 3. The oligonucleotides used for the virus replication assay.
Primer | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
IAV | GGCCCAACCCAAACACAAAC | AGCCCTCCTTCTCCGTCAGC |
AKAV | TGCGTTTCAGAGCCTACAAG | GCTACCTCAGGCAACAGATTAG |
In addition, normal PK-15, PK-15 Ifnar1 k/o, or PK-15 Stat2 k/o cells were seeded as described previously and then transfected with 0 or 100 ng/mL poly (I:C) (Sigma-Aldrich, St. Louis, MO, USA, Cat# P1530) using the TransIT-X2 Dynamic Delivery System, according to the manufacturer’s instructions. After overnight culture, the cells were infected with IAV or AKAV as described previously.
Reconstitution of IFNAR1 molecules in PK-15 cells lacking Ifnar1 or Stat2
To rescue retroviral vectors expressing pig wild-type (WT) IFNAR1, pig IFNAR1 carrying the W70C mutation, or ZsGreen protein, 3 × 106 Lenti-X 293T cells were cotransfected with the pGP vector, pDON-5 Neo-IFNAR1 (WT), pDON-5 Neo-IFNAR1 (W70C), or pDON-5 Neo-ZsGreen, and pMD2.G plasmids using TransIT-293 Transfection Reagent in Opti-MEM I Reduced Serum Medium. The supernatant was filtered 2 days after transfection. To avoid contamination by residual plasmid DNA, viral stocks were treated with 4 U/mL TURBO DNase (Thermo Fisher Scientific, Cat# AM2238) at 37°C for 60 min.
To reconstitute IFNAR1, PK-15 cells lacking Ifnar1, or Stat2 were infected with retroviral vectors expressing pig IFNAR1 (WT), pig IFNAR1 (W70C), or ZsGreen protein. After 48 h of incubation, the cells were treated with 1 mg/mL G418 disulfate aqueous solution (Nacalai Tesque, Cat# 09380–86) to deplete non-transduced cells. Cells were maintained until cells transduced with ZsGreen-expressing virus became >90% ZsGreen-positive. PK-15 Ifnar1 k/o or PK-15 Stat2 k/o cells infected with retroviral vectors expressing IFNAR1 (WT), IFNAR1 (W70C), or ZsGreen protein were plated at 1 × 104 cells/well. After 24 h, total RNA was extracted using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) to measure the Ifnar1 expression. We used a forward primer (5′-GCTGAGGACAAGGCGATTAT-3′) and a reverse primer (5′-GGAGTACACGAATGAGGATGAG-3′) based on the codon-optimized sequence of pig Ifnar1 (S1 Text). Expression was measured as previously described. To assess antiviral activity in reconstituted cells, cells were treated with 0 or 100 ng/mL IFNβ for 24 h, and the viral infection experiment was performed as previously described. The mRNA expression of IGSs in reconstituted cells was determined as previously described.
Statistical analysis
Differences between treated and untreated cells were evaluated by an unpaired, two-tailed Student’s t-test. Multiple comparisons were evaluated by one-way analysis of variance (ANOVA) followed by Tukey’s test. p ≤ 0.05 indicated statistical significance. The test was performed using GraphPad Prism 9 software v9.1.1 (GraphPad, San Diego, CA, USA).
Results
Generation and screening of PK-15 cells lacking Ifnar1 or Stat2
To generate PK-15 cells lacking Ifnar1, we designed sgRNAs targeting pig Ifnar1 using pig genome information from GenBank (NM_213772.1). Furthermore, as STAT2 is a key molecule involved in IFN-mediated antiviral responses, we designed sgRNAs targeting pig Stat2 (NM_213889.1) [34–36]. PK-15 cells were transfected with PX459 plasmids harboring these sgRNAs, and single-cell colonies were isolated using the limiting dilution method. Then, cells were treated with pig IFNβ. Following infection with an HIV-1–based reporter virus, single clones of PK-15 Ifnar1 k/o or PK-15 Stat2 k/o cells were assessed. Normal PK-15 cells efficiently prevented infection by the HIV-1–based reporter virus (Fig 1). Conversely, PK-15 Ifnar1 and PK-15 Stat2 k/o cells did not resist this viral infection (Fig 1), suggesting that cells lacking Ifnar1 or Stat2 cannot respond to IFNβ treatment.
Fig 1. Generation and screening of PK-15 cells lacking Ifnar1 or Stat2.
Normal PK-15 cells, PK-15 Ifnar1 k/o cells, or PK-15 Stat2 k/o cells treated with various concentrations of pig IFNβ were infected with HIV-1–based reporter virus. Infectivity was calculated as relative light units (RLU) 2 days after infection. Relative infectivity was calculated in comparison that in untreated cells. The results are presented as the mean and standard deviation of quadruplicate measurements from one assay, and they are representative of at least three independent experiments. Differences were examined by one-way ANOVA followed by Tukey’s test. ****p < 0.0001.
PK-15 cells lacking Ifnar1 or Stat2 lost the ability to induce ISGs upon IFNβ treatment
We determined that the activation of the type I IFN signaling pathway triggers a complex cascade of events that culminate in the expression of a broad array of ISGs, contributing to an antiviral state in infected cells. To characterize PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells, we evaluated the mRNA expression of three ISGs (Mx1, ISG15, and viperin gene) upon IFNβ treatment. Treatment of normal PK-15 cells with 100 ng/mL pig IFNβ robustly induced ISG expression (over 100-fold) compared to that in untreated cells (Fig 2A and 2B). Conversely, both PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells displayed no or marginal induction of these ISGs upon IFNβ treatment (Fig 2A and 2B). Furthermore, we tested the induction of ISG15 protein upon IFNβ treatment by western blotting. In normal PK-15 cells, we observed a significant induction of ISG15 upon IFNβ treatment (Fig 2C), whereas ISG15 expression was not induced by IFNβ treatment in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells (Fig 2C). These results demonstrated that PK-15 cells lacking Ifnar1 or Stat2 were unresponsive to IFNβ treatment.
Fig 2. PK-15 cells lacking Ifnar1 or Stat2 exhibited a loss of ISG induction upon IFNβ treatment.
(a) Induction of ISG mRNAs in normal PK-15 cells, PK-15 Ifnar1 k/o cells, and PK-15 Stat2 k/o cells was measured by qRT–PCR 1 day after IFNβ treatment. The results are presented as the mean and standard deviation of sextuplicate measurements from one assay, and they are representative of at least three independent experiments. Differences between 100 ng/mL IFNβ-treated cells and untreated cells were examined by a two-tailed, unpaired Student’s t-test. ****p < 0.0001, ns (not significant). (b) The data presented in Fig 2A were used to compare ISG induction among normal PK-15 cells, PK-15 Ifnar1 k/o cells, and PK-15 Stat2 k/o cells. Multiple comparisons were examined by one-way ANOVA followed by Tukey’s test. ****p < 0.0001. (c) Expression of ISG15 protein (15 kDa) in normal PK-15, PK-15 Ifnar1 k/o, and PK-15 Stat2 k/o cells was determined via western blotting, as depicted in the lower panel. The quantity of input protein was visualized using the Total Protein Detection Module, as depicted in the upper panel.
PK-15 cells lacking Ifnar1 or Stat2 are susceptible to viral infection in the presence of IFNβ or poly (I:C)
Next, we examined whether Ifnar1 k/o or Stat2 k/o augments the susceptibility of PK-15 cells to viral infection in the presence of IFNβ. We used PK-15 Ifnar1 k/o (Clone #4–11) and PK-15 Stat2 k/o cells (Clone #1–2) for further analyses. IAV replication was significantly inhibited in normal PK-15 cells treated with IFNβ (Fig 3A). By contrast, IAV replication was not inhibited in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells upon IFNβ treatment (Fig 3A). Previous research demonstrated the inter-species transmission of AKAV from cows to pigs [37]. Therefore, the prevalence, and pathogenicity of AKAV in the pig population should be investigated. To test the usefulness of PK-15 Ifnar1 k/o cells for this purpose, we tested the replication of AKAV in PK-15 cells treated with pig IFNβ (Fig 3B). Whereas AKAV replication was blocked in normal PK-15 cells treated with IFNβ, there was no inhibition of AKAV replication in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells treated with IFNβ (Fig 3B). These results demonstrated that both PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells supported viral replication in the presence of IFNβ.
Fig 3. PK-15 cells lacking Ifnar1 or Stat2 are susceptible to viral infection in the presence of IFNβ.
Replication of IAV (a) and AKAV (b) was examined in normal PK-15 cells, PK-15 Ifnar1 k/o cells, and PK-15 Stat2 k/o cells. Cells were pretreated with 0 or 100 ng/mL IFNβ before infection. Viral RNA levels in the culture supernatant were quantified by qRT–PCR 2 days after infection. The relative values were calculated in comparison to that in non-pretreated cells. The results are presented as the mean and standard deviation of sextuplicate measurements from one assay. Differences between 100 ng/mL IFNβ-treated cells and untreated cells were examined by a two-tailed, unpaired Student’s t-test. ***p < 0.001, **p < 0.05, ns (not significant).
Furthermore, we employed a synthetic double-stranded RNA analog poly (I:C) to investigate whether Ifnar1 k/o and Stat2 k/o enhance the susceptibility of PK-15 cells to viral replication in the presence of interferon-inducible substances. In normal PK-15 cells treated with poly (I:C), IAV replication was significantly inhibited (Fig 4A). However, after poly (I:C) treatment, IAV replication was not inhibited or potentially enhanced in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells (Fig 4A). Furthermore, although AKAV replication was suppressed in normal PK-15 cells treated with poly (I:C), no inhibition of AKAV replication was observed in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells upon poly (I:C) treatment (Fig 4B). These results demonstrate that both PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells support viral replication in the presence of poly (I:C).
Fig 4. PK-15 cells lacking Ifnar1 or Stat2 exhibit susceptibility to viral infection in the presence of poly (I:C).
The replication of IAV (a) and AKAV (b) was examined in normal PK-15, PK-15 Ifnar1 k/o, and PK-15 Stat2 k/o cells. Before infection, the cells were transfected with 0 or 100 ng/mL poly (I:C). Viral RNA levels in the culture supernatant were quantified via qRT–PCR 2 days after viral infection. The relative values were calculated with respect to non-pretreated cells. The results are presented as the mean and standard deviation of eight repeated measurements from one assay. Differences between 100 ng/mL poly (I:C)-treated cells and untreated cells were examined via a two-tailed, unpaired Student’s t-test. ****p < 0.0001, **p < 0.01, and *p < 0.05, ns (not significant).
Reconstitution of Ifnar1 in PK-15 Ifnar1 k/o cells restored the response to IFNβ
Off-target effects are an important concern associated with the CRISPR/Cas9 method [38]. To elucidate the specificity of Ifnar1 k/o, we reconstituted IFNAR1 by infecting PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells with retroviral vectors expressing pig IFNAR1. In this experiment, we used both WT IFNAR1 and mutant IFNAR1 carrying the W70C mutation (W73C in human IFNAR1)—IFNAR1 (W70C)—which was previously reported to be associated with the impaired activity of human IFNAR1 [39]. Although we attempted to detect reconstituted IFNAR1 via western blotting, we could not detect pig IFNAR1 using three commercial anti-human IFNAR1 antibodies. Therefore, we used qRT–PCR for detection. Ifnar1 k/o cells reconstituted with IFNAR1 (WT) or IFNAR1 (W70C) displayed significantly lower Ct values than control cells (Fig 5A), suggesting that IFNAR1 molecules were successfully reconstituted in these cells. We performed an infection assay in reconstituted cells using AKAV. The results demonstrated that PK-15 Ifnar1 k/o cells reconstituted with IFNAR1 (WT) showed resistance to viral infection, similar to that in normal PK-15 cells (Fig 5B). Conversely, PK-15 Ifnar1 k/o cells reconstituted with IFNAR1 (W70C) showed no resistance to viral infection, suggesting that the restoration of antiviral activity requires reconstitution with WT IFNAR1. As expected, neither IFNAR1 (WT) nor IFNAR1 (W70C) in PK-15 Stat2 k/o cells showed restoration of the resistance to viral infection (Fig 5B). Consistent with the results of infection activity, ISG expression was induced by IFNβ treatment in PK-15 Ifnar1 k/o cells reconstituted with IFNAR1 (WT) but not in other cells (Fig 5B). These results suggest that PK-15 Ifnar1 k/o cells generated in this study exhibit a specific deletion of Ifnar1.
Fig 5. Reconstitution of IFNAR1 in PK-15 Ifnar1 k/o cells restored the response to IFNβ.
(a) PK-15 Ifnar1 k/o cells were infected with retroviral vectors expressing IFNAR1 (WT), IFNAR1 (W70C), or ZsGreen protein. After selection with G418, Ifnar1 expression was measured by qRT–PCR 1 day after infection. The results are presented as the mean and standard deviation of octuplicate measurements from one assay, and they are representative of at least three independent experiments. Multiple comparisons were examined by one-way ANOVA followed by Tukey’s test. ****p < 0.0001. (b) PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells infected with retroviral vectors expressing IFNAR1 (WT), IFNAR1 (W70C), or ZsGreen protein were treated with 0 or 100 ng/mL IFNβ for 24 h. Cells were superinfected with AKAV. Viral RNA levels in the culture supernatant were quantified by qRT–PCR 2 days after infection. The relative values were calculated in comparison to that in non-pretreated cells. The results are presented as the mean and standard deviation of septuplicate measurements from one assay, and they are representative of at least three independent experiments. Differences between 0 and 100 ng/mL IFNβ-treated cells were examined by a two-tailed, unpaired Student’s t-test. ****p < 0.0001, ***p < 0.001, *p < 0.05, ns (not significant). (c) Induction of ISG mRNAs in PK-15 Ifnar1 k/o cells infected with retroviral vectors expressing IFNAR1 (WT), IFNAR1 (W70C), or ZsGreen protein was measured by qRT–PCR 1 day after IFNβ treatment. The results are presented as the mean and standard deviation of sextuplicate measurements from one assay, and they are representative of at least three independent experiments. Multiple comparisons were examined by one-way ANOVA followed by Tukey’s test. ***p < 0.001, **p < 0.01, ns (not significant).
Discussion
In this study, we demonstrated that PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells represent a promising tool for viral isolation from clinical samples, vaccine development, and virological investigation. Our results illustrated that PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells were susceptible to HIV-1–based reporter virus infection upon IFNβ treatment. We observed marginal ISG expression upon IFNβ treatment in PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells compared to that in normal PK-15 cells. This result was confirmed by viral replication assays using IAV and AKAV.
IFNs play major role in innate immunity. IFNs are essential molecules for inducing an antiviral state, thereby protecting virus-exposed cells, and neighboring cells. IFNs bind to IFNAR1 on the cell surface, initiating a downstream cascade of immune responses. The stimulation of this cascade leads to the induction of ISGs such as Mx1, ISG15, and viperin gene [40]. These ISGs block several stages of viral replication, including viral entry, viral genome replication, and progeny virion release [41–43]. Mx protein has shown antiviral effects against the influenza virus [2, 44, 45] and bunyavirus [43, 46]. In this study, robust induction of ISGs and inhibition of viral replication were observed in normal PK-15 cells treated with IFNβ; however, these effects were reversed by Ifnar1 or Stat2 k/o. Notably, our infection assay demonstrated that PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells supported the replication of both IAV and AKAV in the presence of poly (I:C), suggesting that the effect of Ifnar1 k/o is shared by Stat2 k/o. This finding highlights the feasibility of these cells for the isolation of viruses from clinical samples contaminated with interferon-inducible substances.
We examined the potential risk of off-target effects of gene editing in PK-15 Ifnar1 k/o cells. The reconstitution of PK-15 Ifnar1 k/o cells with WT IFNAR1, but not with IFNAR1 carrying the W70C mutation, restored the cells’ resistance to viral infection and ISG induction. Our results are consistent with a previous report demonstrating that W70C mutation in IFNAR1 (W73C in humans) resulted in increased severity of COVID-19 infection because of the loss of IFN-mediated immune responses [39].
In conclusion, our study demonstrated that PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells can be used for viral isolation from samples with possible contamination by IFNs or IFN-inducing substances. We believe that PK-15 Ifnar1 k/o and PK-15 Stat2 k/o cells will contribute to the isolation of several zoonotic diseases such as influenza virus, Japanese encephalitis virus, and Nipah virus. Furthermore, considering the importance of maintaining the health of pigs for sustainable agriculture, the method developed in this study can be beneficial for isolating viruses from clinical samples to understand the pathogenicity of life-threatening viral diseases in pigs, including African swine fever, and foot-and-mouth disease. Furthermore, isolated viruses can serve as a vaccine seed for preparing an inactivated or live-attenuated vaccine.
Supporting information
(XLSX)
(PDF)
The coding sequence of pig IFNAR1 was synthesized according to the amino acid sequence deposited in GenBank (Acc. Num. NM_213772.1) with codon optimization to pig cells. The start and stop codons are underlined.
(TXT)
Acknowledgments
pMD2.G was a gift from Dr. Didier Trono. pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Dr. Feng Zhang. psPAX2-IN/HiBiT and pWPI-Luc2 were kind gifts from Dr. Kenzo Tokunaga. We thank Dr. Hirohisa Mekata, Ms. Tomoko Nishiuchi, and Ms. Yuki Shibatani for their support. We additionally thank Enago (www.enago.com) for the English language review.
Data Availability
All relevant data are within the manuscript and its Supporting Information files.
Funding Statement
This work was supported by grants from the Japan Agency for Medical Research and Development (AMED) Research Program on HIV/AIDS JP23fk0410047, JP23fk0410056, JP23fk0410058 (to A.S.); AMED Japan Program for Infectious Diseases Research and Infrastructure JP22wm0325009 (to A.S.); AMED CRDF Global Grant JP22jk0210039 (to A.S.); from JSPS KAKENHI Grant-in-Aid for Scientific Research (B) 22H02500 (to A.S.) and from The Ito Foundation Research Grant R5 Ken77 (to A.S.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Samuel CE. Antiviral Actions of Interferons. Clinical Microbiology Reviews. 2001;14: 778–809. doi: 10.1128/CMR.14.4.778-809.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Katze MG, He Y, Gale M. Viruses and interferon: a fight for supremacy. Nat Rev Immunol. 2002;2: 675–687. doi: 10.1038/nri888 [DOI] [PubMed] [Google Scholar]
- 3.Sadler AJ, Williams BRG. Interferon-inducible antiviral effectors. Nat Rev Immunol. 2008;8: 559–568. doi: 10.1038/nri2314 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ho J, Pelzel C, Begitt A, Mee M, Elsheikha HM, Scott DJ, et al. STAT2 Is a Pervasive Cytokine Regulator due to Its Inhibition of STAT1 in Multiple Signaling Pathways. PLOS Biology. 2016;14: e2000117. doi: 10.1371/journal.pbio.2000117 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Harrison AR, Moseley GW. The Dynamic Interface of Viruses with STATs. Journal of Virology. 2020;94: 10.1128/jvi.00856-20. doi: 10.1128/JVI.00856-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Marchetti M, Monier M-N, Fradagrada A, Mitchell K, Baychelier F, Eid P, et al. Stat-mediated Signaling Induced by Type I and Type II Interferons (IFNs) Is Differentially Controlled through Lipid Microdomain Association and Clathrin-dependent Endocytosis of IFN Receptors. MBoC. 2006;17: 2896–2909. doi: 10.1091/mbc.e06-01-0076 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hu X, Li J, Fu M, Zhao X, Wang W. The JAK/STAT signaling pathway: from bench to clinic. Sig Transduct Target Ther. 2021;6: 1–33. doi: 10.1038/s41392-021-00791-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fan W, Jiao P, Zhang H, Chen T, Zhou X, Qi Y, et al. Inhibition of African Swine Fever Virus Replication by Porcine Type I and Type II Interferons. Frontiers in Microbiology. 2020;11. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2020.01203 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Duewell P, Beller E, Kirchleitner SV, Adunka T, Bourhis H, Siveke J, et al. Targeted activation of melanoma differentiation-associated protein 5 (MDA5) for immunotherapy of pancreatic carcinoma. Oncoimmunology. 2015;4: e1029698. doi: 10.1080/2162402X.2015.1029698 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Onomoto K, Onoguchi K, Yoneyama M. Regulation of RIG-I-like receptor-mediated signaling: interaction between host and viral factors. Cell Mol Immunol. 2021;18: 539–555. doi: 10.1038/s41423-020-00602-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Im JH, Duic I, Yoshimura SH, Onomoto K, Yoneyama M, Kato H, et al. Mechanisms of length-dependent recognition of viral double-stranded RNA by RIG-I. Sci Rep. 2023;13: 6318. doi: 10.1038/s41598-023-33208-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Mokhtari Y, Pourbagheri-Sigaroodi A, Zafari P, Bagheri N, Ghaffari SH, Bashash D. Toll-like receptors (TLRs): An old family of immune receptors with a new face in cancer pathogenesis. Journal of Cellular and Molecular Medicine. 2021;25: 639–651. doi: 10.1111/jcmm.16214 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Verma R, Bharti K. Toll like receptor 3 and viral infections of nervous system. J Neurol Sci. 2017;372: 40–48. doi: 10.1016/j.jns.2016.11.034 [DOI] [PubMed] [Google Scholar]
- 14.Han X, Li X, Yue SC, Anandaiah A, Hashem F, Reinach PS, et al. Epigenetic Regulation of Tumor Necrosis Factor α (TNFα) Release in Human Macrophages by HIV-1 Single-stranded RNA (ssRNA) Is Dependent on TLR8 Signaling. J Biol Chem. 2012;287: 13778–13786. doi: 10.1074/jbc.M112.342683 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zheng W, Xu Q, Zhang Y, E X, Gao W, Zhang M, et al. Toll-like receptor-mediated innate immunity against herpesviridae infection: a current perspective on viral infection signaling pathways. Virology Journal. 2020;17: 192. doi: 10.1186/s12985-020-01463-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chen C, Fan W, Li J, Zheng W, Zhang S, Yang L, et al. A Promising IFN-Deficient System to Manufacture IFN-Sensitive Influenza Vaccine Virus. Frontiers in Cellular and Infection Microbiology. 2018;8. Available: https://www.frontiersin.org/articles/10.3389/fcimb.2018.00127 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Desmyter J, Melnick JL, Rawls WE. Defectiveness of interferon production and of rubella virus interference in a line of African green monkey kidney cells (Vero). J Virol. 1968;2: 955–961. doi: 10.1128/JVI.2.10.955-961.1968 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Emeny JM, Morgan MJ. Regulation of the interferon system: evidence that Vero cells have a genetic defect in interferon production. J Gen Virol. 1979;43: 247–252. doi: 10.1099/0022-1317-43-1-247 [DOI] [PubMed] [Google Scholar]
- 19.McLean RK, Graham SP. The pig as an amplifying host for new and emerging zoonotic viruses. One Health. 2022;14: 100384. doi: 10.1016/j.onehlt.2022.100384 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Meng XJ, Lindsay DS, Sriranganathan N. Wild boars as sources for infectious diseases in livestock and humans. Philos Trans R Soc Lond B Biol Sci. 2009;364: 2697–2707. doi: 10.1098/rstb.2009.0086 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Luo Y, Li S, Sun Y, Qiu H-J. Classical swine fever in China: A minireview. Veterinary Microbiology. 2014;172: 1–6. doi: 10.1016/j.vetmic.2014.04.004 [DOI] [PubMed] [Google Scholar]
- 22.Guo J, Hou L, Zhou J, Wang D, Cui Y, Feng X, et al. Porcine Circovirus Type 2 Vaccines: Commercial Application and Research Advances. Viruses. 2022;14: 2005. doi: 10.3390/v14092005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Yuan X, Lin H, Fan H. Efficacy and immunogenicity of recombinant swinepox virus expressing the A epitope of the TGEV S protein. Vaccine. 2015;33: 3900–3906. doi: 10.1016/j.vaccine.2015.06.057 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mészáros I, Olasz F, Cságola A, Tijssen P, Zádori Z. Biology of Porcine Parvovirus (Ungulate parvovirus 1). Viruses. 2017;9: 393. doi: 10.3390/v9120393 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yuan H, Li N, Li P, Bai X, Sun P, Bao H, et al. Modification of the second translation initiation site restricts the replication of foot-and-mouth disease virus in PK-15 cells. Appl Microbiol Biotechnol. 2020;104: 8455–8466. doi: 10.1007/s00253-020-10810-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Li L, Du Y, Zhang Y, Li P, Liu X, Zhang X, et al. Comprehensive evaluation of the safety and immunogenicity of a gene-deleted variant pseudorabies virus attenuated vaccine. Veterinary Research. 2022;53: 73. doi: 10.1186/s13567-022-01091-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Young DF, Andrejeva L, Livingstone A, Goodbourn S, Lamb RA, Collins PL, et al. Virus Replication in Engineered Human Cells That Do Not Respond to Interferons. J Virol. 2003;77: 2174–2181. doi: 10.1128/jvi.77.3.2174-2181.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ozono S, Zhang Y, Tobiume M, Kishigami S, Tokunaga K. Super-rapid quantitation of the production of HIV-1 harboring a luminescent peptide tag. J Biol Chem. 2020;295: 13023–13030. doi: 10.1074/jbc.RA120.013887 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Morizako N, Butlertanaka EP, Tanaka YL, Shibata H, Okabayashi T, Mekata H, et al. Generation of a bovine cell line for gene engineering using an HIV-1-based lentiviral vector. Sci Rep. 2022;12: 16952. doi: 10.1038/s41598-022-20970-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Peitsch C, Klenk H-D, Garten W, Böttcher-Friebertshäuser E. Activation of Influenza A Viruses by Host Proteases from Swine Airway Epithelium. J Virol. 2014;88: 282–291. doi: 10.1128/JVI.01635-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Eisfeld AJ, Neumann G, Kawaoka Y. Influenza A Virus Isolation, Culture and Identification. Nat Protoc. 2014;9: 2663–2681. doi: 10.1038/nprot.2014.180 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shema Mugisha C, Vuong HR, Puray-Chavez M, Bailey AL, Fox JM, Chen RE, et al. A Simplified Quantitative Real-Time PCR Assay for Monitoring SARS-CoV-2 Growth in Cell Culture. mSphere. 2020;5: e00658–20. doi: 10.1128/mSphere.00658-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Li H, Bradley KC, Long JS, Frise R, Ashcroft JW, Hartgroves LC, et al. Internal genes of a highly pathogenic H5N1 influenza virus determine high viral replication in myeloid cells and severe outcome of infection in mice. PLoS Pathog. 2018;14: e1006821. doi: 10.1371/journal.ppat.1006821 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Perry ST, Buck MD, Lada SM, Schindler C, Shresta S. STAT2 Mediates Innate Immunity to Dengue Virus in the Absence of STAT1 via the Type I Interferon Receptor. PLOS Pathogens. 2011;7: e1001297. doi: 10.1371/journal.ppat.1001297 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Cheon H, Holvey-Bates EG, Schoggins JW, Forster S, Hertzog P, Imanaka N, et al. IFNβ-dependent increases in STAT1, STAT2, and IRF9 mediate resistance to viruses and DNA damage. The EMBO Journal. 2013;32: 2751–2763. doi: 10.1038/emboj.2013.203 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Wang Y, Song Q, Huang W, Lin Y, Wang X, Wang C, et al. A virus-induced conformational switch of STAT1-STAT2 dimers boosts antiviral defenses. Cell Res. 2021;31: 206–218. doi: 10.1038/s41422-020-0386-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Huang C-C, Huang T-S, Deng M-C, Jong M-H, Lin S-Y. Natural infections of pigs with akabane virus. Vet Microbiol. 2003;94: 1–11. doi: 10.1016/s0378-1135(03)00062-2 [DOI] [PubMed] [Google Scholar]
- 38.Uddin F, Rudin CM, Sen T. CRISPR Gene Therapy: Applications, Limitations, and Implications for the Future. Front Oncol. 2020;10: 1387. doi: 10.3389/fonc.2020.01387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Zhang Q, Bastard P, Liu Z, Le Pen J, Moncada-Velez M, Chen J, et al. Inborn errors of type I IFN immunity in patients with life-threatening COVID-19. Science. 2020;370: eabd4570. doi: 10.1126/science.abd4570 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.McNab F, Mayer-Barber K, Sher A, Wack A, O’Garra A. Type I interferons in infectious disease. Nat Rev Immunol. 2015;15: 87–103. doi: 10.1038/nri3787 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Koerner I, Kochs G, Kalinke U, Weiss S, Staeheli P. Protective Role of Beta Interferon in Host Defense against Influenza A Virus. Journal of Virology. 2007;81: 2025–2030. doi: 10.1128/JVI.01718-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Lenschow DJ, Lai C, Frias-Staheli N, Giannakopoulos NV, Lutz A, Wolff T, et al. IFN-stimulated gene 15 functions as a critical antiviral molecule against influenza, herpes, and Sindbis viruses. Proceedings of the National Academy of Sciences. 2007;104: 1371–1376. doi: 10.1073/pnas.0607038104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Lerolle S, Freitas N, Cosset F-L, Legros V. Host Cell Restriction Factors of Bunyaviruses and Viral Countermeasures. Viruses. 2021;13: 784. doi: 10.3390/v13050784 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Horisberger MA. Interferons, Mx genes, and resistance to influenza virus. Am J Respir Crit Care Med. 1995;152: S67–71. doi: 10.1164/ajrccm/152.4_Pt_2.S67 [DOI] [PubMed] [Google Scholar]
- 45.García-Sastre A. Induction and evasion of type I interferon responses by influenza viruses. Virus Res. 2011;162: 12–18. doi: 10.1016/j.virusres.2011.10.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Elliott RM. Orthobunyaviruses: recent genetic and structural insights. Nat Rev Microbiol. 2014;12: 673–685. doi: 10.1038/nrmicro3332 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(XLSX)
(PDF)
The coding sequence of pig IFNAR1 was synthesized according to the amino acid sequence deposited in GenBank (Acc. Num. NM_213772.1) with codon optimization to pig cells. The start and stop codons are underlined.
(TXT)
Data Availability Statement
All relevant data are within the manuscript and its Supporting Information files.