Combination of PARP inhibitor and CDK4/6 inhibitor modulates cGAS/STING‐dependent therapy‐induced senescence and provides “one‐two punch” opportunity with anti‐PD‐L1 therapy in colorectal cancer

Tao Wang; Weizhen Liu; Qian Shen; Ruikang Tao; Chengguo Li; Qian Shen; Yao Lin; Yongzhou Huang; Lei Yang; Gengchen Xie; Jie Bai; Ruidong Li; Lulu Wang; Kaixiong Tao; Yuping Yin

doi:10.1111/cas.15961

. 2023 Sep 13;114(11):4184–4201. doi: 10.1111/cas.15961

Combination of PARP inhibitor and CDK4/6 inhibitor modulates cGAS/STING‐dependent therapy‐induced senescence and provides “one‐two punch” opportunity with anti‐PD‐L1 therapy in colorectal cancer

Tao Wang ^1,², Weizhen Liu ¹, Qian Shen ³, Ruikang Tao ⁴, Chengguo Li ¹, Qian Shen ¹, Yao Lin ¹, Yongzhou Huang ¹, Lei Yang ¹, Gengchen Xie ¹, Jie Bai ¹, Ruidong Li ¹, Lulu Wang ⁵, Kaixiong Tao ^1,^✉, Yuping Yin ^1,^✉

PMCID: PMC10637067 PMID: 37702298

Abstract

Although PARP inhibitor (PARPi) has been proven to be a promising anticancer drug in cancer patients harboring BRCA1/2 mutation, it provides limited clinical benefit in colorectal cancer patients with a low prevalence of BRCA1/2 mutations. In our study, we found PARPi talazoparib significantly induced cellular senescence via inhibiting p53 ubiquitination and activating p21. Furthermore, CDK4/6i palbociclib amplified this therapy‐induced senescence (TIS) in vitro and in vivo. Mechanistically, talazoparib and palbociclib combination induced senescence‐associated secretory phenotype (SASP), and characterization of SASP components revealed type I interferon (IFN)‐related mediators, which were amplified by cGAS/STING signaling. More importantly, RNA sequencing data indicated that combination therapy activated T cell signatures and combination treatment transformed the tumor microenvironment (TME) into a more antitumor state with increased CD8 T cells and natural killer (NK) cells and decreased macrophages and granulocytic myeloid‐derived suppressor cells (G‐MDSCs). Moreover, clearance of the TIS cells by αPD‐L1 promoted survival in immunocompetent mouse colorectal cancer models. Collectively, we elucidated the synergistic antitumor and immunomodulatory mechanisms of the talazoparib–palbociclib combination. Further combination with PD‐L1 antibody might be a promising “one‐two punch” therapeutic strategy for colorectal cancer patients.

Keywords: cGAS/STING, colorectal cancer, immune checkpoint blockade, senotherapy, therapy‐induced senescence

Talazoparib and palbociclib combination triggers therapy‐induced senescence and activates antitumor immunity, which strengthens the anticancer effect of immune checkpoint blockade treatment in colorectal cancer. Characterization of senescence‐associated secretory phenotype components reveals type I IFN‐related mediators, which are amplified by cGAS/STING signaling.

graphic file with name CAS-114-4184-g006.jpg

Abbreviations

BMDC: bone marrow‐derived dendritic cell
CCF: cytoplasmic chromatin fragment
CI: combination index
CHX: cycloheximide
CTCF: corrected total cell fluorescence
CDK4/6i: CDK4/6 inhibitor
DCs: dendritic cells
DEGs: differentially expressed genes
DMSO: dimethyl sulfoxide
DDR: DNA damage response
ELISA: enzyme‐linked immunosorbent assay
NK: natural killer
FDA: Food and Drug Administration
FDR: false discovery rate
GSEA: Gene Set Enrichment Analysis
G‐MDSC: granulocytic myeloid‐derived suppressor cell
HR: homologous recombination
ISG: interferon‐stimulated gene
ICB: immune checkpoint blockade
IFN: interferon
KEGG: Kyoto Encyclopedia of Genes and Genomes
M‐MDSC: monocytic myeloid‐derived suppressor cell
PARP: poly (ADP‐ribose) polymerase
PARPi: PARP inhibitor
RB: retinoblastoma
SAPA: senescence‐associated proliferation arrest
SD: standard deviation
SSB: single‐strand break
SASP: senescence‐associated secretory phenotype
TME: tumor microenvironment
TIIC: tumor‐infiltrating immune cell
TIS: therapy‐induced senescence
WB: Western blot

1. INTRODUCTION

Poly (ADP‐ribose) polymerase (PARP) inhibitor (PARPi) is designed with synthetic lethality that impairs single‐strand break (SSB) repair and induces cell death in BRCA1/2‐mutated or homologous recombination (HR)‐deficient tumor cells. ¹ , ² , ³ Clinical studies have confirmed that PARPi is the “gold finger” drug in BRCA1/2‐mutated cancers and has more acceptable side effects than conventional chemotherapy. ⁴ , ⁵ , ⁶ , ⁷ PARPi has been approved by Food and Drug Administration (FDA) for application in various cancers. However, the low rate of BRCA1/2 mutations limits the efficacy of PARPi monotherapy in colorectal cancer. ⁸

Currently, new combination regimens and strategies have been applied to selectively enhance the efficacy of PARPi in multiple preclinical cancer models, ¹ , ⁹ , ¹⁰ , ¹¹ such as chemotherapy agents, radiotherapy, immunotherapy, and small molecule inhibitors, but we still need further evidence to promote these strategies into clinical application. ¹² Besides, although targeting cell cycle checkpoint kinases including ATR/CHK1 and ATM/CHK2 was theoretically feasible to elevate the anticancer effect of PARPi via impairing HR repair capacity, the safety and efficacy of these targeted drugs need to be proved by further clinical trials. ¹¹ , ¹³ Thus, exploring an FDA‐approved drug to sensitize the efficacy of PARPi may expand the population of the cancer patients who benefit from PARPi treatment. Meanwhile, clinical evidence revealed that HR‐independent action was also involved in PARPi therapy, and PARPi‐induced DDR challenged cell fate not only to promote apoptosis but also to stimulate cell senescence. ¹⁴ Our study also demonstrated that PARPi talazoparib activated p53/p21 senescence signaling in colorectal cancer cells, and it also reported that p21 activation promoted the anticancer effect of CDK4/6 inhibitor (CDK4/6i), which was recognized as a vital agent for breast cancer treatment approved by the FDA. ¹⁵ Based on this, it is rational to test the anticancer effect of PARPi and CDK4/6i combination in colorectal cancer.

To validate our hypothesis, we found PARPi and CDK4/6i combination showed a potent anticancer effect via amplifying therapy‐induced senescence (TIS) in colorectal cancer cells, and further data demonstrated that combination therapy induced senescence‐associated secretory phenotype (SASP) and promoted T cell proliferation and activation. Senescence and SASP can lead to tumor microenvironment (TME) remodeling, which contributes to the occurrence of drug resistance and tumor recurrence. ¹⁶ , ¹⁷ “One‐two punch” anticancer therapies consisting of senescence‐inducing agents and senolytics to selectively clear senescent cells have generated novel insights to improve antitumor efficacy. ¹⁸ , ¹⁹ Importantly, this finding allowed us to add immune checkpoint blockade (ICB) treatment to mediate senescent cells clearance, and our data suggest that the combination of PARPi and CDK4/6i could enhance αPD‐L1 efficacy in immunocompetent mice. The triple therapy proposed in our study may help expand the population of colorectal cancer that would benefit from single‐agent targeted therapy.

2. MATERIALS AND METHODS

2.1. Cell lines and culture

HCT116 and 293 T cell lines were obtained from the National Collection of Authenticated Cell Cultures of China. CT26‐LUC, MC38, and LoVo cell lines were purchased from Zhongqiao Xinzhou Biotechnology. Among them, CT26‐LUC and MC38 cell lines were cultured in RPMI‐1640 (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco). 293 T and HCT116 cell lines were cultured in Dulbecco's modified Eagle medium (Gibco) supplemented with 10% FBS. LoVo cell line was maintained in Ham's F12K medium (Zhongqiao Xinzhou Biotechnology) supplemented with 10% FBS.

2.2. T cell activation and proliferation assays

Mouse lymphocytes were obtained by centrifugation using a lymphocyte separation solution (Tbdscience). Bone marrow‐derived dendritic cells (BMDCs) from BALB/c mice (HUAFUKANG Bioscience) were extracted as reported in the literature. ²⁰ Bone marrow cells were cultured in RPMI‐1640 medium containing 10% FBS, 10 ng/mL granulocyte‐macrophage colony‐stimulating factor (GM‐CSF; PeproTech, AF‐315‐03), and 10 ng/mL IL‐4 (PeproTech, 214–14). CT26 cells were treated with DMSO, talazoparib (0.5 μM), palbociclib (1.0 μM), or talazoparib (0.5 μM) combined with palbociclib (1.0 μM) for 48 h, respectively. Subsequently, CT26 cells and dendritic cells (DCs) were cocultured at a ratio of 1:10 for 24 h. DCs were then cocultured with mouse spleen lymphocytes at a ratio of 1:10 for 72 h, and the cells were harvested and labeled with Anti‐CD3 (BioLegend, 100235), Anti‐CD8 (BioLegend, 100706), and Anti‐CD69 (BioLegend, 104508). The proportion of CD69+ cells was analyzed using flow cytometry. Coculture experiments were repeated three times under the same conditions.

CT26 cells were treated with the above concentrations of drugs for 48 h, and the supernatant was collected. Using the EasySep™ (Stemcell Technologies) Mouse T Cell Isolation Kit, T cells were purified from BALB/c mouse splenocytes. Subsequently, the supernatant obtained by culturing CT26 was used to stimulate T cells for 72 h in 96‐well plates, and CD3/CD28 beads (Gibco, Thermo Fisher Scientific) were added to the supernatant with 0.5:1 beads‐to‐lymphocyte ratio. Finally, 0.5 μCi [³H]thymidine (specific activity: 20 Ci/mmol) was added to 96‐well plates and incubated for 6 h to detect T cell proliferation. ²¹ This experiment was repeated three times.

2.3. Small interfering RNA transfection

The siRNA sequences were purchased from RiboBio (Guangzhou, China). The siRNA sequences for human cGAS knockdown were 5′‐CAACTACGACTAAAGCCATTT‐3′ (#1) and 5′‐CTTTGATAACTGCGTGACATA‐3′ (#2), and the sequences of siRNA #1 and siRNA #2 targeting mouse cGAS were 5′‐CTGTGGATATAATTCTGGCTT‐3′ and 5′‐GCAGCTACTATGAACATGTGA‐3′, respectively. The corresponding control siRNA sequence was 5′‐GGGUAUCGACGAUUACAAA‐3′. For siRNA transfection of cells, 3 μL of Lipofectamine 2000 (Thermo Fisher Scientific, USA) and 10 μL of siRNA (10 nM) were added, and cells were incubated for 24 h. Finally, the protein was extracted for Western blot (WB) to verify the knockdown effect.

2.4. Plasmid construction and transfection

The DNA product containing homology arms at both ends was inserted into the pLVX‐3× FLAG plasmid vector, as described previously. ²² Human PARP1 truncations were constructed as follows: zinc 1, zinc 2, BRCT, and PARP A helical domains with a Flag‐tag; zinc 1, zinc 2, and BRCT domains with a Flag‐tag; zinc 1 and zinc 2 domains with a Flag‐tag; and BRCT, PARP A helical, and PARP catalytic domains with a Flag‐tag. ²² Five human‐derived p53 truncations were constructed: TAD and DBD domains with a Flag‐tag, TAD domains with a Flag‐tag, DBD and CTD domains with a Flag‐tag, DBD domains with a Flag‐tag, and CTD domains with a Flag‐tag. ²³ The corresponding DNA sequence‐related primers are listed in Table S1–S3. Transfection was performed using the Neofect transfection reagent (Neofect Biotechnology) following the manufacturer's instructions.

2.5. Lentivirus infection

Lentiviruses targeting the p53 sequence were purchased from GeneChem Co., Ltd. Lentiviral transfection was performed as previously described. ¹¹ , ²⁴ After 24 h of transfection, 4 μg/mL puromycin was used to select stably transfected cells.

2.6. RNA extraction and qRT‐PCR

Total cellular RNA was extracted as previously described. ²⁵ Briefly, total RNA was extracted using RNAiso Plus* (Takara, 9109) after DMSO or talazoparib (0.5 μM) treatment and reverse transcribed into cDNA using PrimeScript RT Master Mix (Takara, RR036A). After the cDNA was diluted, the mRNA levels of target genes were detected using TB Green Premix Ex Taq II (Takara, RR820A) on a StepOne Plus Real‐Time PCR System (Thermo Fisher Scientific). The primer sequences used for qRT‐PCR are listed in Table S2. The fold change of mRNA levels in different groups was calculated using the ΔΔCt method. ²⁵ Each gene expression assay was repeated three times.

2.7. MTS assay

The colorectal cancer cell lines were seeded in 96‐well plates at 1 × 10³ cells/well and cultured overnight in the medium before adding DMSO, talazoparib, palbociclib, or talazoparib combined with palbociclib for treatment. Five days after drug treatment, cell proliferation was measured using the CellTiter™ AQueous assay (MTS; Promega). ¹¹ Each group contained five technical replicates of three independent experiments.

2.8. Cell cycle and apoptosis analysis

After treatment with the corresponding drugs, flow cytometry was performed to detect apoptosis and cell cycle progression, as previously reported. ¹¹ Cell apoptosis and cell cycle detection were repeated three times.

2.9. Clonogenic assay

Cells (1 × 10³ cells/well) were evenly seeded in a six‐well plate. After 4 days of culture, the medium was changed, and cells were treated with drugs. After cultivation for 10 days, the cells were stained and fixed as previously described. ²⁶ Cell clones were counted using ImageJ software. Each set of experiments was repeated thrice.

2.10. Western blot analysis and immunoprecipitation

Protein extraction and WB were performed as previously described. ²⁷ Briefly, the cells were lysed with phosphatase inhibitors (G2007, Servicebio), protease (B14001, Bimake), and RIPA buffer (V900854, Sigma). Depending on the molecular weight of the target protein, 7.5%–12.0% SDS‐PAGE was used for protein separation.

Primary antibodies against phospho‐Rb ^S807/811 (8516S), Rb (9309S), Phospho‐TBK1^S172 (5483S), TBK1 (38066S), Phospho‐IRF3^S396 (29047S), and IRF3 (4302S) were purchased from Cell Signaling Technology. Antibodies against PARP1 (13371), p21 (10355 and 28248), p53 (60283), GAPDH (60004), Flag (20543), ubiquitin (10201), Ki‐67 (27309), and cGAS (26416) were obtained from Proteintech. Horseradish peroxidase‐conjugated secondary antibodies (SA00001‐1 and SA00001‐2) were purchased from Proteintech.

Immunoprecipitation experiments were performed as previously described. ²⁸ Anti‐Flag magnetic beads (B26101) were purchased from Bimake. To avoid interference from light/heavy chains on the target band, mouse anti‐rabbit IgG light chain (A25022, 1:5000) and goat anti‐mouse IgG light chain (A25012, 1:5000) for secondary antibody incubation were obtained from Abbkine.

2.11. β‐Galactosidase staining

Cells and tumor tissues were stained using a β‐galactosidase staining kit (Beyotime Institute of Biotechnology). Briefly, an appropriate amount of β‐galactosidase staining fixative was added to cells or tissues. After fixation, the working staining solution was added, and the cells were observed using a light microscope after incubation at 37°C overnight. Each experiment was repeated thrice.

2.12. RNA sequencing

Three tumors were randomly selected from each group for RNA sequencing in animal experimentation. Library preparation and sequencing were performed using the Illumina HiSeq 2000/4000 platform (Novogene Bioinformatics Technology) as previously reported. ²⁹ Differentially expressed genes (DEGs), KEGG, and GSEA analyses were performed using the Novogene online analysis platform (Novogene Bioinformatics Technology). The signature score was calculated by normalizing gene expression levels. ³⁰

2.13. Enzyme‐linked immunosorbent assay

The enzyme‐linked immunosorbent assay (ELISA) kits used in this study are listed in Table S3, and ELISA was performed according to the instructions. The experiment was repeated thrice.

2.14. Immunofluorescence

The coverslips were placed in a six‐well plate, and the cells were evenly seeded at a density of 2 × 10⁵ cells/well overnight. Immunofluorescence experiments were performed as reported in the literature. ³¹ After treatment with DMSO, talazoparib, palbociclib, or talazoparib combined with palbociclib, cells were incubated with primary antibodies (Lamin B1, Proteintech, 12987, 1:100; cGAS, Proteintech, 26416, 1:100; Phospho‐TBK1^S172, Cell Signaling Technology, 5483S, 1:50; Phospho‐IRF3^S396, Cell Signaling Technology, 29047S, 1:100). The tissue sections were deparaffinized and incubated with primary antibodies (p21, Proteintech, 10355 and 28248, 1:200; CD8, Abcam, ab217344, 1:500; PD‐L1, Cell Signaling Technology, 64988S, 1:100). Corrected total cell fluorescence (CTCF) was used to compare changes in protein expression as previously reported. ³²

2.15. In vivo assays

The Institutional Animal Care and Use Committee, Huazhong University of Science and Technology approved all animal experiments in this study (20222879). PBS (100 μL) containing 1.0 × 10⁶ HCT116 cells or LoVo cells was injected into the right flank of BALB/c nude mice (HUAFUKANG Bioscience) at 5 weeks of age to construct a subcutaneous tumor model of nude mice. After 7–9 days, when the tumors grew to 100 mm³, they were randomly divided into two groups (the control group and the talazoparib group) or randomly distributed into four groups (control, talazoparib, palbociclib, and combination therapy groups). Talazoparib and palbociclib were purchased from Selleck Chemical. The control group received the same amount of normal saline orally. The talazoparib group was given 0.33 mg/kg/day talazoparib by gavage. The palbociclib group was administered 20 mg/kg/day palbociclib orally, and the combination group received talazoparib and palbociclib. Mice were sacrificed 21 days after treatment, and tumors were collected.

For the MC38 syngeneic model, PBS (100 μL) containing 1.0 × 10⁶ MC38 cells was injected into the right flank of C57 mice (HUAFUKANG Bioscience) at 5 weeks of age. For the CT26 syngeneic model, PBS (100 μL) containing 1.0 × 10⁶ CT26 cells was injected into the right flank of BALB/c mice (HUAFUKANG Bioscience) at 5 weeks of age. When the tumors grew to 100 mm³, BALB/c mice were randomly divided into two groups, four groups, or eight groups according to the experimental protocol. The two groups were: the control group and the talazoparib group. The four groups were: control, talazoparib, palbociclib, and combined treatment groups. The eight groups were: control, talazoparib, palbociclib, talazoparib combined with palbociclib, αPD‐L1, talazoparib combined with αPD‐L1, palbociclib combined with αPD‐L1, and talazoparib plus palbociclib combined with αPD‐L1 groups. Talazopanib and palbociclib were administered as described above. The αPD‐L1 antibody was purchased from BioXCell at a dose of 200 μg per mouse every 2 days via intraperitoneal injection. For 21 consecutive days, the tumor volume was measured every 2 days, and the body weight was measured every 3 days. The administration was stopped after 21 days, and the survival of the mice was observed. The formula for calculating tumor volume is as follows: (length × width × width) / 2. For CD8+ T cell depletion experiment, anti‐CD8 (clone 2.43, BioXCell) was given with intraperitoneal injection at a dose of 200 ug/mouse. Anti‐CD8 was given 2 days prior to tumor implantations (day −2), day 0, and then every 4 days for the duration of the experiment.

2.16. Immunohistochemistry (IHC)

The tumor tissue was fixed with 4% paraformaldehyde, dehydrated, and then embedded in paraffin. Immunohistochemical staining of the tumor tissues with anti‐Ki‐67 (1:2000) was performed as previously described. ³⁰ The staining intensity of the IHC referred to the positive cell frequency.

2.17. Bioluminescence imaging to monitor tumor

D‐luciferin (Meilunbio, MB1834) was diluted with D‐PBS (Meilunbio, MA0010) to a 15‐mg/mL working solution at a dose of 10 μL/g for intraperitoneal injection. After D‐luciferin was injected into the abdominal cavity, bioluminescence imaging analysis was performed. Drug efficacy was confirmed by measuring the tumor luminescence intensity. ³³

2.18. Flow cytometry and cell sorting

By using Collagenase IV (absin, abs47048003) and Deoxyribonuclease (absin, abs47047435), tumor tissue was prepared into a single‐cell suspension. The following viability dyes or anti‐mouse antibodies were used: anti‐CD8 (53‐6.7), anti‐F4/80 (T45‐2342), anti‐CD69 (H1.2F3), anti‐CD11b (M1/70), anti‐Ki‐67 (B56), anti‐Mouse Ly‐6G and Ly‐6C (RB6‐8C5), anti‐Mouse CD45 (30‐F11), anti‐Mouse CD3 Molecular Complex (17A2), Fixable Viability Stain 510, Anti‐Mouse NK‐1.1 (PK136), anti‐Mouse Ly‐6G (1A8), Ms Ly‐6C BV786 HK1.4.RMAB, Transcription Factor Buffer Set, and anti‐Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) purchased from BD Pharmingen.

2.19. Statistical analysis

GraphPad Prism version 9 (GraphPad Software, Inc) was used for statistical analysis. All data were presented as the mean ± standard deviation (SD), and Student's t‐test was used for comparison between groups. The Pearson coefficient was used to calculate the correlation of IHC scores for PARP1 and p21 in gastric and colorectal cancer specimens. p < 0.05 indicated a statistically significant difference.

3. RESULTS

3.1. PARPi talazoparib activates the cellular senescence signaling pathway in colorectal cancer

The study investigated the sensitivity of colorectal cancer to PARPi talazoparib using a mouse subcutaneous tumor model. The results showed that talazoparib monotherapy failed to significantly inhibit the growth of subcutaneous tumors in HCT116 and CT26 colorectal cancer (p > 0.05) (Figure S1–S8). To investigate differential gene expression and pathway enrichment associated with the response of colorectal cancer to talazoparib, RNA sequencing was performed. KEGG analysis showed that talazoparib could significantly activate the cellular senescence signaling pathway in colorectal cancer (Figure 1A), and DEG analysis showed that the expression of cellular senescence‐related genes was significantly upregulated in PARPi‐treated tumors (p < 0.001) (Figure 1B,C). Furthermore, we confirmed consistent results by staining HCT116 and CT26 tumors for β‐galactosidase (Figure 1D, E). Senescence can be triggered by cellular impairment, including loss of antioncogenes, organelle damage, and DNA damage. DNA damage‐inducing agents can activate the DDR to further upregulate the p53/p21 signaling pathway to induce cell senescence. ³⁴ To study the molecular mechanism of talazoparib‐induced senescence in colorectal cancer cells, GSEA analysis showed that talazoparib activated the p53 signaling pathway (Figure 1F). Meantime, immunofluorescence of tumors confirmed that talazoparib promoted the expression of p21 (Figure 1G). These data indicate that PARPi may promote colorectal cancer TIS by upregulating the p53/p21 signaling pathway.

Poly (ADP‐ribose) polymerase (PARP) inhibitor talazoparib promotes cellular senescence in colorectal cancer. (A) KEGG analysis of upregulated signaling pathways in HCT116 tumors treated with talazoparib. (B) Heatmap of DEGs in HCT116 tumors treated with DMSO or talazoparib. (C) The expression levels of genes in cellular senescence signature of HCT116 tumors (t‐test; ***p < 0.001). (D) Representative images of β‐galactosidase staining in HCT116 and CT26 tumors. Magnification: 400× or 1000×. Positive expression (→). (E) Data of the positive cell rate of β‐galactosidase staining in HCT116 and CT26 tumors are shown as mean ± SD (t‐test; **p < 0.01). (F) GSEA analysis of upregulated signaling pathways in HCT116 tumors treated with talazoparib. p < 0.001, false discovery rate (FDR) q‐value = 0.015. (G) Representative images of p21 immunofluorescence. Magnification: 400×. KEGG, Kyoto Encyclopedia of Genes and Genomes; DEGs, differentially expressed genes; GSEA, Gene Set Enrichment Analysis.

3.2. Talazoparib facilitates the binding of PARP1 to p53 and inhibits proteasome‐associated p53 degradation

Based on the effect of PARPi in the regulation of the p53/p21 signaling pathway, we attempted to treat colorectal cancer cell lines with talazoparib for different durations to understand the molecular mechanism. Talazoparib upregulated p53 and p21 protein levels in a time‐dependent manner (Figure 2A). Furthermore, the knockdown of p53 reversed PARPi‐mediated elevation of p21 protein expression in HCT116 and CT26 cells (Figure 2B). To investigate the underlying mechanism of PARPi regulation of p53 protein levels, coimmunoprecipitation experiments revealed that talazoparib promoted the binding of PARP1 to p53 (Figure 2C). To elucidate the precise region of the PARP1‐p53 interaction, a series of truncation mutants were constructed. Coimmunoprecipitation indicated that PARP1 mainly interacted with the DBD and CTD domains (residues 95–393) of p53 (Figure 2D), and p53 mainly interacted with the zinc 1 and zinc 2 domains (residues 1–384) of PARP1 (Figure 2E).

Talazoparib facilitates poly (ADP‐ribose) polymerase (PARP)1 binding to p53 and inhibits p53 ubiquitination degradation. (A) Western blot of p53 and p21 in HCT116 and CT26 cells upon talazoparib (0.5 μM) exposure for 12 or 24 h. (B) Western blot analysis of the effect of p53 knockdown on the upregulation of p21 protein expression in tumor cells by talazoparib (0.5 μM). (C) Coimmunoprecipitation experiments were used to determine whether PARP1 and p53 were bound in HCT116 cells. The cells were treated with DMSO or talazoparib (0.5 μM) for 24 h. (D) Coimmunoprecipitation was used to detect interplay between endogenous PARP1 and domains of p53, including amino acids 1–393, 1–289, 1–94, 95–393, and 290–393 in 293 T cells. (E) Coimmunoprecipitation detected interactions between endogenous p53 and PARP1 domains, including amino acids 1–384, 1–476, 1–779, 1–1014, and 385–1014 in 293 T cells. (F) p53 protein expression was assessed after incubation with cycloheximide (CHX) at various times with or without talazoparib (0.5 μM) in HCT116 cells (t‐test; ***p < 0.001). (G) The level of p53 ubiquitination was detected using Western blotting. HCT116 cells were treated with DMSO or talazoparib (0.5 μM) for 24 h, followed by MG132 (10 μM) for 4 h.

Moreover, we confirmed that p53 mRNA levels were not significantly elevated after cells were treated with talazoparib (Figure S2), suggesting that PARPi may stabilize p53 through post‐transcriptional regulation. To confirm our conjecture, cycloheximide (CHX) and MG132 were used to evaluate the effects of PARPi on p53 in HCT116 cells, which demonstrated that talazoparib inhibited p53 degradation and prolonged p53 half‐life (Figure 2F). Furthermore, ubiquitination experiments revealed that the rate of p53 ubiquitination was inhibited in cells treated with talazoparib (Figure 2G). Collectively, these results suggest that talazoparib could stabilize p53 by promoting PARP1 binding to p53 and further reducing p53 ubiquitination.

3.3. Talazoparib combined with palbociclib inhibits tumor proliferation by stimulating tumor senescence in vitro and in vivo

Previous studies reported that upregulation of p21 expression sensitized tumor cells to CDK4/6i; ¹⁵ therefore, we speculated that PARPi could enhance the antiproliferative effect of CDK4/6i in colorectal cancer cell lines. To assess the efficacy of combination therapy, we calculated a series of combination indexes (CIs) for talazoparib/palbociclib at fixed ratios (Figure 3A). Consistent with the molecular characteristics of the tumors, CI less than 0.9 across all concentration ranges supported the synergy in HCT116^shCtrl and CT26^shCtrl, and no synergy (CI >0.9) of combination therapy was observed in HCT116^shp53 and CT26^shp53 (Figure 3A). Clonogenic experiments also demonstrated that dual PARP and CDK4/6 inhibition significantly restrained the proliferation of colorectal cancer cell lines (Figure 3B,C). Our data show that talazoparib sensitization of palbociclib against tumor proliferation is p53 dependent.

Dual poly (ADP‐ribose) polymerase (PARP) and CDK4/6 inhibition block colorectal cancer proliferation by promoting tumor senescence. (A) Cell proliferation was detected using MTS, and the combination index (CI) was calculated to assess the efficacy of combination therapy. CI <0.9 is considered synergistic. HCT116^shCtrl, CT26^shCtrl, HCT116^shp53, and CT26^shp53 cells were treated with 0, 0.03, 0.06, 0.13, 0.25, and 0.5 μM talazoparib and/or 0, 0.06, 0.13, 0.25, 0.5, and 1 μM palbociclib, respectively, for 5 days. (B) Clonogenic assays were used to assess the antiproliferative effects of talazoparib (50 nM) or/and palbociclib (100 nM) in HCT116 and CT26 cells. (C) Statistical graphs of (B) and (D) (t‐test; ***p < 0.001). (D) β‐Galactosidase staining was performed, and the proportion of positive cells was calculated to probe the efficacy of talazoparib (0.5 μM) or/and palbociclib (1 μM) treatment for 3 days in promoting cellular senescence. Magnification: 400×. Positive expression (→). (E) Tumor volume of each group (n = 5) on the indicated days of treatment (t‐test; ***p < 0.001). (F) The weight of each mouse group (t‐test). (G) Representative images of β‐galactosidase staining and Ki‐67 immunohistochemistry in HCT116 tumors (t‐test; ***p < 0.001). Magnification: 400 × .

However, flow cytometry analysis confirmed that combined PARP and CDK4/6 inhibition did not obviously increase tumor cell apoptosis compared with the monotherapy group at 3 days post treatment (Figure S3A). In addition, cell cycle analysis demonstrated that talazoparib treatment arrested HCT116 and CT26 cells in the G2M phase (p < 0.05) and palbociclib blocked tumor cells in the G0G1 phase (p < 0.05) (Figure S3B–D). Therefore, talazoparib combined with palbociclib treatment may accumulate cells in both G0G1 and G2M phases. Given that severe cell cycle arrest can induce senescence in tumor cells, ³⁵ we disclosed the level of cellular senescence. The β‐galactosidase staining analysis showed that talazoparib combined with palbociclib could significantly promote HCT116 and CT26 cell senescence (Figure 3C,D). In contrast, the knockdown of p53 could reverse the TIS of the drug combination (Figure 3C,D).

Consistent with cell culture models, combination therapy significantly inhibited the growth of HCT116‐derived tumors compared with other groups in a 21‐day observation (Figure 3E). Furthermore, no significant difference was observed in the body weight of the four groups, suggesting that the combination treatment was well tolerated by the mice (Figure 3F). Moreover, the tumor tissue of the combination group exhibited more noticeable β‐galactosidase staining, and the expression of Ki‐67 was significantly weaker than that of the other three groups (Figure 3G). These results indicate that talazoparib combined with palbociclib could promote the senescence of tumors in BALB/c nude mice and inhibit tumor growth.

3.4. Dual PARP and CDK4/6 inhibition induces cytoplasmic chromatin fragment (CCF) production and activates innate immunity in colorectal cancer cells

As previously reported, degradation of the nuclear membrane marker lamin B1 and the appearance of CCFs were important features of senescent cells. ³⁶ , ³⁷ In accordance with this, a decrease in the expression of the nuclear protein component lamin B1 was found in senescent cells induced by combined PARP and CDK4/6 inhibition (Figure 4A,B). Notably, using confocal microscopy, we observed nuclear chromosomes in the form of blebs budding of the nucleus resulting in CCFs in TIS cells treated with dual drugs, whereas no obvious CCF was observed in the monotherapy group (Figure 4A,C). cGAS/STING is a key axis mediating cellular senescence and autoimmunity, recognizing microbial DNA and also being stimulated by endogenous DNA. ³⁸ In senescent HCT116 cells, we found that cGAS could costain with DAPI‐positive blebs budding of the nucleus using confocal microscopy, suggesting that cGAS may be involved in sensing the CCFs (Figure 4A). These results indicate that the combination therapy may downregulate the nuclear membrane component lamin B1 by promoting cellular senescence, thereby producing CCFs to activate the cGAS/STING pathway.

Talazoparib combined with palbociclib activates the cGAS/STING pathway in colorectal cancer via induction of senescence. (A) Lamin B1 (red) and cGAS (green) immunofluorescences in HCT116 cells treated with talazoparib (0.5 μM) or/and palbociclib (1 μM) for 48 h were captured using confocal fluorescence microscopy. Magnification: 600×. (B) Lamin B1 expression was measured by CTCF. (C) CCFs were determined using confocal fluorescent microscopy. (D) Western blot of p‐TBK1 and P‐IRF3 treated with the above drug concentrations for 24 h in colorectal cancer cells. (E) Cells were stained for immunofluorescence of p‐TBK1 (green) and p‐IRF3 (red) in p53 knockdown and parental HCT116 cells. Cells were incubated with the above drug concentrations for 2 days, respectively. Magnification: 400×. (F) β‐galactosidase staining was performed to calculate the proportion of positive cells. HCT116 and CT26 cells were treated with the above drug concentrations for 3 days, respectively. Positive expression (→). Magnification: 400×. CTCF, corrected total cell fluorescence. CCF, cytoplasmic chromatin fragment.

In addition, the TBK1/IRF3 signaling pathway is downstream of cGAS/STING, which can lead to the secretion of proinflammatory cytokines and activation of innate immune responses. ³² We also found that the combination treatment triggered the phosphorylation of TBK1 and IRF3 in HCT116 and CT26 cells (Figure 4D). However, the activation of the TBK1/IRF3 signaling pathway was reversed after p53 knockdown (Figure 4E). Together these findings confirm that cGAS/STING signaling activation depends on CCFs which derived from p53‐mediated cellular senescence. Furthermore, we found that the knockdown of cGAS in AGS and HCT116 cells attenuated senescence‐induced effects in the combination treatment group (Figure 4F).

3.5. Type I IFN response and SASP induced by the combination of talazoparib and palbociclib relies on cGAS

Based on the potential activation of innate immune responses in dual PARP and CDK4/6 inhibition, we further investigated the antitumor effect of the combination therapy in immunocompetent mice bearing CT26 tumors. However, in the animal experiments of BALB/c immunocompetent mice, the combination therapy group did not exhibit significant anticancer efficacy compared with the single drug group (Figure S4A–C). To confirm this result, we used the murine colon cancer cell line MC38 to construct a subcutaneous tumor model in immunocompetent mice and human colon cancer cell LoVo to construct a subcutaneous tumor model of nude mice. The experimental results showed that the inhibitory effect of the double‐drug combination therapy on LoVo tumors was significantly better than that of the single‐drug therapy group in nude mice (Figure S5A–C). However, talazoparib combined with palbociclib had no significant difference in inhibitory effect on MC38 tumors compared with monotherapy in immunocompetent mice (Figure S5D–F). Studies have shown that TIS of cells can induce a immunosuppressive TME leading to an off‐target effect and promote drug resistance. ¹⁶ , ¹⁷ Strategy targeting senescent cells has recently been proposed to eliminate these detrimental effects, termed “one‐two punch” cancer therapy. ¹⁸ , ¹⁹ Previous studies have confirmed that activation of the innate immune system can promote antitumor immune efficacy. ³⁹ , ⁴⁰ Therefore, induction of senescence through dual PARP and CDK4/6 inhibition followed by immune‐mediated senescent cell clearance may improve the efficacy of targeted drugs. To explore the effect of talazoparib combined with palbociclib on antitumor immunity, we performed RNA sequencing using CT26 tumors. RNA sequencing results show that IFN‐β response signature and T cell signature are significantly upregulated in the combination therapy group (Figure 5A,B).

The combination therapy increases T cell activation and T cell proliferation rate in vitro. (A, B) RNA sequencing was used to explore the immune landscape of CT26 tumors. The expression levels of genes in IFN‐β response signature and T cells signature (***p < 0.001). (C, D) The proportion of CD69+ cells was detected using flow cytometry in the CT26^shCtrl group and CT26^shp53 group (*p < 0.05, ***p < 0.001, ns, not significant). CT26 cells were treated with DMSO, talazoparib (0.5 μM), palbociclib (1.0 μM), or a two‐drug combination for 48 h, respectively. Then, CT26 cells were sequentially cocultured with mouse dendritic cells (DCs) and mouse spleen lymphocytes. (E, F) T cell proliferation was determined by [³H] thymidine incorporation. Purified T cells from the spleen of BALB/c mice were activated with CD3/CD28 beads in the presence of the supernatant of CT26 cells treated with DMSO, talazoparib (0.5 μM), palbociclib (1.0 μM), or combination therapy. (G) ELISA kits were used to detect the expression of IFN‐β, CCL5, CXCL10, IL‐1β, IL‐6, and TNF‐α in the supernatant of the coculture system (***p < 0.001).

To verify the influence of the combination therapy on the activation state of T cells, we conducted a coculture experiment. As shown in Figure 5C–E, the proportion of CD69+ T cells and T cell proliferation rate obviously increased in the talazoparib combined with palbociclib treatment group compared with the control or the single‐drug group. However, cGAS knockdown resulted in attenuated T cell proliferation and activation in the combination treatment group (Figure 5D,F). Subsequently, to characterize the immunomodulatory composition of the combination group, we collected the supernatant of coculture system to detect the cytokines, chemokines, and type I IFNs. The ELISA results show that the expression of seven molecules including IFN‐β is significantly increased after combination treatment in tumor cells (Figure 5G). Among them, CCL5 and CXCL10 are potent T cell‐activating cytokines. ⁴¹ Meanwhile, CCL5, CXCL10, TNF‐α, IL‐1β, and IL‐6 are members of the interferon‐stimulated gene (ISG) family, and their elevated expression is closely related to SASP. ³² , ⁴² , ⁴³ However, the double‐drug combination led to upregulation of these cytokines/chemokines, which was reversed by cGAS knockdown (Figure 5G). These results suggest that talazoparib and palbociclib combination could induce SASP, and characterization of SASP components revealed type I IFN‐related mediators which are amplified by cGAS signaling.

3.6. αPD‐L1 in combination with talazoparib and palbociclib achieves lasting tumor regression in immunocompetent mice

Given the results for prosenescence effects of dual PARP and CDK4/6 inhibition and the evidence that senescent cells activated T lymphocytes through the SASP, the study sought to assess whether αPD‐L1 could improve the antitumor efficacy of the combination of talazoparib and palbociclib in immunocompetent mice. As expected, the triple therapy that included αPD‐L1 noticeably reduced the progression of CT26 tumors in immunocompetent mice (Figure 6A–C). Notably, three mice (60%) in the triple‐therapy group exhibited complete tumor remission (Figure 6A). In addition, the body weights of the mice in the triple‐therapy group were not significantly different from those of the other seven groups, suggesting that the mice in the triple‐therapy group tolerated the drug well (Figure 6D). During survival analysis, the median survival of the triple‐therapy group was significantly improved compared with the other seven groups (P = 0.014) (Figure 6E).

Antitumor efficacy of talazoparib plus palbociclib combined with ɑPD‐L1 in immunocompetent mice. (A) Representative images of bioluminescence imaging on the indicated days of treatment (n = 5 for each group). (B) Dosing interval and route. (C) Tumor growth curves in the CT26 colorectal cancer mice model. Tumor volume is represented by mean ± SD (t‐test; ***p < 0.001). (D) The weight of each mouse group (t‐test). (E) Survival curves showed therapeutic efficacy in BALB/c mice (p = 0.014). (F) Representative images of CD8 and PD‐L1 immunofluorescence. Magnification 400 ×.

Moreover, the multi‐immunofluorescence analysis revealed that tumors exhibited added CD8+ T cell infiltration and elevated proportion of PD‐L1‐positive cells in the talazoparib combined with palbociclib group and triple‐therapy group (Figure 6F). Meantime, αPD‐L1 appeared to clear senescent tumor cells, as triple‐therapy tumors showed a reduction in β‐galactosidase staining‐positive cells compared with tumors of the talazoparib combined with palbociclib treatment group (Figure S6). We detected the changes in the overall picture of the tumor immune microenvironment by flow cytometry. Macrophages and granulocytic myeloid‐derived suppressor cells (G‐MDSCs) in the tumor tissues after treatment with talazoparib combined with palbociclib decreased compared with other groups, while NK and CD8 T cells were significantly increased in tumors following dual therapy with talazoparib and palbociclib, and there was no significant difference in the number of monocytic myeloid‐derived suppressor cells (M‐MDSCs) in the tumors of each group (Figure 7A–E). The gating strategy for the identification of tumor‐infiltrating immune cells (TIICs) in CT26 tumors is shown in Figure S7. In addition, the activation and proliferation of CD8 T cells and the expression of related cytokines in CT26 tumor tissue were consistent with the results of T cell coculture experiments (Figure 7F–H).

The changes in the overall picture of tumor immune microenvironment. The proportion of macrophages (A), granulocytic myeloid‐derived suppressor cells (G‐MDSCs) (B), monocytic myeloid‐derived suppressor cells (M‐MDSCs) (C), NK (D), and CD8 T cells (E) in CT26 tumor tissues after 21 days of treatment (*p < 0.05, **p < 0.01, ns, not significant). (F) The activation level of CD8 T cells in each group (***p < 0.001). (G) The proliferation level of CD8 T cells in each group (**p < 0.01). (H) ELISA kits were used to detect the expression of TNF‐α, IFN‐β, CCL5, CXCL10, IL‐1β, and IL‐6 in the CT26 tumor homogenate (**p < 0.01, ***p < 0.001).

Through the CD8 T depletion experiment to delete CD8+ T cells in BALB/c mice, the tumor volume in the triple‐therapy group was not significantly smaller than that in the talazoparib combined with palbociclib group (Figure S8A–C), indicating that CD8+ T cells played an important role in tumor suppression in the triple‐therapy group. These data suggest that talazoparib combined with palbociclib activates antitumor immunity by promoting the infiltration of CD8+ T lymphocytes and upregulating the expression of PD‐L1 in cells, which strengthens the anticancer effect of ICB treatment in immunocompetent mice (Figure 8).

Schematic representation of talazoparib combined with palbociclib activating antitumor immunity and synergizing immune checkpoint blockade (ICB) in colorectal cancer.

4. DISCUSSION

PARPi has extraordinary therapeutic effects on HR‐deficient tumors; however, clinical trials have shown that HR‐independent modes of action of PARPi are also associated with clinical benefit. ¹⁴ DDR triggered by PARPi mobilizes cell fate decisions, such as inducing TIS or apoptosis leading to tumor cell death. ⁴⁴ In colorectal cancer cells, our data suggest that the PARPi talazoparib could activate the p53/p21 senescence signaling pathway by inhibiting p53 ubiquitination. A study has shown that p53‐dependent TIS could facilitate chemotherapy resistance and ultimately lead to tumor recurrence, and the phenomenon may be due to the fact that cell cycle arrest assists tumor cells with DNA damage in escaping the mitotic catastrophe. ⁴⁵ In addition, it has been reported that PARPi can trigger p21‐dependent TIS in ovarian and breast cancer cells by activating the DDR kinase Chk2 and the senescence‐associated proliferation arrest (SAPA) induced by PARPi is reversible. ⁴⁴ Excavating the beneficial potential of TIS through the screening of combination therapy drugs may further broaden the beneficiary population of PARPi.

As previously reported, ⁴⁶ CDK4/6i induces HR deficiency in MYC‐overexpressing ovarian cancer cells, and its combination with PARPi promotes apoptosis. In addition, profound cell cycle arrest can induce TIS in tumor cells. ³⁵ We observed that the combination therapy arrested tumor cells in G0G1 and G2M phases while inhibiting cell proliferation by exacerbating TIS in colorectal cancer. Interestingly, the combination therapy had no significant effect on apoptosis in this study, which might be related to diversity in gene status among different tumors. Of note, p21 is a pan‐CDK inhibitor that loses CDK inhibitory activity due to mitogen‐triggered tyrosine phosphorylation when bound to D cyclins and CDK4/6 as assembly factors. ⁴⁷ The key antitumor mechanism of action of CDK4/6i is to induce G1 cell cycle arrest by inhibiting phosphorylation of the tumor suppressor RB. ⁴⁸ , ⁴⁹ , ⁵⁰ However, CDK4/6i can upregulate cyclin D1 expression to further sequester cell cycle inhibitory protein p21, resulting in CDK4/6i resistance. ¹⁵ PARPi promoted the expression of cell cycle inhibitory protein p21 in colorectal cancer, which might be the main reason for this synergistic antitumor effect.

Previous publications described that the cGAS/STING pathway, AKT1/IKKα, or TOP1cc levels are closely associated with TIS induction or exacerbation. ⁵¹ , ⁵² Our data also confirm that the TIS produced by the two‐drug combination cGAS dependent. cGAS is a cytoplasmic DNA sensor that can recognize micronuclei surrounded by fragile lamin B1 membranes, free DNA caused by mitochondrial DNA instability, or endogenous retroviruses, which further activates downstream signal transducers or transcription factors. ⁵³ Decreased expression of lamin B1, characteristic of senescent cells, may lead to leakage of chromatin from the nucleus into the cytoplasm, and the CCF is involved in the autophagy to stabilize cellular senescence. ³⁷ , ⁵⁴ Our study revealed that talazoparib combined with palbociclib treatment promoted the release of DNA from the nucleus into the cytoplasm as blebs bud of the nucleus. The colocalization of cGAS and DAPI‐positive chromatin herniations confirmed that endogenous DNA sensing was established in the senescent cells. Activation of cGAS/STING mediates innate immune responses and promotes cytokine secretion by producing type I interferons. ⁴² , ⁵⁵ SASP is composed of a variety of inflammatory cytokines and other immune modulators secreted by senescent cells, while SASP amplifies cellular senescence by involving auto‐ and paracrine signaling. ⁵⁶ , ⁵⁷ Consistent with previous reports, SASP produced by senescent cells disappeared, and cellular senescence was further attenuated after the knockdown of cGAS. Importantly, our study elucidated how senescence‐specific inflammatory SASP was triggered.

Therapy‐induced senescence inhibits tumor growth for a better prognosis, while the chronic accumulation of senescent cells during long‐term treatment can provoke resistance and recurrence. ⁵⁸ , ⁵⁹ Strategies for the targeted clearance of senescent cells are named senotherapy, including immunotherapy, senolytics‐mediated senescent cell clearance, and SASP inhibition by targeting agents. ¹⁶ Exacerbating TIS provides a treatment window for additional pharmacological manipulation, and robust immunogenicity of senescent cells activates antitumor immune responses. TIS‐induced SASP can lead to TME remodeling, either by inducing antitumor immunity or forming an immunosuppressive niche depending on the secretory components and the target cells. ¹⁶ TIICs convert immunologically “cold tumors” into “hot tumors” and promote the efficacy of ICB. ⁶⁰ Interestingly, dual PARP and CDK4/6 inhibition resulted in a significant increase in CD8+ T lymphocyte infiltration, which may be due to CCL5 and CXCL10 of SASP‐related components promoting T lymphocyte activation and proliferation for senescence immunosurveillance. ²¹ , ⁶¹ In addition, cytokines, including IFN‐γ, and type I interferon (IFN‐α, IFN‐β) regulate PD‐L1 expression, ⁶² and the addition of immune checkpoint inhibitor αPD‐L1 cleared the senescent cells induced by talazoparib and palbociclib combination therapy and obtained a potent antitumor effect.

This study has some limitations. First, the reason why the antitumor effect of talazoparib combined with palbociclib was not observed in this immune‐active condition needs further study. Second, the efficacy of triple therapy in colorectal cancer patients needs to be further confirmed by clinical studies.

In summary, our study revealed that talazoparib combined with palbociclib activated the cGAS/STING pathway by promoting cellular senescence, further unleashing the antitumor immune response mediated by its SASP. Talazoparib plus palbociclib combined with αPD‐L1 therapy achieved a promising antitumor effect in immunocompetent mice. These findings may have important implications for the clinical development of talazoparib and palbociclib in combination with αPD‐L1 therapy in colorectal cancer.

AUTHOR CONTRIBUTIONS

KXT and YPY conceived and designed the study. TW and WZL conducted the experiments, performed the statistical analysis, and drafted the manuscript. CGL participated in the animal experiments. QS, RKT, YL, QS, YZH, LY, GCX, JB, RDL, and LLW conducted the experiments and analyzed the data. All authors read and approved the final manuscript.

FUNDING INFORMATION

This work was supported by the Natural Science Foundation of Hubei Province (No. 2019CFB660, 2019CFB100, and 2021CFB566), the Key Research and Development Program of Hubei Province (No. 2021BCA116), and the National Natural Science Foundation of China (No. 81874184, 82003205, and 82003131).

CONFLICT OF INTEREST STATEMENT

The authors have no conflict of interest.

ETHICS STATEMENT

Approval of the research protocol by an Institutional Reviewer Board: This study was approved by the Institutional Animal Care and Use Committee, Huazhong University of Science and Technology.

Informed Consent: N/A.

Registry and the Registration No. of the study/trial: N/A.

Animal Studies: The Institutional Animal Care and Use Committee, Huazhong University of Science and Technology approved all animal experiments in this study (20222879).

Supporting information

Figure S1–S8.

Click here for additional data file.^{(1.8MB, pdf)}

Table S1–S3.

Click here for additional data file.^{(74.2KB, pdf)}

ACKNOWLEDGMENTS

We appreciate the technical support provided by Figdraw in the drawing of the schematic.

Wang T, Liu W, Shen Q, et al. Combination of PARP inhibitor and CDK4/6 inhibitor modulates cGAS/STING‐dependent therapy‐induced senescence and provides “one‐two punch” opportunity with anti‐PD‐L1 therapy in colorectal cancer. Cancer Sci. 2023;114:4184‐4201. doi: 10.1111/cas.15961

Tao Wang and Weizhen Liu contributed equally to this work.

Contributor Information

Kaixiong Tao, Email: kaixiongtao@hust.edu.cn.

Yuping Yin, Email: yinyuping2017@hust.edu.cn.

DATA AVAILABILITY STATEMENT

All data relevant to the study are included in the article or uploaded as supplementary information.

REFERENCES

1. Lord CJ, Ashworth A. PARP inhibitors: synthetic lethality in the clinic. Science. 2017;355:1152‐1158. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. Nature. 2001;411:366‐374. [DOI] [PubMed] [Google Scholar]
3. Powell SN, Bindra RS. Targeting the DNA damage response for cancer therapy. DNA Repair (Amst). 2009;8:1153‐1165. [DOI] [PubMed] [Google Scholar]
4. Golan T, Atias D, Stossel C, Raitses‐Gurevich M. Patient‐derived xenograft models of BRCA‐associated pancreatic cancers. Adv Drug Deliv Rev. 2021;171:257‐265. [DOI] [PubMed] [Google Scholar]
5. Audeh MW, Carmichael J, Penson RT, et al. Oral poly(ADP‐ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof‐of‐concept trial. Lancet. 2010;376:245‐251. [DOI] [PubMed] [Google Scholar]
6. Kaufman B, Shapira‐Frommer R, Schmutzler RK, et al. Olaparib monotherapy in patients with advanced cancer and a germline BRCA1/2 mutation. J Clin Oncol. 2015;33:244‐250. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Tutt A, Robson M, Garber JE, et al. Oral poly(ADP‐ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof‐of‐concept trial. Lancet. 2010;376:235‐244. [DOI] [PubMed] [Google Scholar]
8. Alexandrov LB, Nik‐Zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683. [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Konstantinopoulos PA, Ceccaldi R, Shapiro GI, D'Andrea AD. Homologous recombination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov. 2015;5:1137‐1154. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Scott CL, Swisher EM, Kaufmann SH. Poly (ADP‐ribose) polymerase inhibitors: recent advances and future development. J Clin Oncol. 2015;33:1397‐1406. [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Wang T, Zhang P, Li C, et al. MUS81 inhibition enhances the anticancer efficacy of Talazoparib by impairing ATR/CHK1 signaling pathway in gastric cancer. Front Oncol. 2022;12:844135. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Dréan A, Lord CJ, Ashworth A. PARP inhibitor combination therapy. Crit Rev Oncol Hematol. 2016;108:73‐85. [DOI] [PubMed] [Google Scholar]
13. Li S, Wang L, Wang Y, Zhang C, Hong Z, Han Z. The synthetic lethality of targeting cell cycle checkpoints and PARPs in cancer treatment. J Hematol Oncol. 2022;15:147. [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Ledermann J, Harter P, Gourley C, et al. Olaparib maintenance therapy in platinum‐sensitive relapsed ovarian cancer. N Engl J Med. 2012;366:1382‐1392. [DOI] [PubMed] [Google Scholar]
15. Vilgelm AE, Saleh N, Shattuck‐Brandt R, et al. MDM2 antagonists overcome intrinsic resistance to CDK4/6 inhibition by inducing p21. Sci Transl Med. 2019;11:eaav7171. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Liu H, Zhao H, Sun Y. Tumor microenvironment and cellular senescence: understanding therapeutic resistance and harnessing strategies. Semin Cancer Biol. 2022;86:769‐781. [DOI] [PubMed] [Google Scholar]
17. Toso A, Revandkar A, Di Mitri D, et al. Enhancing chemotherapy efficacy in Pten‐deficient prostate tumors by activating the senescence‐associated antitumor immunity. Cell Rep. 2014;9:75‐89. [DOI] [PubMed] [Google Scholar]
18. Wang L, Leite de Oliveira R, Wang C, et al. High‐throughput functional genetic and compound screens identify targets for senescence induction in cancer. Cell Rep. 2017;21:773‐783. [DOI] [PubMed] [Google Scholar]
19. Leite de Oliveira R, Bernards R. Anti‐cancer therapy: senescence is the new black. EMBO J. 2018;37:e99386. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Inaba K, Inaba M, Romani N, et al. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony‐stimulating factor. J Exp Med. 1992;176:1693‐1702. [DOI] [PMC free article] [PubMed] [Google Scholar]
21. De Martino M, Tkach M, Bruni S, et al. Blockade of Stat3 oncogene addiction induces cellular senescence and reveals a cell‐nonautonomous activity suitable for cancer immunotherapy. Onco Targets Ther. 2020;9:1715767. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Zhang N, Zhang Y, Qian H, Wu S, Cao L, Sun Y. Selective targeting of ubiquitination and degradation of PARP1 by E3 ubiquitin ligase WWP2 regulates isoproterenol‐induced cardiac remodeling. Cell Death Differ. 2020;27:2605‐2619. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Jenkins LM, Durell SR, Mazur SJ, Appella E. p53 N‐terminal phosphorylation: a defining layer of complex regulation. Carcinogenesis. 2012;33:1441‐1449. [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Fang Z, Cao B, Liao JM, et al. SPIN1 promotes tumorigenesis by blocking the uL18 (universal large ribosomal subunit protein 18)‐MDM2‐p53 pathway in human cancer. Elife. 2018;7:e31275. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Li C, Shen Q, Zhang P, et al. Targeting MUS81 promotes the anticancer effect of WEE1 inhibitor and immune checkpoint blocking combination therapy via activating cGAS/STING signaling in gastric cancer cells. J Exp Clin Cancer Res. 2021;40:315. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Huang Y, Zhang J, Hou L, et al. LncRNA AK023391 promotes tumorigenesis and invasion of gastric cancer through activation of the PI3K/Akt signaling pathway. J Exp Clin Cancer Res. 2017;36:194. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Nam HJ, Kim HP, Yoon YK, et al. The irreversible pan‐HER inhibitor PF00299804 alone or combined with gemcitabine has an antitumor effect in biliary tract cancer cell lines. Invest New Drugs. 2012;30:2148‐2160. [DOI] [PubMed] [Google Scholar]
28. An L, Nie P, Chen M, et al. MST4 kinase suppresses gastric tumorigenesis by limiting YAP activation via a non‐canonical pathway. J Exp Med. 2020;217:e20191817. [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Cheng W, Li XW, Xiao YQ, Duan SB. Non‐coding RNA‐associated ceRNA networks in a new contrast‐induced acute kidney injury rat model. Mol Ther Nucleic Acids. 2019;17:102‐112. [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Yi M, Zhang J, Li A, et al. The construction, expression, and enhanced anti‐tumor activity of YM101: a bispecific antibody simultaneously targeting TGF‐β and PD‐L1. J Hematol Oncol. 2021;14:27. [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Chen X, Li L, Liu F, Hoh J, Kapron CM, Liu J. Cadmium induces glomerular endothelial cell‐specific expression of complement factor H via the −1635 AP‐1 binding site. J Immunol. 2019;202:1210‐1218. [DOI] [PubMed] [Google Scholar]
32. Glück S, Guey B, Gulen MF, et al. Innate immune sensing of cytosolic chromatin fragments through cGAS promotes senescence. Nat Cell Biol. 2017;19:1061‐1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Meng Z, Huang H, Huang D, Zhang F, Mi P. Functional metal‐organic framework‐based nanocarriers for accurate magnetic resonance imaging and effective eradication of breast tumor and lung metastasis. J Colloid Interface Sci. 2021;581:31‐43. [DOI] [PubMed] [Google Scholar]
34. Huang W, Hickson LJ, Eirin A, Kirkland JL, Lerman LO. Cellular senescence: the good, the bad and the unknown. Nat Rev Nephrol. 2022;18:611‐627. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Choi YJ, Li X, Hydbring P, et al. The requirement for cyclin D function in tumor maintenance. Cancer Cell. 2012;22:438‐451. [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Freund A, Laberge RM, Demaria M, Campisi J. Lamin B1 loss is a senescence‐associated biomarker. Mol Biol Cell. 2012;23:2066‐2075. [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Ivanov A, Pawlikowski J, Manoharan I, et al. Lysosome‐mediated processing of chromatin in senescence. J Cell Biol. 2013;202:129‐143. [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Hopfner KP, Hornung V. Molecular mechanisms and cellular functions of cGAS‐STING signalling. Nat Rev Mol Cell Biol. 2020;21:501‐521. [DOI] [PubMed] [Google Scholar]
39. Wang L, Yang L, Wang C, et al. Inhibition of the ATM/Chk2 axis promotes cGAS/STING signaling in ARID1A‐deficient tumors. J Clin Invest. 2020;130:5951‐5966. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Shen J, Zhao W, Ju Z, et al. PARPi triggers the STING‐dependent immune response and enhances the therapeutic efficacy of immune checkpoint blockade independent of BRCAness. Cancer Res. 2019;79:311‐319. [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Rauch I, Müller M, Decker T. The regulation of inflammation by interferons and their STATs. Jak‐Stat. 2013;2:e23820. [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Li T, Chen ZJ. The cGAS‐cGAMP‐STING pathway connects DNA damage to inflammation, senescence, and cancer. J Exp Med. 2018;215:1287‐1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Yang H, Wang H, Ren J, Chen Q, Chen ZJ. cGAS is essential for cellular senescence. Proc Natl Acad Sci U S A. 2017;114:E4612‐E4620. [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Fleury H, Malaquin N, Tu V, et al. Exploiting interconnected synthetic lethal interactions between PARP inhibition and cancer cell reversible senescence. Nat Commun. 2019;10:2556. [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Jackson JG, Pant V, Li Q, et al. p53‐mediated senescence impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. Cancer Cell. 2012;21:793‐806. [DOI] [PMC free article] [PubMed] [Google Scholar]
46. Yi J, Liu C, Tao Z, et al. MYC status as a determinant of synergistic response to Olaparib and palbociclib in ovarian cancer. EBioMedicine. 2019;43:225‐237. [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Wetzel CC, Berberich SJ. p53 binds to cisplatin‐damaged DNA. Biochim Biophys Acta. 2001;1517:392‐397. [DOI] [PubMed] [Google Scholar]
48. Deng J, Wang ES, Jenkins RW, et al. CDK4/6 inhibition augments antitumor immunity by enhancing T‐cell activation. Cancer Discov. 2018;8:216‐233. [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Goel S, DeCristo MJ, Watt AC, et al. CDK4/6 inhibition triggers anti‐tumour immunity. Nature. 2017;548:471‐475. [DOI] [PMC free article] [PubMed] [Google Scholar]
50. Herrera‐Abreu MT, Palafox M, Asghar U, et al. Early adaptation and acquired resistance to CDK4/6 inhibition in estrogen receptor‐positive breast cancer. Cancer Res. 2016;76:2301‐2313. [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Bayer AL, Pietruska J, Farrell J, McRee S, Alcaide P, Hinds PW. AKT1 is required for a complete palbociclib‐induced senescence phenotype in BRAF‐V600E‐driven human melanoma. Cancers (Basel). 2022;14:572. [DOI] [PMC free article] [PubMed] [Google Scholar]
52. Hao X, Zhao B, Zhou W, et al. Sensitization of ovarian tumor to immune checkpoint blockade by boosting senescence‐associated secretory phenotype. iScience. 2020;24:102016. [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Chen Q, Sun L, Chen ZJ. Regulation and function of the cGAS‐STING pathway of cytosolic DNA sensing. Nat Immunol. 2016;17:1142‐1149. [DOI] [PubMed] [Google Scholar]
54. Freund A, Patil CK, Campisi J. p38MAPK is a novel DNA damage response‐independent regulator of the senescence‐associated secretory phenotype. EMBO J. 2011;30:1536‐1548. [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Marcus A, Mao AJ, Lensink‐Vasan M, Wang L, Vance RE, Raulet DH. Tumor‐derived cGAMP triggers a STING‐mediated interferon response in non‐tumor cells to activate the NK cell response. Immunity. 2018;49:754‐763.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Freund A, Orjalo AV, Desprez PY, Campisi J. Inflammatory networks during cellular senescence: causes and consequences. Trends Mol Med. 2010;16:238‐246. [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Kuilman T, Peeper DS. Senescence‐messaging secretome: SMS‐ing cellular stress. Nat Rev Cancer. 2009;9:81‐94. [DOI] [PubMed] [Google Scholar]
58. Schmitt CA, Fridman JS, Yang M, et al. A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell. 2002;109:335‐346. [DOI] [PubMed] [Google Scholar]
59. Faget DV, Ren Q, Stewart SA. Unmasking senescence: context‐dependent effects of SASP in cancer. Nat Rev Cancer. 2019;19:439‐453. [DOI] [PubMed] [Google Scholar]
60. Seidel JA, Otsuka A, Kabashima K. Anti‐PD‐1 and anti‐CTLA‐4 therapies in cancer: mechanisms of action, efficacy, and limitations. Front Oncol. 2018;8:86. [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Meng J, Peng J, Feng J, et al. Niraparib exhibits a synergistic anti‐tumor effect with PD‐L1 blockade by inducing an immune response in ovarian cancer. J Transl Med. 2021;19:415. [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Qin G, Wang X, Ye S, et al. NPM1 upregulates the transcription of PD‐L1 and suppresses T cell activity in triple‐negative breast cancer. Nat Commun. 2020;11:1669. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1–S8.

Click here for additional data file.^{(1.8MB, pdf)}

Table S1–S3.

Click here for additional data file.^{(74.2KB, pdf)}

Data Availability Statement

All data relevant to the study are included in the article or uploaded as supplementary information.

[cas15961-bib-0001] 1. Lord CJ, Ashworth A. PARP inhibitors: synthetic lethality in the clinic. Science. 2017;355:1152‐1158. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0002] 2. Hoeijmakers JH. Genome maintenance mechanisms for preventing cancer. Nature. 2001;411:366‐374. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0003] 3. Powell SN, Bindra RS. Targeting the DNA damage response for cancer therapy. DNA Repair (Amst). 2009;8:1153‐1165. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0004] 4. Golan T, Atias D, Stossel C, Raitses‐Gurevich M. Patient‐derived xenograft models of BRCA‐associated pancreatic cancers. Adv Drug Deliv Rev. 2021;171:257‐265. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0005] 5. Audeh MW, Carmichael J, Penson RT, et al. Oral poly(ADP‐ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof‐of‐concept trial. Lancet. 2010;376:245‐251. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0006] 6. Kaufman B, Shapira‐Frommer R, Schmutzler RK, et al. Olaparib monotherapy in patients with advanced cancer and a germline BRCA1/2 mutation. J Clin Oncol. 2015;33:244‐250. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0007] 7. Tutt A, Robson M, Garber JE, et al. Oral poly(ADP‐ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof‐of‐concept trial. Lancet. 2010;376:235‐244. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0008] 8. Alexandrov LB, Nik‐Zainal S, Siu HC, Leung SY, Stratton MR. A mutational signature in gastric cancer suggests therapeutic strategies. Nat Commun. 2015;6:8683. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0009] 9. Konstantinopoulos PA, Ceccaldi R, Shapiro GI, D'Andrea AD. Homologous recombination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov. 2015;5:1137‐1154. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0010] 10. Scott CL, Swisher EM, Kaufmann SH. Poly (ADP‐ribose) polymerase inhibitors: recent advances and future development. J Clin Oncol. 2015;33:1397‐1406. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0011] 11. Wang T, Zhang P, Li C, et al. MUS81 inhibition enhances the anticancer efficacy of Talazoparib by impairing ATR/CHK1 signaling pathway in gastric cancer. Front Oncol. 2022;12:844135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0012] 12. Dréan A, Lord CJ, Ashworth A. PARP inhibitor combination therapy. Crit Rev Oncol Hematol. 2016;108:73‐85. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0013] 13. Li S, Wang L, Wang Y, Zhang C, Hong Z, Han Z. The synthetic lethality of targeting cell cycle checkpoints and PARPs in cancer treatment. J Hematol Oncol. 2022;15:147. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0014] 14. Ledermann J, Harter P, Gourley C, et al. Olaparib maintenance therapy in platinum‐sensitive relapsed ovarian cancer. N Engl J Med. 2012;366:1382‐1392. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0015] 15. Vilgelm AE, Saleh N, Shattuck‐Brandt R, et al. MDM2 antagonists overcome intrinsic resistance to CDK4/6 inhibition by inducing p21. Sci Transl Med. 2019;11:eaav7171. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0016] 16. Liu H, Zhao H, Sun Y. Tumor microenvironment and cellular senescence: understanding therapeutic resistance and harnessing strategies. Semin Cancer Biol. 2022;86:769‐781. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0017] 17. Toso A, Revandkar A, Di Mitri D, et al. Enhancing chemotherapy efficacy in Pten‐deficient prostate tumors by activating the senescence‐associated antitumor immunity. Cell Rep. 2014;9:75‐89. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0018] 18. Wang L, Leite de Oliveira R, Wang C, et al. High‐throughput functional genetic and compound screens identify targets for senescence induction in cancer. Cell Rep. 2017;21:773‐783. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0019] 19. Leite de Oliveira R, Bernards R. Anti‐cancer therapy: senescence is the new black. EMBO J. 2018;37:e99386. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0020] 20. Inaba K, Inaba M, Romani N, et al. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony‐stimulating factor. J Exp Med. 1992;176:1693‐1702. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0021] 21. De Martino M, Tkach M, Bruni S, et al. Blockade of Stat3 oncogene addiction induces cellular senescence and reveals a cell‐nonautonomous activity suitable for cancer immunotherapy. Onco Targets Ther. 2020;9:1715767. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0022] 22. Zhang N, Zhang Y, Qian H, Wu S, Cao L, Sun Y. Selective targeting of ubiquitination and degradation of PARP1 by E3 ubiquitin ligase WWP2 regulates isoproterenol‐induced cardiac remodeling. Cell Death Differ. 2020;27:2605‐2619. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0023] 23. Jenkins LM, Durell SR, Mazur SJ, Appella E. p53 N‐terminal phosphorylation: a defining layer of complex regulation. Carcinogenesis. 2012;33:1441‐1449. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0024] 24. Fang Z, Cao B, Liao JM, et al. SPIN1 promotes tumorigenesis by blocking the uL18 (universal large ribosomal subunit protein 18)‐MDM2‐p53 pathway in human cancer. Elife. 2018;7:e31275. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0025] 25. Li C, Shen Q, Zhang P, et al. Targeting MUS81 promotes the anticancer effect of WEE1 inhibitor and immune checkpoint blocking combination therapy via activating cGAS/STING signaling in gastric cancer cells. J Exp Clin Cancer Res. 2021;40:315. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0026] 26. Huang Y, Zhang J, Hou L, et al. LncRNA AK023391 promotes tumorigenesis and invasion of gastric cancer through activation of the PI3K/Akt signaling pathway. J Exp Clin Cancer Res. 2017;36:194. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0027] 27. Nam HJ, Kim HP, Yoon YK, et al. The irreversible pan‐HER inhibitor PF00299804 alone or combined with gemcitabine has an antitumor effect in biliary tract cancer cell lines. Invest New Drugs. 2012;30:2148‐2160. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0028] 28. An L, Nie P, Chen M, et al. MST4 kinase suppresses gastric tumorigenesis by limiting YAP activation via a non‐canonical pathway. J Exp Med. 2020;217:e20191817. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0029] 29. Cheng W, Li XW, Xiao YQ, Duan SB. Non‐coding RNA‐associated ceRNA networks in a new contrast‐induced acute kidney injury rat model. Mol Ther Nucleic Acids. 2019;17:102‐112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0030] 30. Yi M, Zhang J, Li A, et al. The construction, expression, and enhanced anti‐tumor activity of YM101: a bispecific antibody simultaneously targeting TGF‐β and PD‐L1. J Hematol Oncol. 2021;14:27. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0031] 31. Chen X, Li L, Liu F, Hoh J, Kapron CM, Liu J. Cadmium induces glomerular endothelial cell‐specific expression of complement factor H via the −1635 AP‐1 binding site. J Immunol. 2019;202:1210‐1218. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0032] 32. Glück S, Guey B, Gulen MF, et al. Innate immune sensing of cytosolic chromatin fragments through cGAS promotes senescence. Nat Cell Biol. 2017;19:1061‐1070. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0033] 33. Meng Z, Huang H, Huang D, Zhang F, Mi P. Functional metal‐organic framework‐based nanocarriers for accurate magnetic resonance imaging and effective eradication of breast tumor and lung metastasis. J Colloid Interface Sci. 2021;581:31‐43. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0034] 34. Huang W, Hickson LJ, Eirin A, Kirkland JL, Lerman LO. Cellular senescence: the good, the bad and the unknown. Nat Rev Nephrol. 2022;18:611‐627. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0035] 35. Choi YJ, Li X, Hydbring P, et al. The requirement for cyclin D function in tumor maintenance. Cancer Cell. 2012;22:438‐451. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0036] 36. Freund A, Laberge RM, Demaria M, Campisi J. Lamin B1 loss is a senescence‐associated biomarker. Mol Biol Cell. 2012;23:2066‐2075. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0037] 37. Ivanov A, Pawlikowski J, Manoharan I, et al. Lysosome‐mediated processing of chromatin in senescence. J Cell Biol. 2013;202:129‐143. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0038] 38. Hopfner KP, Hornung V. Molecular mechanisms and cellular functions of cGAS‐STING signalling. Nat Rev Mol Cell Biol. 2020;21:501‐521. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0039] 39. Wang L, Yang L, Wang C, et al. Inhibition of the ATM/Chk2 axis promotes cGAS/STING signaling in ARID1A‐deficient tumors. J Clin Invest. 2020;130:5951‐5966. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0040] 40. Shen J, Zhao W, Ju Z, et al. PARPi triggers the STING‐dependent immune response and enhances the therapeutic efficacy of immune checkpoint blockade independent of BRCAness. Cancer Res. 2019;79:311‐319. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0041] 41. Rauch I, Müller M, Decker T. The regulation of inflammation by interferons and their STATs. Jak‐Stat. 2013;2:e23820. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0042] 42. Li T, Chen ZJ. The cGAS‐cGAMP‐STING pathway connects DNA damage to inflammation, senescence, and cancer. J Exp Med. 2018;215:1287‐1299. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0043] 43. Yang H, Wang H, Ren J, Chen Q, Chen ZJ. cGAS is essential for cellular senescence. Proc Natl Acad Sci U S A. 2017;114:E4612‐E4620. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0044] 44. Fleury H, Malaquin N, Tu V, et al. Exploiting interconnected synthetic lethal interactions between PARP inhibition and cancer cell reversible senescence. Nat Commun. 2019;10:2556. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0045] 45. Jackson JG, Pant V, Li Q, et al. p53‐mediated senescence impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. Cancer Cell. 2012;21:793‐806. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0046] 46. Yi J, Liu C, Tao Z, et al. MYC status as a determinant of synergistic response to Olaparib and palbociclib in ovarian cancer. EBioMedicine. 2019;43:225‐237. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0047] 47. Wetzel CC, Berberich SJ. p53 binds to cisplatin‐damaged DNA. Biochim Biophys Acta. 2001;1517:392‐397. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0048] 48. Deng J, Wang ES, Jenkins RW, et al. CDK4/6 inhibition augments antitumor immunity by enhancing T‐cell activation. Cancer Discov. 2018;8:216‐233. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0049] 49. Goel S, DeCristo MJ, Watt AC, et al. CDK4/6 inhibition triggers anti‐tumour immunity. Nature. 2017;548:471‐475. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0050] 50. Herrera‐Abreu MT, Palafox M, Asghar U, et al. Early adaptation and acquired resistance to CDK4/6 inhibition in estrogen receptor‐positive breast cancer. Cancer Res. 2016;76:2301‐2313. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0051] 51. Bayer AL, Pietruska J, Farrell J, McRee S, Alcaide P, Hinds PW. AKT1 is required for a complete palbociclib‐induced senescence phenotype in BRAF‐V600E‐driven human melanoma. Cancers (Basel). 2022;14:572. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0052] 52. Hao X, Zhao B, Zhou W, et al. Sensitization of ovarian tumor to immune checkpoint blockade by boosting senescence‐associated secretory phenotype. iScience. 2020;24:102016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0053] 53. Chen Q, Sun L, Chen ZJ. Regulation and function of the cGAS‐STING pathway of cytosolic DNA sensing. Nat Immunol. 2016;17:1142‐1149. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0054] 54. Freund A, Patil CK, Campisi J. p38MAPK is a novel DNA damage response‐independent regulator of the senescence‐associated secretory phenotype. EMBO J. 2011;30:1536‐1548. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0055] 55. Marcus A, Mao AJ, Lensink‐Vasan M, Wang L, Vance RE, Raulet DH. Tumor‐derived cGAMP triggers a STING‐mediated interferon response in non‐tumor cells to activate the NK cell response. Immunity. 2018;49:754‐763.e4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0056] 56. Freund A, Orjalo AV, Desprez PY, Campisi J. Inflammatory networks during cellular senescence: causes and consequences. Trends Mol Med. 2010;16:238‐246. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0057] 57. Kuilman T, Peeper DS. Senescence‐messaging secretome: SMS‐ing cellular stress. Nat Rev Cancer. 2009;9:81‐94. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0058] 58. Schmitt CA, Fridman JS, Yang M, et al. A senescence program controlled by p53 and p16INK4a contributes to the outcome of cancer therapy. Cell. 2002;109:335‐346. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0059] 59. Faget DV, Ren Q, Stewart SA. Unmasking senescence: context‐dependent effects of SASP in cancer. Nat Rev Cancer. 2019;19:439‐453. [DOI] [PubMed] [Google Scholar]

[cas15961-bib-0060] 60. Seidel JA, Otsuka A, Kabashima K. Anti‐PD‐1 and anti‐CTLA‐4 therapies in cancer: mechanisms of action, efficacy, and limitations. Front Oncol. 2018;8:86. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0061] 61. Meng J, Peng J, Feng J, et al. Niraparib exhibits a synergistic anti‐tumor effect with PD‐L1 blockade by inducing an immune response in ovarian cancer. J Transl Med. 2021;19:415. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cas15961-bib-0062] 62. Qin G, Wang X, Ye S, et al. NPM1 upregulates the transcription of PD‐L1 and suppresses T cell activity in triple‐negative breast cancer. Nat Commun. 2020;11:1669. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Combination of PARP inhibitor and CDK4/6 inhibitor modulates cGAS/STING‐dependent therapy‐induced senescence and provides “one‐two punch” opportunity with anti‐PD‐L1 therapy in colorectal cancer

Tao Wang

Weizhen Liu

Qian Shen

Ruikang Tao

Chengguo Li

Qian Shen

Yao Lin

Yongzhou Huang

Lei Yang

Gengchen Xie

Jie Bai

Ruidong Li

Lulu Wang

Kaixiong Tao

Yuping Yin

Abstract

Abbreviations

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1. Cell lines and culture

2.2. T cell activation and proliferation assays

2.3. Small interfering RNA transfection

2.4. Plasmid construction and transfection

2.5. Lentivirus infection

2.6. RNA extraction and qRT‐PCR

2.7. MTS assay

2.8. Cell cycle and apoptosis analysis

2.9. Clonogenic assay

2.10. Western blot analysis and immunoprecipitation

2.11. β‐Galactosidase staining

2.12. RNA sequencing

2.13. Enzyme‐linked immunosorbent assay

2.14. Immunofluorescence

2.15. In vivo assays

2.16. Immunohistochemistry (IHC)

2.17. Bioluminescence imaging to monitor tumor

2.18. Flow cytometry and cell sorting

2.19. Statistical analysis

3. RESULTS

3.1. PARPi talazoparib activates the cellular senescence signaling pathway in colorectal cancer

FIGURE 1.

3.2. Talazoparib facilitates the binding of PARP1 to p53 and inhibits proteasome‐associated p53 degradation

FIGURE 2.

3.3. Talazoparib combined with palbociclib inhibits tumor proliferation by stimulating tumor senescence in vitro and in vivo

FIGURE 3.

3.4. Dual PARP and CDK4/6 inhibition induces cytoplasmic chromatin fragment (CCF) production and activates innate immunity in colorectal cancer cells

FIGURE 4.

3.5. Type I IFN response and SASP induced by the combination of talazoparib and palbociclib relies on cGAS

FIGURE 5.

3.6. αPD‐L1 in combination with talazoparib and palbociclib achieves lasting tumor regression in immunocompetent mice

FIGURE 6.

FIGURE 7.

FIGURE 8.

4. DISCUSSION

AUTHOR CONTRIBUTIONS

FUNDING INFORMATION

CONFLICT OF INTEREST STATEMENT

ETHICS STATEMENT

Supporting information

ACKNOWLEDGMENTS

Contributor Information

DATA AVAILABILITY STATEMENT

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases