Skip to main content
NCBI home page
Journal of Genetic Engineering & Biotechnology logoLink to Journal of Genetic Engineering & Biotechnology
. 2023 Nov 10;21:110. doi: 10.1186/s43141-023-00567-w

Comparative analysis of physiological traits and gene expression patterns in nitrogen deficiency among barley cultivars

Zohreh Hajibarat 1, Abbas Saidi 1,✉, Habibollah Ghazvini 2, Zahra Hajibarat 1
PMCID: PMC10638351  PMID: 37947941

Abstract

Background

Nitrogen is one of the most important mineral nutrients for plants and is absorbed by the root system mainly in the inorganic form (NH+4 and NO−3). Plants absorb nitrogen as a food source for growth, biomass production, and development. Nitrogen is mainly absorbed as nitrate, which is the most common source of nitrogen available to higher plants. One of the unique features of nitrate transport is that NO−3 is both a substrate for transport and an inducer of NO−3 transport systems in genes and at physiological levels.

Methods

In the present study, morphological and physiological traits (chlorophyll a/b, total chlorophyll, and carotenoid, antioxidant enzymes, and protein content), correlation between traits and gene expression, and principle component analysis of traits among five barley cultivars were measured in response to nitrogen deficiency (ND). The starved plants were transferred to a nutrient solution containing 0.2 mM and 2 mM NO−3 up to 7 and 14 days after ND application and non-stressed conditions, respectively.

Results

Gene expression analysis revealed that the 10 HvNRT2 genes were induced in the leaf and root tissues at 7 and 14 days after ND treatments in five barley cultivars. Expression of NRT2 genes by relative quantitative qRT-PCR analysis for 10 HvNRT2 genes were determined. Based on the gene expression, HvNRT2.1, HvNRT2.2, and HvNRT2.4 were strongly induced by NO−3, peaking at 7 and 14 days after ND treatment. In contrast, the HvNRT2.4 showed only moderate induction in both leaves and roots. From our results, the Reyhan cultivar showed a significant increase in root fresh weight (RFW), protein content, and antioxidant enzyme activity in roots at 7 and 14 days after ND treatment as compared to the non-stressed condition. A highly positive correlation was observed between root catalase (CATr) and HvNRT2.2/2.5/2.6 leaves.

Conclusion

The expression of HvNRT2.4 is increased during long-term nitrogen starvation, while the expression of HvNRT2.1 and HvNRT2.2 are transiently increased by ND. Based on physiological and morphological traits and molecular mechanisms, the Reyhan is considered a tolerant cultivar under ND condition.

Keywords: Barley, Nitrogen deficiency, Nitrate transporter genes, Physiological traits

Background

Nitrogen plays an essential role in the regulation of several biological processes such as carbon metabolism, amino acid metabolism, and protein synthesis. Nitrogen starvation affects several major physiological and biological processes that affect growth and development [1], root architecture [2], lignin content [3], anthocyanin, phosphorus, potassium content [4], chlorophyll synthesis [5], and CO2 uptake in plants [6]. Nitrogen (N) is an essential plant growth nutrient whose coordinated distribution from source to sink organs is crucial for seed development and overall crop yield. Barley, Hordeum vulgar, is one of the most important staple food grains from the Poaceae family. However, grain yield is limited by a number of stresses. Among these stresses, insufficient use of nitrogen is the most important.

Selection of tolerant cultivars to abiotic stress has become one of the main goals of adaptation. In previous reports, the response, adaptation, genotype differences, and molecular mechanisms under LN stress have been comprehensively studied in such plants as Arabidopsis [7], rice [8], maize [9], and wheat [10]. Among the different forms of nitrogen, nitrate (NO−3) is the main absorbed form in most agricultural soils and is preferentially absorbed by most cereals except paddy rice, where the ammonium form (NH+4) is preferred [11]. One of the most important consequences of abiotic stress is the imbalance between the production of reactive oxygen species (ROS) and antioxidant defense systems (AOX), which can lead to cell loss and cell death. Catalase (CAT), peroxidase (POD), and ascorbate peroxidase (APX) are considered as the main antioxidant enzymes to inhibit ROS, and the inhibition ability is related to the activity of antioxidant enzymes in plants [12]. Nitrate is often limited in availability in most agricultural soils with significant temporal and spatial fluctuations. As sessile organisms, plants must be able to rapidly adapt to these changing soil nitrate concentrations to optimize nitrogen uptake. In order to increase the ability of plants to absorb N fertilizer, it is important to understand the processes by which plants acquire nitrate and how to regulate this process [13, 14]. Most plants have two types of nitrate uptake systems with associated transporter genes. Low-affinity transport system (LATS) when nitrate availability is > 0.5 mM and high-affinity transport system (HATS) when external nitrate availability is < 0.5 mM [15]. Depending on the external NO−3 concentration, low-affinity transport systems (LATS) and high-affinity transport systems (HATS) affect NO−3 uptake in plants under non-stressed conditions [16, 17]. When nitrate enters the plant, it is assimilated into amino acids in a series of reactions facilitated by a known set of enzymes, although when sufficient nitrate is available, it can be temporarily stored in vacuoles before absorption. Nitrogen compounds formed during uptake are stored in source tissues (e.g., leaves in cereals) during vegetative growth and then transferred to sink during the reproductive stage (e.g., seed development in cereals) in a process called nitrogen remobilization. The NRT2 gene family, belonging to HATS, was shown to play an important role in NO−3 uptake from soil under nitrogen-limited conditions [18]. However, the temporal transcriptional expression patterns of NRT1 and NRT2 gene families and their effects on nitrogen uptake in wheat have been unclear for a long time. Nevertheless, it is clear that the NO3 transport capabilities of most NRT2 proteins in plants require the involvement of a chaperone protein, NAR2, as part of a two-component high-affinity NO3 uptake system [19, 20]. Nitrogen use efficiency (NUE) is a complex trait that involves several molecular, biochemical, and physiological processes [21]. Improved NUE often results in increased aboveground biomass, seed yield, protein content, and overall economic performance [22].

The AtNRT2.1 is a component of the high-affinity nitrate uptake system that functions as a nitrate sensor or signal transducer downstream of the actual sensor, independent of its role in nitrate uptake [23]. The OsNRT2.1 and OsNRT2.2 are expressed in all root cell types with stronger activity in the epidermis in rice, and OsNRT2.3 expression is detectable in the root and lateral root [24, 25]. The expression of OsNRT2.4 is limited in the lateral root region and to a lesser extent in the companion cells of the crown root. A pervious study showed that osnrt2.4 mutants show defects in lateral root length and number under both high and low nitrate regimes [26]. It was found that different cultivars tolerant to low N showed significant differences in N metabolism enzyme activity, dry matter weight, etc., which should be considered in further research [27]. Therefore, in the present study, we investigated the effects of ND on chlorophyll content, protein content, dry and wet weights of roots and leaves, antioxidant enzymes, and the expression of transporter genes of barley cultivars with different ND tolerance. We compared high and low N use efficiency (NUE) barley cultivars.

Methods

Ten (10) seeds of five barley cultivars were germinated on wet Whatman filter papers in Petri dishes. Seven- to 10-day-old seedlings, seedlings with a uniform growth state, were moved to 10-L containers. The plants were treated with a modified Hoagland nutrient solution [28] 2 mmol/L NH4NO−3, 0.4 mmol/L MgSO4, 0.3, mmol/L K2SO4, 0.2 mmol/L KH2PO4, 0.4 mmol/L CaCl2, 0.19 μmol/L CuSO4, 46.9 μmol/L H3BO3, 4.5 μmol/L MnCl2, 1 μmol/ L Na2MoO4, 0.38 μmol/L ZnSO4, and 19.9 μmol/L Fe (III) EDTA. The pH of the solution was adjusted to 5.8 with NaOH. The two N treatments included 0.2 mmol/L NH4NO−3 (ND) and 2 mmol/L NH4NO−3 (as non-stressed) conditions [29]. After 7 and 14 days of ND treatments, plant height (PH), leaf dry weight (LDW), root dry weight (RDW), leaf fresh weight (LFW), root fresh weight (RFW), and root lengths (RL) were recorded. Plants with uniform growth status were subsequently harvested as replicates, separated into roots and shoots, and dried in the oven at 72 °C for 3 days to obtain RDW and LDW.

Characterization of physiological indices

To investigate physiological traits, ND and non-stressed treatments were applied to 7- to 10-day-old seedlings. Samples from non-stressed and stressed barley leaves and root were collected at 7 and 14 days after ND application. The fresh leaf samples were washed by distilled water in the laboratory. Then, they were left to dry at room temperature (18 °C) to be analyzed for the determination of chlorophylls (Cha and Chb) and carotenoid contents. Accurately weighted 0.5 g of fresh plant leaf and root samples were taken and homogenized in tissue homogenizer with 10 ml of acetone extracting solvent. The homogenized samples were centrifuged at 12,000 rpm for 15 min at 4 °C. The supernatant was separated and 1 ml of it was mixed with 4 ml of the acetone solvent. The solution mixture was analyzed for Chlorophyll-a, Chlorophyll-b, and carotenoid contents in a spectrophotometer. The activity of antioxidant enzymes, including polyphenol oxidase (PPO), catalase (CAT), and peroxidase (POD), was measured using the spectrophotometric method (BIORAD, SmartspecTM plus-USA) according to Kar and Mishra method [30].

Protein extraction

To analyze protein content, ND and non-stressed treatments were applied to 7- to 10-day-old seedlings. Samples from non-stressed and stressed barley leaves were collected at 7 and 14 days after ND application. Preparation of protein and enzyme extract were carried out following the method [31]. In brief, fresh leaves (0.5 g) were ground to a fine powder in liquid nitrogen using a pre-chilled mortar and pestle and then extracted in 3 mL of 0.2 M potassium phosphate buffer, pH 7.0, containing 0.1 mM ethylenediaminetetraacetic acid (EDTA). The extract was centrifuged for 20 min at 13,000 rpm and 4 °C, and the supernatant was used for protein activity assay. The total protein content for all samples was determined by the method of Bradford [32] using bovine serum albumin as a standard.

RNA extraction and expression pattern of nitrate transporter genes

For the preparation of RNA obtained from leaf and root tissues, samples were collected separately from barley seedlings under ND stress and non-stressed conditions. Sampling was done at 7 and 14 days after ND treatment. Total RNA was extracted from nitrogen-deficient and non-stressed leaves and roots using the RNX-Plus kit (Sinaclone) according to the manufacturer’s instructions. The purity and concentration of RNA were determined by NanoDrop and its quality was confirmed using 1% agarose gel analysis. Then, the cDNA synthesis was performed according to the instructions of the cDNA synthesis kit. Three repetitions were performed to analyze each gene, where the actin gene was used as a reference gene. All primers used in the gene expression analysis were designed using the Oligo program (Table 1). Gene expression was performed with a real-time instrument using Cybergreen as described in the manufacturer’s instructions. For the relative expression of genes through 2−∆∆CT after normalization, the value of Ct for nitrate transporter genes was determined using actin as a reference gene. The qRT-PCR analysis was performed to determine the expression profile of HvNRT2.1, HvNRT2.2, HvNRT2.3, HvNRT2.4, HvNRT2.5, HvNRT2.6, HvNRT2.8, HvNRT2.9, and HvNRT2.11 genes using leaf and root tissues under non-stressed and ND treatments. Results are discussed in relation to distinct roles for individual NRT2 family members. The SPSS software was used for expression analysis, physiological, and morphological traits. The TBtools was utilized to draw the heatmap which was used to display the differential expression of genes and the correlation between the physiological traits and gene expression. Statistical analyses were performed using SPSS version 20.0 statistical software. The significant variations between means were compared at P < 0.05 (Duncan’s test). Statistical graphs were generated using GraphPad Prism version 9 software and the statistical significance was defined at P < 0.05.

Table 1.

The primer sequences of HvNRT2 gene used in this study

Primer name Primer sequence
HvNRT2.1F GCTCCGCATGTTGATGTTTA
HvNRT2.1R TGACGTTGCCGTTTGACTTA
HvNRT2.2F TCATCTGTCTGCAGGAATCG
HvNRT2.2R CCACATGTAACTGCGCGTAT
HvNRT2.3F CATATCGCAGGCCAAAAGTT
HvNRT2.3R CCTTATACGTGCTGGGGTGT
HvNRT2.4F CCAGCACGTATGAGACTGGA
HvNRT2.4R ACGCCTTATTACAGCCGATG
HvNRT2.5F TGGACCGAGGAGGAGCGT
HvNRT2.5R GGAGCTCTTCGGACCTCACAC
HvNRT2.6F CATGCACGCTGCCCGTCGCT
HvNRT2.6R GTCTCATACGTGCTGGGGCG
HvNRT2.7F AGTACTACGGTGCCGAGTGG
HvNRT2.7R GTTTGGTGGGCTGGTAGGTA
HvNRT2.8F GACCGAGGAGGACTACTACGC
HvNRT2.8R CGTGTACGGTAGGGAAGTAG
HvNRT2.9F TCCATGCTCCTCCCACCCA
HvNRT2.9R CGTGTACGGTAGGGAAGTAG
HvNRT2.11F CTGCATCAGGGCTTACCTTC
HvNRT2.11R CGGAGGGAGTAGGTTGGTAAA
HvActin F GGTCCATCCTAGCCTCACTC
HvActin R GATAACAGCAGTGGAGCGCT
Open in a new tab

Results

Among the morphological traits measured at 7 and 14 days after applying ND, only the Mahtab cultivar showed a significant decrease in LDW at 7 days after ND application. On the other hand, the Mahtab cultivars showed a significant decrease in RDW at 7 days after ND application, but Bahrokh revealed a significant increase in RDW at 7 days after ND application. The RFW was significantly decreased in the Mahtab cultivar at 7 days after ND application as compared to the non-stressed condition whereas, the RFW was significantly increased in the Reyhan cultivar at 14 days after ND application as compared to the non-stressed condition. No significant differences were observed in the leaf fresh weight, plant height, and root length at 7 and 14 days after ND application (Table 2).

Table 2.

Comparison of means for morphological traits measured (RDW, LDW, and RFW) in five barley cultivars

Cultivars Treatments RDW LDW RFW
Behrokh S7 28a 23.6 abcdef 174.5 abcd
Behrokh N7 14.7bcdefg 20.3 bcdef 133.2 bcdefg
Behrokh S14 12.5b 25.7 ab 23.3 cdef
Behrokh N14 15.4b 23.95 ab 15.1 ef
Reyhan S7 12.25defg 18.95 bcdef 103.75 cdefg
Reyhan N7 11.85defg 20.6 bcdef 124 bcdefg
Reyhan S14 17.2b 29.5 ab 71.5ab
Reyhan N14 13.6b 39.55a 16.4 ef
Mehr S7 9.25efg 16.35cdef 95.2defg
Mehr N7 16.65bcdef 17.05bcdef 134.8bcd
Mehr S14 10.85b 32.43ab 10.35f
Mehr N14 12.7b 17.6b 10.3f
Fajr S7 7.75 fg 13.75ef 78.5efg
Fajr N7 8.6efg 16.55cdef 152.4abcdef
Fajr S14 11b 18.4b 65.1abc
Fajr N14 19.16b 32.1ab 75.25a
Mahtab S7 7.05g 12.45f 51g
Mahtab N7 23abc 27.45abc 176abcd
Mahtab S14 8.8b 29ab 10.85f
Mahtab N14 14.55b 27.05ab 15.2ef
Open in a new tab

Protein content

Based on protein content measured at 7 and 14 days after ND application, the Behrokh and Mahtab cultivars did not show any significant differences from non-stressed condition. In the Reyhan cultivar, the protein content was significantly increased at 7 and 14 days after ND application as compared to non-stressed condition. However, the protein content was only significantly increased in the Mehr cultivar at 14 days after applying ND as compared to non-stressed condition. On the other hand, the protein content was significantly decreased in the Fajr cultivar at 14 days after applying ND as compared to non-stressed condition (Fig. 1a).

Fig. 1.

Fig. 1

Open in a new tab

The effects of ND on five barley cultivars for protein content (a), total chlorophyll (b), carotenoid (c) chlorophyll b (d), and chlorophyll a (e) at 7 and 14 days after ND application. Values represent the means of three replications per treatment. Different letters demonstrate significant differences between treatments (P < 0.05, Duncan’s Multiple Range Test). NC7, 7 days after ND; NC14, 14 days after ND

Total chlorophyll content

Based on the total chlorophyll content, the Mahtab and Behrokh cultivars did not show any significant differences from non-stressed condition at 7 and 14 days after ND application. The Reyhan cultivar only showed a significant decrease in total chlorophyll content at 7 days after ND application. Further, as compared to non-stressed condition, the Mehr cultivar showed a significant decrease for total chlorophyll at 7 days and a significant increase at 14 days after ND application. The Fajr cultivar showed a significant increase in total chlorophyll content at 7 days, while it did not show any significant differences from non-stressed condition at 14 days after ND application (Fig. 1b).

Carotenoids content

The Bahrokh and Reyhan cultivars showed no significant differences for carotenoid content at both time points of 7 and 14 days after ND application. The Fajr and Mehr cultivars showed no significant difference at 7 days after ND application; however, a significant decrease at 14 days after ND application was observed. The Mahtab revealed a significant increase both at 7 and 14 days after ND application (Fig. 1c).

Chlorophyll b

Based on the content of chlorophyll b, the cultivars Bahrokh, Reyhan, and Mahtab did not show any significant differences as compared to non-stressed condition at 7 and 14 days after ND application. The Mehr cultivar showed no significant difference in chlorophyll b at 7 days after ND application but a significant increase at 14 days after ND application was observed. Compared to non-stressed condition, chlorophyll b was significantly reduced in the Fajr cultivar at 7 days after ND application; however, no significant difference from non-stressed condition was observed at 14 days after ND application (Fig. 1d).

Chlorophyll a

Based on the content of chlorophyll a, the Mahtab and Fajr cultivars showed no significant differences as compared to non-stressed condition for both time points of 7 and 14 days after ND application. A significant decrease in chlorophyll a was observed at 7 days after ND application, while no significant difference from non-stressed condition was observed at 14 days after ND application in the Reyhan. The Mehr cultivar showed no significant difference at 7 days after ND application; however, a significant increase from non-stressed condition was observed at 14 days after ND application. The Behrokh revealed no significant difference at 7 days after ND application, but a significant decrease was observed at 14 days after ND application (Fig. 1e).

Antioxidant enzymes’ content in leaves

APX enzymes in the leaves

APX enzymes in the leaves of the Mahtab cultivar were significantly increased as compared to non-stressed condition at both 7 and 14 days after ND application. A significant decrease was observed in the Behrokh and Mehr cultivars at 7 and 14 days after applying ND. At 7 days after applying ND, a significant increase in APX enzymes was observed in the Reyhan cultivar as compared to non-stressed condition. However, at 14 days after applying ND, no significant difference from non-stressed condition was observed. In the Fajr cultivar, a significant increase, as compared to non-stressed condition, was shown at 14 days after applying ND, but no significant difference was observed at 7 days after applying ND (Fig. 2a).

Fig. 2.

Fig. 2

Open in a new tab

The effects of ND on APX (a), CAT (b), and POD (c) antioxidative enzyme activities in the leaves of barley cultivars under different concentrations. The error bars (mean ± SE) followed by various letters are statistically significant (P < 0.05, Duncan’s Multiple Range Test). Significant differences between the two concentrations are marked with different letters. NC7, 7 days after ND; NC14, 14 days after ND

Catalase enzyme in leaves

In the Bahrokh and Mahtab cultivars, the amount of catalase enzyme did not show any significant differences at 7 and 14 days after applying ND when compared with non-stressed condition. A significant decrease from non-stressed condition was observed in the Mehr cultivar at two-time points of 7 and 14 days after applying ND. In the Fajr cultivar, catalase enzyme showed a significant decrease at 7 days after applying ND as compared to non-stressed condition, but at 14 days after applying ND, it showed a significant increase as compared to non-stressed condition. In the Reyahn cultivar, a significant increase as compared to non-stressed condition was observed at 7 days after ND application. But at 14 days after applying ND, no significant difference was observed in the content of catalase enzyme from non-stressed condition (Fig. 2b).

POD enzyme in leaves

In the Bahrokh cultivar, POD enzyme content was significantly increased as compared to non-stressed condition at 7 days after ND application. But at 14 days after ND was applied, a significant decrease in POD enzyme content was observed as compared to non-stressed condition. In the Reyhan and Mahtab cultivars, a significant increase in POD enzyme content compared to non-stressed condition was observed at 7 and 14 days after ND application. A significant decrease was observed in the Mehr at 7 and 14 days after ND application as compared to non-stressed condition. In the Fajr cultivar, a significant increase in POD content as compared to non-stressed condition was observed at 7 days after ND application. However, at 14 days after applying ND, no significant difference from non-stressed condition was observed (Fig. 2c).

Antioxidant enzymes’ content in the root

APX enzymes in the root

In the Mahtab, Mehr, and Reyhan cultivars, a significant increase in the content of APX enzyme in the roots, as compared to non-stressed condition, was observed at 7 and 14 days after the application of ND. In the Behrokh cultivar, a significant increase as compared to non-stressed condition was observed at 7 days after ND application. However, at 14 days after applying ND, a significant decrease in the APX enzyme was observed as compared to non-stressed condition. In the Fajr cultivar, no significant difference from non-stressed condition was observed at 7 days after applying ND, but at 14 days after ND application, a significant increase was observed (Fig. 3a).

Fig. 3.

Fig. 3

Open in a new tab

The effects of ND on APX (a), CAT (b), POD (c), and antioxidant enzyme activities in the root of barley cultivars under different concentrations. The error bars (mean ± SE) followed by various letters are statistically significant (P < 0.05, Duncan’s Multiple Range Test). Significant differences between the two concentrations are marked with different letters. NC7, 7 days after ND; NC14, 14 days after ND

CAT enzymes in the root

The catalase content in the roots of Mehr and Mahtab cultivars was not significantly different from non-stressed condition at 7 and 14 days after ND application. In the Fajr and Bahrokh cultivars, a significant increase as compared to non-stressed condition was observed at 7 days after applying ND, but no significant difference was observed at 14 days after ND application. A significant increase as compared to non-stressed condition was observed in the Reyhan cultivar at 7 and 14 days after ND application (Fig. 3b).

POD enzymes in the root

The POD content in the roots of the Mahtab cultivar was observed to be significantly reduced from non-stressed condition at 7 and 14 days after ND application. In the Fajr cultivar, there was a significant increase in POD enzymes as compared to non-stressed condition at 7 days after applying ND. However, at 14 days after ND application, no significant difference from non-stressed condition was observed. A significant increase as compared to non-stressed condition was observed in the Reyhan cultivar at 7 and 14 days after ND application. In the Bahrokh cultivar, a significant increase in the content of POD enzyme in the roots as compared to non-stressed condition was observed at 7 days after ND application. But at 14 days after ND application, no significant difference from non-stressed condition was observed. In the Mehr cultivar, there was a significant decrease as compared to non-stressed condition at 7 days after applying ND. However, at 14 days after ND application, no significant difference in POD enzymes in the root, as compared to non-stressed condition, was observed (Fig. 3b).

Gene expression in leaf

The Reyhan cultivar did not show any significant differences at both two-time points of 7 and 14 days after ND application, except HvNRT2.1, HvNRT2.5, and HvNRT2.6 genes (Fig. 4a). In the Mehr cultivar, the HvNRT2.2, HvNRT2.3, HvNRT2.5, and HvNRT2.7 genes were more significantly expressed at 7 days after ND application as compared to non-stressed condition. The HvNRT2.1 and HvNRT2.4 genes showed higher significant expressions at 14 days after applying ND as compared to non-stressed condition (Fig. 4b). In the Mahtab cultivar, the HvNRT2.2, HvNRT2.8, and HvNRT2.11 genes showed higher significant expressions at 7 days as compared to non-stressed condition. On the other hand, the HvNRT2.1, HvNRT2.3, HvNRT2.4, HvNRT2.5, HvNRT2.7, and HvNRT2.9 genes were more significantly expressed as compared to non-stressed condition at 14 days after ND application (Fig. 4c). In the Fajr cultivar, the expression of HvNRT2.7 and HvNRT2.8 genes were significantly increased at 7 days after applying ND as compared to non-stressed condition. However, the HvNRT2.1, HvNRT2.5, HvNRT2.6, HvNRT2.9, and HvNRT2.11 genes showed higher significant expressions at 14 days after applying ND as compared to non-stressed condition (Fig. 4d). In the Behrokh cultivar, the HvNRT2.3, HvNRT2.6, and HvNRT2.9 genes showed higher significant expressions at 7 days after ND application as compared to non-stressed condition. Whereas, HvNRT2.7 and HvNRT2.11 exhibited higher significant expressions at 14 days after applying ND as compared to non-stressed condition (Fig. 4e).

Fig. 4.

Fig. 4

Open in a new tab

The qRT-PCR expressions of HvNRT2.1, HvNRT2.2, HvNRT2.3, HvNRT2.4, HvNRT2.5, HvNRT2.6, HvNRT2.7, HvNRT2.8, HvNRT2.9, and HvNRT2.11 genes in leaf in five barley cultivars (Reyhan, Mehr, Mahtab, Fajr, and Behrokh) under ND conditions. Error bars represent the means ± SD taken from three independent biological replicates. NC7; 7 days after ND and NC14; 14 days after ND. Different lower case letters above columns indicate significant differences at the P < 0.05 between the non-stressed and ND conditions in the leaf. Duncan’s test was used to compare the treatment means at P < 0.05

Gene expression in root

In the Reyhan cultivar, the HvNRT2.1, HvNRT2.3, HvNRT2.7, HvNRT2.8, and HvNRT2.11 genes showed a significant increase in expressions at 7 days after applying ND as compared to non-stressed condition. The HvNRT2.4 and HvNRT2.5 gene showed a significant increase at 14 days after applying ND as compared to non-stressed condition (Fig. 5a). In the Mehr cultivar, the expression of HvNRT2.2 and HvNRT2.3 were significantly increased at 7 days after ND application as compared to non-stressed condition, whereas, a significant increase in expressions of HvNRT2.1, HvNRT2.4, HvNRT2.5, and HvNRT2.9 were observed at 14 days after applying ND as compared to non-stressed condition (Fig. 5b). In the Mahtab cultivar, the HvNRT 2.3, HvNRT2.5, and HvNRT2.6 genes were significantly increased in expressions at 7 days after applying ND as compared to non-stressed condition. However, the expression of HvNRT2.7, HvNRT2.8, and HvNRT2.11 genes were significantly increased as compared to non-stressed condition (Fig. 5c). In the Fajr cultivar, the HvNRT2.4, HvNRT2.5, HvNRT2.6, and HvNRT2.8 were significantly increased at7 days after ND application, as compared to non-stressed condition. At 14 days after ND application, the HvNRT2.1, HvNRT2.2, HvNRT2.3, and HvNRT2.9 genes were significantly increased as compared to non-stressed condition (Fig. 5d). In the Behrokh cultivar, the HvNRT2.3 and HvNRT2.4 genes were significantly increased in expression at 7 days after ND application as compared to non-stressed condition (Fig. 5e).

Fig. 5.

Fig. 5

Open in a new tab

The qRT-PCR expressions of HvNRT2.1, HvNRT2.2, HvNRT2.3, HvNRT2.4, HvNRT2.5, HvNRT2.6, HvNRT2.7, HvNRT2.8, HvNRT2.9, and HvNRT2.11 genes in leaves of five barley cultivars (Reyhan, Mehr, Mahtab, Fajr, and Behrokh) under ND condition. Error bars represent the means ± SD taken from three independent biological replicates. NC7; 7 days after ND and NC14; 14 days after ND. Different lower case letters above columns indicate significant differences at the P < 0.05 between the non-stressed and ND condition in root. Duncan’s test was used to compare the treatment means at P < 0.05

Principle component analysis

The diversity of genotypes for morphological and physiological traits was evaluated using the bi-plot graphic display, and the cultivars were evaluated according to their principal component scores (PCA). The Reyhan, Fajr, and Behrokh cultivars are located on the upper right side of the graph and are considered as tolerant cultivars. The Mahtab and Mehr cultivars are located on the left bottom of the diagram and are considered as sensitive and semi-sensitive cultivars (Fig. 6).

Fig. 6.

Fig. 6

Open in a new tab

The principle component analysis of physiological and morphological traits among five barley cultivars under ND condition

Correlation between measured traits and HvNRT2 gene expression at 7 days after ND application

Investigating the correlation between traits and gene expression in roots and leaves at 7 days after applying ND showed that the HvNRT2.8r has a positive and significant correlation with carotenoid and HvNRT2.2r. Root dry weight had a positive and significant correlation with leaf dry weight. The HvNRT2.8r had a positive and significant correlation with HvNRT2.7l. There was a positive correlation between HvNRT2.7l and HvNRT2.7r. The HvNRT2.4r showed a positive and significant correlation with HvNRT2.5r, and HvNRT2.2r had a positive and significant correlation with HvNRT2.11r, HvNRT2.4l, HvNRT2.3r, and HvNRT2.3l. The HvNRT2.5l had a positive and significant correlation with HvNRT2.11l, HvNRT2.2l, HvNRT2.11r, HvNRT2.4l, HvNRT2.9r, HvNRT2.9l, HvNRT2.3r, and HvNRT2.3l.

A positive and significant correlation was observed between HvNRT2.11l and HvNRT2.2l, HvNRT2.11r, HvNRT2.4l, HvNRT2.9r, HvNRT2.9l, HvNRT2.3r, and HvNRT2.3l. The HvNRT2.2l had a positive and significant correlation with HvNRT2.11r, HvNRT2.4l, and HvNRT2.3r. A positively significant correlation between HvNRT2.11r and HvNRT2.4l, HvNRT2.3r, and HvNRT2.3l were observed. The HvNRT2.4l had a positive and significant correlation with HvNRT2.3r and HvNRT2.3l. A positive and significant correlation between HvNRT2.9r and HvNRT2.3l and between HvNRT2.9l and HvNRT2.3r and HvNRT2.3l were observed. The HvNRT2.3r had a positive and significant correlation with HvNRT2.3l.

The HvNRT2.1l had a positive and significant correlation with CATl, whereas PODl and HvNRT2.1r had a positive and significant correlation with CATl. The APXr had a positive and significant correlation with PODr, Cha, Chb, and TCH. The PODr had a positive and significant correlation with Cha, Chb, and TCH. A positive and significant correlation between Cha and Chb and TCH was observed. The correlation between Chb and TCH was significantly positive. A positive and significant correlation between HvNRT2.6r and HvNRT2.6l was seen (Fig. 7a).

Fig. 7.

Fig. 7

Open in a new tab

The correlation coefficients of physiological and morphological traits and gene expression at 7 (a) and 14 (b) days after ND application. Protein content (PC); plant height (PH); leaf dry weight (LDW); leaf fresh weight (LFW); root fresh weight (RFW); root dry weight (RDW); HvNRT2r (root HvNRT2); and HvNRT2l (leaf HvNRT2)

Correlation between measured traits and gene expression at 14 days after ND

Investigating the correlation between traits and gene expression in roots and leaves at 14 days after applying ND showed that HvNRT2.1r has a positive and significant correlation with HvNRT2.9r, HvNRT2.2l, HvNRT2.2r, HvNRT2.1l, HvNRT2.3r, and HvNRT2.6r. The HvNRT2.9r had a positive and significant correlation with HvNRT2.6l, HvNRT2.2l, HvNRT2.2r, HvNRT2.1l, HvNRT2.6r, and HvNRT2.6l. A positive and significant correlation between HvNRT2.2l and HvNRT2.2r, HvNRT2.1l, HvNRT2.6r, HvNRT2.6l, and CATr were seen. The HvNRT2.2r showed a positive and significant correlation with HvNRT2.1l and HvNRT2.6l. A positive and significant correlation was seen between HvNRT2.1l and PC. The correlation between HvNRT2.3r and HvNRT2.6r was positively significant.

The HvNRT2.6r showed a positive and significant correlation with HvNRT2.5r. A positively significant correlation between HvNRT2.5l and HvNRT2.6l and CATr was observed. On the other hand, a negative and significant correlation between the HvNRT2.5l and Cha, Chb, TCH, and PH were observed. The carotenoid showed a positive and significant correlation with HvNRT2.6l and CATr. The correlation between HvNRT2.6l and CATr was positive, whereas the HvNRT2.4r revealed a positive and significant correlation with HvNRT2.7r. The Cha showed a positive and significant correlation with Chb and TCH. The Chb showed a significantly positive correlation with TCH. A positive correlation was observed between PH with PODr and between PODl with CATl, HvNRT2.11r, APXl, and PODr. Also, a positive correlation was observed between CATl and HvNRT2.11r, APXl, and PODr revealed. A positive correlation between HvNRT2.11r and APXl and PODr was observed. The APXl and PODr positively correlated. A positive correlation between HvNRT2.3l with HvNRT2.4l and HvNRT2.11l and between HvNRT2.4l and HvNRT2.5r and HvNRT2.11l were observed. The HvNRT2.8l showed a positive correlation with HvNRT2.5r and HvNRT2.11l and HvNRT2.5r revealed a positive correlation with HvNRT2.11l. A negative correlation was revealed between HvNRT2.11r with HvNRT2.7l. A positive correlation between CATr and HvNRT2.2l, HvNRT2.5l, carotenoid, and HvNRT2.6l were observed (Fig. 7b).

Discussion

Nitrate is the main form of nitrogen utilized by most plants, acting both as an important nutrient and as a signal molecule involved in the metabolism, growth, development, and adaptation of plants to various stresses. In the present study, among the five cultivars (Reyhan, Behrokh, Fajr, Mehr, Mahtab), the Reyahn revealed higher values for root fresh weight (RFW), protein content, and antioxidant enzyme activity in root at two-time points of 7 and 14 days after ND as compared to non-stressed condition. Based on our results, the protein content only was significantly increased in the Reyhan cultivar at 7 and 14 days after applying ND, indicating that Reyhan had a high nitrogen use efficiency (NUE). Thus, the Reyhan cultivar can enhance protein content under ND and maintain nitrogen as a source for growth, biomass production, and seed yield. Based on the analysis of the expression of nitrate transporter genes among barley cultivars at 7 and 14 days after applying ND, the expression of HvNRT2.1 and HvNRT2.4 genes were also significantly increased in the Reyhan. Under nitrogen-limited conditions, the NRT2 family plays a key role in acquiring NO−3 from the soil. The NRT2 include CmNRT2.1 in chrysanthemum [33], TaNRT2.1 in wheat [34, 35], and OsNRT2.1, OsNRT2.2, and their partner protein OsNAR2.1 in rice which play key roles in root NO−3 influx as main factors of HATS [24-1]. The HvNRT2.1 and HvNRT2.4 were strongly induced by NO−3 peaking at 7 and 14 days. Previous studies have shown that NRT2.1 under ND treatment can be a useful indicator to evaluate plant tolerance or sensitivity to ND [15]. Expression analysis of several NRT2 genes in response to nitrate indicates that ZmNRT2.1 and ZmNRT2.2 are the main genes controlling high-affinity nitrate uptake in maize [36]. At ND, the HvNRT2.1, HvNRT2.2, and HvNRT2.4 genes had key roles in NO−3uptake and shoot and root growth. These findings have helped to detect candidate genes in response to ND. The contribution of HvNRT2.1 and HvNRT2.4 genes were required for optimal adaptation to N limitation in plants.

Breeding programs provide a possibility to improve the crop in predicted climatic conditions (for example, abiotic stress). In addition to morphological traits, other traits related to morphological such as physiological and biochemical traits play important roles in the selection of elite parents. Principal component analysis is a useful tool for screening tolerant genotypes [37]. Morphological traits can be used to identify superior parents to be utilized for germplasm introduction and classification [38, 39]. The results of principal components analysis and cluster analysis showed that the tolerant and sensitive cultivars were divided into separate groups with a similar pattern under ND. Thus, cultivars such as Reyhan and Fajr are considered as tolerant cultivars in response to nitrate stresses.

Chlorophyll degradation is closely related to reactive oxygen species (ROS). In the sensitive cultivar, Mahtab, chlorophyll content was decreased under ND conditions as compared to non-stressed. On the other hand, in the tolerant Reyhan cultivar, the chlorophyll content was higher under ND stress as compared to non-stress condition. Previous study has shown significant decreases in chlorophyll content in both sensitive and tolerant cultivars at 20d of low nitrogen [40]. Chlorophyll content decreased significantly under ND in creeping bentgrass [41]. Based on physiological traits, an increase in enzyme activity (CAT and APX activity) was observed, which contributes to the increase in AOX activity, especially in plants subjected to ND condition [42]. Plants can develop effective defense mechanisms against oxidative damage by inducing antioxidant enzymes [43, 44]. The CAT and POD are important antioxidant enzymes, playing important roles in minimizing the adverse effects of ROS.

Our results showed that under ND condition, the CAT, APX, and POD were increased in root and then in leaf, suggesting that enzyme activities are more active in the roots as compared in the leaves. According to Liao et al. [45], most enzyme antioxidants are more active in roots than in leaves [45]. Protein content is one of the main regulators of the osmotic potential of the cell. The presence of high protein content helps to maintain the osmotic potential of plant cells and their resistance against damage caused by stress [45, 46]. Our findings showed that RFW, protein content, and antioxidant enzymes were increased under ND condition, indicating the appropriate response of Reyhan to this stress. Previous studies have shown that appropriate N fertilization could increase antioxidant enzymes and physiological traits, improving plant tolerance in response to ND. Therefore, this promoted the accumulation of plant dry matter [47, 48].

Based on the data from five barely cultivars and correlation analysis, we found that the modifications of LDW had close relationships with the RDW and RFW, demonstrating that the root and shoot development could also be considered as useful indicators for the evaluation of plant ND response. In our study, Reyhan possessed higher RFW than other cultivars. Reyhan revealed a significant increase in antioxidant enzymes and protein content in leaves. In our finding, correlation analysis revealed that antioxidant enzymes and morphological and physiological traits at jointing were positively correlated under ND. It provides evidence for increasing tolerance by improving morphological and physiological stages.

Increasing the activity of antioxidant enzymes such as CAT and POD during stress is a defense mechanism in plants against free radicals, where the production of hydrogen peroxide is hindered and, as a result, prevents the degradation of plant proteins [49, 50]. Pervious study has shown that ND decreases CAT and POD activity in rice [51]. Some studies have shown that antioxidant enzyme was increased in response to ND in wheat (Triticum aestivum) leaves and (Coffea arabica) leaves under ND [52, 53]. Our findings revealed that the APX, POD, and CAT in the Rehyan’s root cultivar were increased significantly at 7 and 14 days after ND application. The Rehyan had a higher capacity to decompose H2O2 under ND condition. The Rehyan cultivar had a higher ability to remove H2O2 under a longer period of ND condition. Overall, our findings revealed that the tolerant genotype has a greater capacity than the sensitive genotype to remove H2O2 in shoots and roots under ND conditions. It has been reported that CAT activities were significantly increased in wheat leaves under low nitrogen [52]. As a result, ND led to oxidative damage in both cultivars, which was confirmed by increased activity of antioxidant enzymes and protein content. However, accessions suffered greater increases in leaf APX, root APX, root CAT, and root POD. The results enriched our understanding of antioxidant enzyme activity under ND condition, which will contribute to future research on revealing the molecular mechanisms associated with plant growth and survival under ND.

Conclusion

In this study, five cultivars were screened in response to 7 and 14 days of ND application using morpho-physiological traits and gene expression of nitrate transporter genes. In conclusion, under ND, the HvNRT2.1, HvNRT2.2, and HvNRT2.4 genes were induced in the leaf and root. Based on physiological traits, antioxidant enzymes and protein content were increased in response to ND in the Reyhan cultivar. Based on correlation between traits, there was a positive correlation between antioxidant enzyme in root and leaf HvNRT2.2, leaf HvNRT2.5, leaf HvNRT2.6, and carotenoid, indicating that the root had an important role under ND condition. The results of the principal components analysis showed that the tolerant and sensitive cultivars were placed in a group with almost similar patterns under ND condition. Further, cultivars such as Reyhan are considered as ND tolerant. Based on this, at 7 and 14 days after ND application, an increase in enzyme activity (POD, CAT, and APX) were observed, playing a significant role in antioxidant activity, especially in plants under ND condition. Therefore, the physiological and molecular mechanisms of HvNRT2.4, HvNRT2.1, and HvNRT2.2 genes involved in NO−3 absorption and distribution, as well as adaptation to stress environments, such as ND, are worth further research. This study provides a basis for improving nitrogen application in different ND-tolerant cultivars and improving ND-tolerant cultivars in Iran.

Acknowledgements

The authors are thankful to the Department of Plant Sciences and Biotechnology, Faculty of Life Sciences and Biotechnology, Shahid Beheshti University, Tehran, Iran, for receiving the necessary help for this project work

Abbreviations

CAT

Catalase

POD

Peroxidase

APX

Ascorbate peroxidase

AOX

Antioxidant defense systems

ROS

Reactive oxygen species

Authors’ contributions

AS, HGH, and ZH carried out literature search and designing and editing of the manuscript. ZH, AS, and ZH wrote and drew all the figures of the manuscript. AS, HGH, and ZH authors contributed to the final manuscript. All authors have read and approved the manuscript.

Availability of data and materials

Not applicable

Declarations

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Yan M, Fan X, Feng H, Miller AJ, Shen Q, Xu G. Rice OsNAR2. 1 interacts with OsNRT2. 1, OsNRT2. 2 and OsNRT2. 3a nitrate transporters to provide uptake over high and low concentration ranges. Plant Cell Environ. 2011;34(8):1360–1372. doi: 10.1111/j.1365-3040.2011.02335.x. [DOI] [PubMed] [Google Scholar]
  • 2.Zhang D, Pan X, Mu G, Wang J. Toxic effects of antimony on photosystem II of Synechocysti ssp. as probed by in vivo chlorophyll fluorescence. J Appl Phycol. 2010;22:479–488. doi: 10.1007/s10811-009-9482-1. [DOI] [Google Scholar]
  • 3.Peng H, Zhao R, Smith R, Simko I. Phenotypic and genetic analyses of yellow spot malady in lettuce. Sci Hortic. 2022;305:111389. doi: 10.1016/j.scienta.2022.111389. [DOI] [Google Scholar]
  • 4.Simko I. Genetic variation in response to N, P, or K deprivation in baby leaf lettuce. Horticulturae. 2020;6:15. doi: 10.3390/HORTICULTURAE6010015. [DOI] [Google Scholar]
  • 5.Tantray AY, Hazzazi Y, Ahmad A. Physiological, agronomical, and proteomic studies reveal crucial players in rice nitrogen use efficiency under low nitrogen supply. Int J Mol Sci. 2022;23(12):6410. doi: 10.3390/ijms23126410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Jin X, Li W, Hu D, Shi X, Zhang X, Zhang F, Fu Z, Ding D, Liu Z, Tang J. Biological responses and proteomic changes in maize seedlings under nitrogen deficiency. Plant Mol Biol Rep. 2015;33:490–504. doi: 10.1007/s11105-014-0762-9. [DOI] [Google Scholar]
  • 7.Fichtner F, Lunn JE. The role of trehalose 6-phosphate (Tre6P) in plant metabolism and development. Annu Rev Plant Biol. 2021;17(72):737–760. doi: 10.1146/annurev-arplant-050718-095929. [DOI] [PubMed] [Google Scholar]
  • 8.Nuccio ML, Wu J, Mowers R, Zhou HP, Meghji M, Primavesi LF, Paul MJ, Chen X, Gao Y, Haque E, Basu SS. Expression of trehalose-6-phosphate phosphatase in maize ears improves yield in well-watered and drought conditions. Nat Biotechnol. 2015;33(8):862–869. doi: 10.1038/nbt.3277. [DOI] [PubMed] [Google Scholar]
  • 9.Sengupta A, Chakraborty M, Saha J, Gupta B, Gupta K (2016) Polyamines: osmoprotectants in plant abiotic stress adaptation. Osmolytes and plants acclimation to changing environment: Emerging omics technologies: 97-127.
  • 10.Khajuria A, Sharma N, Bhardwaj R, Ohri P. Emerging role of polyamines in plant stress tolerance. Curr Protein Pept Sci. 2018;19(11):1114–1123. doi: 10.2174/1389203719666180718124211. [DOI] [PubMed] [Google Scholar]
  • 11.Guo J, Jia Y, Chen H, Zhang L, Yang J, Zhang J, Hu X, Ye X, Li Y, Zhou Y. Growth, photosynthesis, and nutrient uptake in wheat are affected by differences in nitrogen levels and forms and potassium supply. Sci Rep. 2019;9(1):1–2. doi: 10.1038/s41598-018-37838-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu HW, Lu Y, Tong SY, Song FB. Lipid peroxidation, antioxidant enzyme activity and osmotic adjustment changes in husk leaves of maize in black soils region of Northeast China. Afr J Agric Res. 2011;4(6):3098–3102. [Google Scholar]
  • 13.Szulc P, Bocianowski J. Effects of application of different nitrogen fertilizer forms and magnesium on dynamics of dry matter accumulation in two maize (Zea mays L.) hybrids in their early growth stages. Pol J Agron. 2012;11:65–80. [Google Scholar]
  • 14.Subedi KD, Ma BL. Nitrogen uptake and partitioning in stay-green and leafy maize hybrids. Crop Sci. 2005;45:740–747. doi: 10.2135/cropsci2005.0740. [DOI] [Google Scholar]
  • 15.Wang X. Managing land carrying capacity: key to achieving sustainable production systems for food security. Land. 2022;11:484. doi: 10.3390/land11040484. [DOI] [Google Scholar]
  • 16.Fageria N, Baligar V. Enhancing nitrogen use efficiency in crop plants. Adv Agron. 2005;88:97–185. doi: 10.1016/S0065-2113(05)88004-6. [DOI] [Google Scholar]
  • 17.Du X, Wang Z, Lei W, Kong L. Increased planting density combined with reduced nitrogen rate to achieve high yield in maize. Sci Rep. 2021;11:358. doi: 10.1038/s41598-020-79633-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bonelli LE, Andrade FH. Maize radiation use-efficiency response to optimally distributed foliar-nitrogen-content depends on canopy leaf-area index. Field Crops Res. 2020;247:107557. doi: 10.1016/j.fcr.2019.107557. [DOI] [Google Scholar]
  • 19.Ciampitti IA, Vyn T. A comprehensive study of plant density consequences on nitrogen uptake dynamics of maize plants from vegetative to reproductive stages. Field Crops Res. 2011;121:2–18. doi: 10.1016/j.fcr.2010.10.009. [DOI] [Google Scholar]
  • 20.Jamal Z, Hamayun M, Ahmad N, Chaudhary MF. Effects of soil and foliar application of different concentrations of NPK and foliar application of (NH4 )2SO4 on different yield parameters in wheat. J Agron. 2006;5:251–256. doi: 10.3923/ja.2006.251.256. [DOI] [Google Scholar]
  • 21.Hawkesford MJ. Genetic variation in traits for nitrogen use efficiency in wheat. J Exp Bot. 2017;68(10):2627–2632. doi: 10.1093/jxb/erx079. [DOI] [PubMed] [Google Scholar]
  • 22.McAllister CH, Beatty PH, Good AG. Engineering nitrogen use efficient crop plants: the current status. Plant Biotechnol J. 2012;10(9):1011–1025. doi: 10.1111/j.1467-7652.2012.00700.x. [DOI] [PubMed] [Google Scholar]
  • 23.Little DY, Rao H, Oliva S, Daniel-Vedele F, Krapp A, Malamy JE. The putative high-affinity nitrate transporter NRT2. 1 represses lateral root initiation in response to nutritional cues. Proc Natl Acad Sci. 2005;102(38):13693–13698. doi: 10.1073/pnas.0504219102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lin SH, Kuo HF, Canivenc G, Lin CS, Lepetit M, Hsu PK, Tillard P, Lin HL, Wang YY, Tsai CB, Gojon A (2008) Mutation of the Arabidopsis NRT1. 5 nitrate transporter causes defective root-to-shoot nitrate transport. Plant Cell 20(9):2514-28 [DOI] [PMC free article] [PubMed]
  • 25.Tang Z, Fan X, Li Q, Feng H, Miller AJ, Shen Q, Xu G. Knockdown of a rice stellar nitrate transporter alters long-distance translocation but not root influx. Plant Physiol. 2012;160(4):2052–2063. doi: 10.1104/pp.112.204461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wei J, Zheng Y, Feng H, Qu H, Fan X, Yamaji N, Ma JF, Xu G. OsNRT2. 4 encodes a dual-affinity nitrate transporter and functions in nitrate-regulated root growth and nitrate distribution in rice. J Exp Bot. 2018;69(5):1095–1107. doi: 10.1093/jxb/erx486. [DOI] [PubMed] [Google Scholar]
  • 27.Sun C, Wang R, Tang G, Cai S, Shi H, Liu F, Xie H, Zhu J, Xiong Q (2023) Integrated 16S and metabolomics revealed the mechanism of drought resistance and nitrogen uptake in rice at the heading stage under different nitrogen levels. Front Plant Sci 14:1120584 [DOI] [PMC free article] [PubMed]
  • 28.Han Y, Yin S, Huang L, Wu X, Zeng J, Liu X, Qiu L, Munns R, Chen ZH, Zhang G. A sodium transporter HvHKT1; 1 confers salt tolerance in barley via regulating tissue and cell ion homeostasis. Plant Cell Physiol. 2018;59(10):1976–1989. doi: 10.1093/pcp/pcy116. [DOI] [PubMed] [Google Scholar]
  • 29.Karunarathne SD, Han Y, Zhang XQ, Zhou G, Hill CB, Chen K, Angessa T, Li C. Genome-wide association study and identification of candidate genes for nitrogen use efficiency in barley (Hordeum vulgare L.) Front Plant Sci. 2020;11:571912. doi: 10.3389/fpls.2020.571912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kar M, Mishra D. Catalase, peroxidase, and polyphenol oxidase activities during rice leaf senescence. Plant Physiol. 1976;57(2):315–319. doi: 10.1104/pp.57.2.315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chang CJ, Kao CH. H2O2 metabolism during senescence of rice leaves: changes in enzyme activities in light and darkness. Plant Growth Regul. 1998;25:11. doi: 10.1023/A:1005903403926. [DOI] [Google Scholar]
  • 32.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 33.Gu C, Song A, Zhang X, Wang H, Li T, Chen Y, Jiang J, Chen F, Chen S. Cloning of chrysanthemum high-affinity nitrate transporter family (CmNRT2) and characterization of CmNRT2. 1. Sci Rep. 2016;6(1):1–9. doi: 10.1038/srep23462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Taulemesse F, Le Gouis J, Gouache D, Gibon Y, Allard V. Post-flowering nitrate uptake in wheat is controlled by N status at flowering, with a putative major role of root nitrate transporter NRT2. 1. PLoS One. 2015;10(3):e0120291. doi: 10.1371/journal.pone.0120291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wang M, Zhang P, Liu Q, Li G, Di D, Xia G, Kronzucker HJ, Fang S, Chu J, Shi W. TaANR1-TaBG1 and TaWabi5-TaNRT2s/NARs link ABA metabolism and nitrate acquisition in wheat roots. Plant Physiol. 2020;182(3):1440–1453. doi: 10.1104/pp.19.01482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Garnett T, Conn V, Plett D, Conn S, Zanghellini J, Mackenzie N, Enju A, Francis K, Holtham L, Roessner U, Boughton B. The response of the maize nitrate transport system to nitrogen demand and supply across the lifecycle. New Phytol. 2013;198(1):82–94. doi: 10.1111/nph.12166. [DOI] [PubMed] [Google Scholar]
  • 37.Karimi HR, Zamani Z, Ebadi A, Fatahi MR. Morphological diversity of Pistacia species in Iran. Genet Resour Crop Evol. 2009;56:561–571. doi: 10.1007/s10722-008-9386-y. [DOI] [Google Scholar]
  • 38.Saidi A, Hajibarat Z, Hajibarat Z. Identification of responsive genes and analysis of genes with bacterial-inducible cis-regulatory elements in the promoter regions in Oryza sativa L. Acta Agri Slov. 2020;116(1):115–123. [Google Scholar]
  • 39.Karunarathne SD, Han Y, Zhang XQ, Dang VH, Angessa TT, Li C. Using chlorate as an analogue to nitrate to identify candidate genes for nitrogen use efficiency in barley. Mol Breed. 2021;41:1. doi: 10.1007/s11032-021-01239-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Yao Y (2018). Growth, physiological and molecular mechanisms of low nitrogen stress tolerance in perennial ryegrass”. Open Access Theses. 1482. https://docs.lib.purdue.edu/open_access_theses/1482
  • 41.Li ZG, Yuan SR, Jia HY, Gao FY, Zhou M, Yuan N, Wu PP, Hu Q, Sun DF, Luo H. Ectopic expression of a cyanobacterial flavodoxin in creeping bentgrass impacts plant development and confers broad abiotic stress tolerance. Plant Biotech J. 2017;15:433–446. doi: 10.1111/pbi.12638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Ghaderi N, Hatami MR, Mozafari A, Siosehmardeh A. Change in antioxidant enzymes activity and some morpho-physiological characteristics of strawberry under long-term salt stress. Physiol Mol Biol Plants. 2018;24:833–843. doi: 10.1007/s12298-018-0535-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Weisany W, Sohrabi Y, Heidari G, Siosemardeh A, Ghassemi-Golezani K. Changes in antioxidant enzymes activity and plant performance by salinity stress and zinc application in soybean (‘Glycine max’L.) Plant Omics. 2012;5(2):60–67. [Google Scholar]
  • 44.Quan X, Zeng J, Chen G, Zhang G. Transcriptomic analysis reveals adaptive strategies to chronic low nitrogen in Tibetan wild barley. BMC Plant Biol. 2019;19:1–2. doi: 10.1186/s12870-019-1668-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Liao L, Dong T, Qiu X, Rong Y, Sun G, Wang Z, Zhu J. Antioxidant enzyme activity and growth responses of Huangguogan citrus cultivar to nitrogen supplementation. Biosci Biotechnol Biochem. 2019;83(10):1924–1936. doi: 10.1080/09168451.2019.1634513. [DOI] [PubMed] [Google Scholar]
  • 46.Lei J, Hong Y. Prometryne-induced oxidative stress and impact on antioxidant enzymes in wheat. Ecotoxicol Environ Saf. 2009;72:1687–1693. doi: 10.1016/j.ecoenv.2009.04.025. [DOI] [PubMed] [Google Scholar]
  • 47.Lamptey S, Li L, Xie J, Zhang R, Yeboah S, Antille DL. Photosynthetic response of maize to nitrogen fertilization in the semiarid western loess plateau of China. Crop Sci. 2017;57(5):2739–2752. doi: 10.2135/cropsci2016.12.1021. [DOI] [Google Scholar]
  • 48.Acciaresi HA, Tambussi EA, Antonietta M, Zuluaga MS, Andrade FH, Guiamét JJ. Carbon assimilation, leaf area dynamics, and grain yield in contemporary earlier-and later-senescing maize hybrids. Eur J Agron. 2014;1(59):29–38. doi: 10.1016/j.eja.2014.05.007. [DOI] [Google Scholar]
  • 49.Ariano S, Bartolomeo D, Cristos X, Andras M. Antioxidant defences in Olive trees during drought stress: changes in activity of some antioxidant enzymes. Funct Plant Biol. 2005;32:45–53. doi: 10.1071/FP04003. [DOI] [PubMed] [Google Scholar]
  • 50.Shah JM, Bukhari SA, Zeng JB, Quan XY, Ali E, Muhammad N, Zhang GP. Nitrogen (N) metabolism related enzyme activities, cell ultrastructure and nutrient contents as affected by N level and barley genotype. J Integr Agric. 2017;16(1):190–198. doi: 10.1016/S2095-3119(15)61308-9. [DOI] [Google Scholar]
  • 51.Huang ZA, Jiang DA, Yang Y, Sun JW, Jin SH. Effects of nitrogen deficiency on gas exchange, quantum yield, and antioxidant enzymes in leaves of rice plants. Photosynthetic. 2004;42(3):357–364. doi: 10.1023/B:PHOT.0000046153.08935.4c. [DOI] [Google Scholar]
  • 52.Polesskaya OG, Kashirina EI, Alekhina ND. Changes in the activity of antioxidant enzymes in wheat leaves and roots as a function of nitrogen source and supply. Russ J Plant Physiol. 2004;51:615–620. doi: 10.1023/B:RUPP.0000040746.66725.77. [DOI] [Google Scholar]
  • 53.Ramalho JC, Campos PS, Teixeira M, Nunes MA. Nitrogen dependent changes in antioxidant system and in fatty acid composition of chloroplast membranes from Coffea arabica L. plants submitted to high irradiance. Plant Sci. 1998;135:115–124. doi: 10.1016/S0168-9452(98)00073-9. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable

Articles from Journal of Genetic Engineering & Biotechnology are provided here courtesy of Academy of Scientific Research and Technology, Egypt

RESOURCES