Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of mouse primers
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Tubulin (Tuba1a) | ctggaacccacggtcatc | gtggccacgagcatagttatt |
| VE-Cadherin (Cdh5) | gttgccacatctcagggaat | ccttcctccagctgtcactc |
| Claudin-5 (Cldn5) | cgggtgagcattcagtcttt | gtcacgatgttgtggtccag |
| Tie2 (Tek) | ccctcctcaaccagaaaaca | tctaggcccttgagctggta |
| p21 (Cdkn1a) | ttgccagcagaataaaaggtg | tttgctcctgtgcggaac |
