Skip to main content
Microbiology Resource Announcements logoLink to Microbiology Resource Announcements
. 2023 Oct 6;12(11):e00621-23. doi: 10.1128/MRA.00621-23

A rabies-related lyssavirus from a Nycticeinops schlieffeni bat with neurological signs, South Africa

Natalie Viljoen 1,2, Arshad Ismail 3,4,5, Jacqueline Weyer 1,2,6, Wanda Markotter 1,
Editor: Jelle Matthijnssens7
PMCID: PMC10652934  PMID: 37800932

ABSTRACT

We report the coding-complete sequence of a lyssavirus, provisionally designated Phala bat lyssavirus (PBLV), characterized using a metagenomics approach. PBLV was identified in a Nycticeinops schlieffeni bat that exhibited neurological signs and died within 24 hours of admission to a wildlife rehabilitation center in Phalaborwa, South Africa.

KEYWORDS: Lyssavirus, rabies, South Africa, bat, surveillance, neurological

ANNOUNCEMENT

Bats are considered to be important hosts for viruses that belong to the genus Lyssavirus, subfamily Alpharhabdovirinae, family Rhaboviridae (1, 2). As part of a disease ecology of zoonotic pathogens in bats study, a bat collected in Phalaborwa, South Africa (coordinates: −23.943190 and 31.128990; laboratory number: UP14561) that displayed neurological signs and died on 7 September 2021 within 24 hours of admission to a wildlife rehabilitation center was submitted for investigation. Brain material from a Nycticeinops schlieffeni bat, confirmed by DNA barcoding (CytB, COI, and 12S rRNA genes) (3 7), was homogenized, and nucleic acids were extracted using the NucleoMag VET RNA/DNA kit (Macherey-Nagel). A lyssavirus quantitative reverse-transcriptase PCR (8) with modifications to the probe (Table 1) was positive and was confirmed by partial nucleoprotein gene amplification (9). Double-stranded complementary DNA was prepared from total RNA using Superscript IV (Thermo Fisher Scientific) and random hexamer primers (Integrated DNA Technologies) followed by degradation of the RNA strand using 10U RNase H (Ambion) and second-strand synthesis using 5U Klenow 3′−5′ Exo-minus DNA polymerase (Thermo Fisher Scientific) (10) in a single step. DNA was purified using the MinElute PCR purification kit (Qiagen) and quantified using a Qubit fluorometer (Thermo Fisher Scientific). Paired-end libraries (2 × 150 bp) were prepared using the Nextera DNA flex preparation kit (Illumina) according to the manufacturer’s instructions, and sequencing was performed on 30-ng cDNA on a NextSeq 2000 instrument (Illumina).

TABLE 1.

Primers and probes used for amplification and sequencing

Application Primer/probe name Primer/probe sequence (5′−3′) a : Position on reference Reference
Cytochrome B barcoding PCR LGL 765 GAAAAACCAYCGTTGTWATTCAACT 14,710–14,734 b (3)
LGL 766 GTTTAATTAGAATYTYAGCTTTGGG 15,989–16,014 b (4)
12S rRNA barcoding PCR 12SU1230M2-CH GCACTGAAAATGCYTAGATG 607–625 b (5)
12SL2226M1 CAGTAYGCTTACCTTGTTACGAC 1,559–1,581 b (6)
Cytochrome C oxidase subunit I gene barcoding PCR LCO1490 GGTCAACAAATCATAAAGATATTGG 5,931–5,950 b (7)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 6,609–6,634 b
Lyssavirus partial NP RT-PCR d lys001 ACGCTTAACGAMAAA 1–15 c (9)
550B GTRCTCCARTTAGCRCACAT 647–666 c
Lyssavirus screening qRT-PCR 541lys CACMGSNAAYTAYAARACNAA 541–561 c (9)
550B GTRCTCCARTTAGCRCACAT 647–666 c (9)
620lyssaC 6-Carboxyfluorescein (FAM)–CAYCAYACHYTVATGACHACHCAYAA–nonfluorescent quencher (QSY) 620–645 c Modified to include degenerate bases to allow the detection of more diverse lyssaviruses (8)
Lyssavirus complete NP PCR lys001 ACGCTTAACGAMAAA 1–15 c (9)
304 TTGACAAAGATCTTGCTCAT 1,514–1,533 c
Lyssavirus complete GP PCR Lyssa Glyco F TGGTGYATNAAYATRAAYTC 3,000–3,019 c (11)
Lyssa Glyco R GGRGARTTNARRTTRTARTC 5,520–5,539 c
Lyssavirus NP sequencing primers lys001 ACGCTTAACGAMAAA 1–15 c (9)
550B GTRCTCCARTTAGCRCACAT 647–666 c
304 TTGACAAAGATCTTGCTCAT 1,514–1,533 c
Lyssavirus GP sequencing primers Lyssa Glyco F TGGTGYATNAAYATRAAYTC 3,000–3,019 c (11)
Sequencing GF1 GAYCCNAGRTAYGARGARTC 3,687–3,706 c
Sequencing GF2 ATNCCNGARATGCARTC 4,491–4,507 c
Sequencing GF3 CWTCNTGGGARTYNTAYAA 4,849–4,867 c
Lyssa Glyco R GGRGARTTNARRTTRTARTC 5,520–5,539 c
End verification Adapt5 ACACTCTTTCCCTACACGACGC Not applicable In-house
nLys5 GGGTCTAGCTTGGCGGC
Adapt3 TGACTGGAGTTCAGACGTGTGC
nLys3 GCTTGAGTCTGTCCTCCCACTG
a

Degenerate bases are indicated using the IUPAC nucleotide code (R = A/G, Y = C/T, S = G/C, W = A/T, K = G/T, M = A/C, B = C/G/T, D = A/G/T, H = A/C/T, V = A/C/G, N = A/C/G/T).

b

Position on human mitochondrial DNA (GenBank accession number: NC012920.1).

c

Position on Pasteur virus (GenBank accession number: M13215.1).

d

GP, glycoprotein; NP, nucleoprotein; RT-PCR, reverse-transcriptase PCR; qRT-PCR, quantitative reverse-transcriptase PCR.

A total of 87.73 million reads with an average read length of 140 bp was obtained. FASTQ files were uploaded to the Galaxy Web platform, and data were analyzed using the server at http://usegalaxy.eu (12). All tools were run for paired-end reads using default parameters unless otherwise noted. FASTQ data sets were quality assessed using FastQC v.0.11.9 (13); reads were quality trimmed (qualified quality Phred score of 20) using fastp v.0.32.2 (14); de novo assembly was performed using Megahit v.1.2.9 (15); and contigs were classified using megablast v.2.10.1 (16). A single contig, 12,156 nt in length, was classified as being similar to lyssaviruses and had a nucleotide identity of 73.14% with Lyssavirus hamburg [host species: Eptesicus serotinus (serotine bat); GenBank accession number: NC009527.1 available at https://www.ncbi.nlm.nih.gov/nuccore/NC_009527] determined using Clustal Omega (17). The 5′ and 3′ ends were verified by amplification of adaptor-ligated DNA fragments using adaptor- and virus-specific primers followed by Sanger sequencing (Table 1), which resolved two misassemblies. Genome annotation was performed using BLASTn and BLASTp (18), and the genome organization was consistent with that of lyssaviruses (Fig. 1). Reads were mapped on the draft genome using Bowtie2 v.2.4.5 (19); duplicate reads were removed and the average sequencing depth was determined, which exceeded 2,600× across the genome, using the SAMtools suite v.1.15.1 (20). The genome was 11,978 nt in length (43.41% GC); however, end verification data suggested that the ends may be longer because, despite repeated attempts, we did not manage to sequence into the adaptors and report the coding-complete genome. At the time of submission, virus isolation attempts had been unsuccessful.

Fig 1.

Fig 1

Schematic of PBLV genome organization.

ACKNOWLEDGMENTS

Funding was available from the South African Research Chair Initiative (held by W.M.) of the Department of Science and Innovation and was administered by the National Research Foundation of South Africa (grant number: 98339) and operational funding utilized for NGS (held by J.W.). Postdoctoral fellowship funding provided by the University of Pretoria (UP), under the UP Co-Funding Postdoctoral Fellowship Programme, is acknowledged (N.V.).

Contributor Information

Wanda Markotter, Email: wanda.markotter@up.ac.za.

Jelle Matthijnssens, Katholieke Universiteit Leuven, Leuven, Belgium .

DATA AVAILABILITY

The phala bat Lyssavirus sequence has been deposited in GenBank under the accession number OQ970171. The version described in this paper is the first version. Raw reads were deposited in the NCBI Sequence Read Archive available at PRJNA971078 under the accession numbers PRJNA971078 (BioProject) and SAMN35019052 (BioSample). The sequence data used for bat identification have been deposited in GenBank under the accession numbers OR096071 (12s rRNA gene) OR091287 (COI gene) and OR105696 (Cytb gene)

ETHICS APPROVAL

Ethics approval was obtained from the University of Pretoria (ethics approvals EC054-14, 458/2019, and 17/2023), and research approval (Section 20 research approval 12/11/1/1/8) was obtained from the Department of Agriculture, Land Reform and Rural Development, South Africa.

REFERENCES

  • 1. Walker PJ, Bigarré L, Kurath G, Dacheux L, Pallandre L. 2022. Revised taxonomy of rhabdoviruses infecting fish and marine mammals. Animals (Basel) 12:1363. doi: 10.3390/ani12111363 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Fooks AR, Shipley R, Markotter W, Tordo N, Freuling CM, Müller T, McElhinney LM, Banyard AC, Rupprecht CE. 2021. Renewed public health threat from emerging Lyssaviruses. Viruses 13:1769. doi: 10.3390/v13091769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Bickham JW, Wood CC, Patton JC. 1995. Biogeographic implications of cytochrome b sequences and allozymes in sockeye (oncorhynchus nerka). J Hered 86:140–144. doi: 10.1093/oxfordjournals.jhered.a111544 [DOI] [PubMed] [Google Scholar]
  • 4. Bickham JW, Patton JC, Schlitter DA, Rautenbach IL, Honeycutt RL. 2004. Molecular phylogenetics, karyotypic diversity, and partition of the genus myotis (chiroptera: vespertilionidae). Mol Phylogenet Evol 33:333–338. doi: 10.1016/j.ympev.2004.06.012 [DOI] [PubMed] [Google Scholar]
  • 5. Hassanin A, Colombo R, Gembu G-C, Merle M, Tu VT, Görföl T, Akawa PM, Csorba G, Kearney T, Monadjem A, Ing RK. 2018. Multilocus phylogeny and species delimitation within the genusGlauconycteris(Chiroptera, Vespertilionidae), with the description of a new bat species from the Tshopo Province of the Democratic Republic of the Congo. J Zool Syst Evol Res 56:1–22. doi: 10.1111/jzs.12176 [DOI] [Google Scholar]
  • 6. Hassanin A, Delsuc F, Ropiquet A, Hammer C, Jansen van Vuuren B, Matthee C, Ruiz-Garcia M, Catzeflis F, Areskoug V, Nguyen TT, Couloux A. 2012. Pattern and timing of diversification of cetartiodactyla. C R Biol 335:32–50. doi: 10.1016/j.crvi.2011.11.002 [DOI] [PubMed] [Google Scholar]
  • 7. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299. [PubMed] [Google Scholar]
  • 8. Coertse J, Weyer J, Nel LH, Markotter W. 2010. Improved PCR methods for detection of African rabies and rabies-related lyssaviruses. J Clin Microbiol 48:3949–3955. doi: 10.1128/JCM.01256-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Markotter W, Kuzmin I, Rupprecht CE, Randles J, Sabeta CT, Wandeler AI, Nel LH. 2006. Isolation of lagos bat virus from water mongoose. Emerg Infect Dis 12:1913–1918. doi: 10.3201/eid1212.060514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Chen G, Qiu Y, Zhuang Q, Wang S, Wang T, Chen J, Wang K. 2018. Next-generation sequencing library preparation method for identification of RNA viruses on the ion torrent sequencing platform. Virus Genes 54:536–542. doi: 10.1007/s11262-018-1568-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Coertse J, Viljoen N, Weyer J, Markotter W. 2023. Comparative neutralization activity of commercial rabies immunoglobulin against diverse lyssaviruses. Vaccines (Basel) 11:1255. doi: 10.3390/vaccines11071255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Afgan E, Nekrutenko A, Grüning BA, Blankenberg D, Goecks J, Schatz MC, Ostrovsky AE, Mahmoud A, Lonie AJ, Syme A, Fouilloux A, Bretaudeau A, Nekrutenko A, Kumar A, Eschenlauer AC, DeSanto AD, Guerler A, Serrano-Solano B, Batut B, Grüning BA, Langhorst BW, Carr B, Raubenolt BA, Hyde CJ, Bromhead CJ, Barnett CB, Royaux C, Gallardo C, Blankenberg D, Fornika DJ, Baker D, Bouvier D, Clements D, de Lima Morais DA, Tabernero DL, Lariviere D, Nasr E, Afgan E, Zambelli F, Heyl F, Psomopoulos F, Coppens F, Price GR, Cuccuru G, Corguillé GL, Von Kuster G, Akbulut GG, Rasche H, Hotz H-R, Eguinoa I, Makunin I, Ranawaka IJ, Taylor JP, Joshi J, Hillman-Jackson J, Goecks J, Chilton JM, Kamali K, Suderman K, Poterlowicz K, Yvan LB, Lopez-Delisle L, Sargent L, Bassetti ME, Tangaro MA, van den Beek M, Čech M, Bernt M, Fahrner M, Tekman M, Föll MC, Schatz MC, Crusoe MR, Roncoroni M, Kucher N, Coraor N, Stoler N, Rhodes N, Soranzo N, Pinter N, Goonasekera NA, Moreno PA, Videm P, Melanie P, Mandreoli P, Jagtap PD, Gu Q, Weber RJM, Lazarus R, Vorderman RHP, Hiltemann S, Golitsynskiy S, Garg S, Bray SA, Gladman SL, Leo S, Mehta SP, Griffin TJ, Jalili V, Yves V, Wen V, Nagampalli VK, Bacon WA, de Koning W, Maier W, Briggs PJ, The Galaxy Community . 2022. The Galaxy platform for accessible, reproducible and collaborative BIOMEDICAL analyses. Nucleic Acids Res 50:W345–W351. doi: 10.1093/nar/gkac247 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Andrews S. 2010. FastQC: a quality control tool for high throughput sequence data. 370
  • 14. Chen S, Zhou Y, Chen Y, Gu J. 2018. Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884–i890. doi: 10.1093/bioinformatics/bty560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Li D, Liu CM, Luo R, Sadakane K, Lam TW. 2015. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31:1674–1676. doi: 10.1093/bioinformatics/btv033 [DOI] [PubMed] [Google Scholar]
  • 16. Cock PJA, Chilton JM, Grüning B, Johnson JE, Soranzo N. 2015. NCBI BLAST+ integrated into Galaxy. Gigascience 4. doi: 10.1186/s13742-015-0080-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539–539. doi: 10.1038/msb.2011.75 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. doi: 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  • 19. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with Bowtie 2. Nat Methods 9:357–359. doi: 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H. 2021. Twelve years of SAMtools and BCFtools. Gigascience 10:giab008. doi: 10.1093/gigascience/giab008 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The phala bat Lyssavirus sequence has been deposited in GenBank under the accession number OQ970171. The version described in this paper is the first version. Raw reads were deposited in the NCBI Sequence Read Archive available at PRJNA971078 under the accession numbers PRJNA971078 (BioProject) and SAMN35019052 (BioSample). The sequence data used for bat identification have been deposited in GenBank under the accession numbers OR096071 (12s rRNA gene) OR091287 (COI gene) and OR105696 (Cytb gene)


Articles from Microbiology Resource Announcements are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES