Polyphosphate uses mTOR, pyrophosphate, and Rho GTPase components to potentiate bacterial survival in Dictyostelium

Ryan J Rahman; Ramesh Rijal; Shiyu Jing; Te-An Chen; Issam Ismail; Richard H Gomer

doi:10.1128/mbio.01939-23

. 2023 Sep 27;14(5):e01939-23. doi: 10.1128/mbio.01939-23

Polyphosphate uses mTOR, pyrophosphate, and Rho GTPase components to potentiate bacterial survival in Dictyostelium

Ryan J Rahman ¹, Ramesh Rijal ¹, Shiyu Jing ¹, Te-An Chen ¹, Issam Ismail ¹, Richard H Gomer ^1,^✉

Editor: Alejandro Aballay²

PMCID: PMC10653871 PMID: 37754562

ABSTRACT

Human macrophages and the eukaryotic microbe Dictyostelium discoideum ingest bacteria by phagocytosis, and then kill the ingested bacteria. Some pathogenic bacteria secrete linear chains of phosphate residues (polyphosphate; polyP), and the polyP prevents some of the phagocytes from killing the ingested bacteria. In D. discoideum, the effect of polyP requires the G protein-coupled receptor (GPCR) GrlD, suggesting that polyP uses a signal transduction pathway to inhibit killing of ingested bacteria. Here we show that in addition to GrlD, the D. discoideum polyP signaling pathway requires the GPCR interacting arrestin-like protein AdcB, inositol hexakisphosphate kinase A (I6kA), the Rho GTPase RacE, and the target of rapamycin (TOR) component Lst8. D. discoideum also secretes polyP, and at high concentrations polyP inhibits D. discoideum cytokinesis. The polyP inhibition of bacterial killing pathway has some components that overlap and some components that are distinct from the polyP inhibition of cytokinesis pathway. These data suggest the intriguing possibility that if there is a similar polyP inhibition of bacterial killing pathway in macrophages, pharmacologically blocking this pathway could potentiate macrophage killing of pathogenic bacteria.

IMPORTANCE

Although most bacteria are quickly killed after phagocytosis by a eukaryotic cell, some pathogenic bacteria escape death after phagocytosis. Pathogenic Mycobacterium species secrete polyP, and the polyP is necessary for the bacteria to prevent their killing after phagocytosis. Conversely, exogenous polyP prevents the killing of ingested bacteria that are normally killed after phagocytosis by human macrophages and the eukaryotic microbe Dictyostelium discoideum. This suggests the possibility that in these cells, a signal transduction pathway is used to sense polyP and prevent killing of ingested bacteria. In this report, we identify key components of the polyP signal transduction pathway in D. discoideum. In cells lacking these components, polyP is unable to inhibit killing of ingested bacteria. The pathway components have orthologs in human cells, and an exciting possibility is that pharmacologically blocking this pathway in human macrophages would cause them to kill ingested pathogens such as Mycobacterium tuberculosis.

KEYWORDS: polyphosphate, Dictyostelium, phagocytosis, bacterial survival

INTRODUCTION

Polyphosphate (polyP) is a linear polymer of three to hundreds of orthophosphate residues, and is found in all kingdoms of life (1). PolyP is predominantly synthesized by polyphosphate kinase 1 (Ppk1), which is highly conserved in more than 100 prokaryotes, including more than 20 major bacterial pathogens and a few eukaryotes such as Dictyostelium discoideum (2). Bacteria lacking Ppk1 lose essential functions for survival, such as cell motility, biofilm formation, and pathogenicity (3 – 5). The pivotal role polyP plays in pathogenesis has marked Ppk1, which is absent in humans, as a potential target to block pathogenicity (6).

In mammalian cells, polyP (n = ~50–150 phosphates) is concentrated in platelet and mast cell granules and is released during injury or cell activation to potentiate blood clotting cascades (7). Platelet-released polyP also triggers release of neutrophil extracellular traps (8), induces macrophage differentiation and neutrophil chemoattraction during wound healing (9), but inhibits peritoneal macrophage chemotaxis to the sites of infection and tissue damage (10). PolyP can also signal through receptors such as P2Y1 and RAGE to potentiate pro-inflammatory responses of endothelial cells as well as mediate communication among astrocytes (11, 12).

Macrophages fight bacterial infections by phagocytosis (13). During phagocytosis, a bacterium is engulfed into a phagosome, which then acidifies and fuses with a lysosome to form a phagolysosome to kill and digest the ingested bacterium (14). Pathogens such as Mycobacterium tuberculosis (Mtb) prevent their killing in human macrophages by inhibiting phagosome acidification and fusion of the phagosome with the lysosome (15). We previously observed that Mycobacterium smegmatis and Mtb secrete extracellular polyP (16), that exogenous polyP inhibits phagosome acidification and lysosome activity, and that polyP potentiates the survival of non-pathogenic Escherichia coli in human macrophages (16). Other workers found that exogenous polyP potentiates pathogenic E. coli survival in a murine model of sepsis (17). Conversely, treatment of human macrophage and Mtb co-cultures with the polyP-degrading enzyme exopolyphosphatase (PPX), or reduced expression of Ppk1 in M. smegmatis, reduced the survival of these bacteria in human macrophages (16, 18). Together, these results suggest that extracellular polyP produced by some pathogenic bacteria contributes to their survival in macrophages (16).

D. discoideum is a eukaryotic microbe that primarily feeds on bacteria by phagocytosis (19 – 21). Many D. discoideum proteins involved in phagocytosis are conserved in human neutrophils and macrophages (22). Proliferating D. discoideum cells accumulate extracellular polyP, and as the cell density increases to near the point where the cells are about to overgrow their food supply and starve, the concomitant high levels of extracellular polyP inhibit cytokinesis but not the accumulation of cell mass so that the cells will be large and have high nutrient reserves when they starve (23). The extracellular polyP is sensed by the putative G protein-coupled polyP receptor GrlD (24). PolyP inhibits proliferation through distinct mechanisms based on nutrient availability, as GrlD partially mediates this effect in high-nutrient conditions while GrlD and a small GTPase RasC are necessary for the effect in low-nutrient conditions (24). In addition to GrlD and RasC in low-nutrient conditions, polyP requires the G protein component Gβ, the Ras guanine nucleotide exchange factor GefA, phosphatase and tensin homolog (PTEN), phospholipase C (PLC), inositol 1,4,5-trisphosphate (IP3) receptor-like protein A (IplA), Ppk1, and the TOR complex two component PiaA to inhibit proliferation (25). With the exception of grlD⁻ , rasC⁻ , and piaA⁻ , the strains lacking the aforementioned proteins had reduced but non-zero responses to polyP, suggesting the existence of parallel pathways mediating polyP effects (25).

In D. discoideum, polyP acts via the polyP receptor GrlD to potentiate E. coli survival (16). We previously observed that E. coli, which do not accumulate detectable extracellular polyP, get killed after phagocytosis by D. discoideum, while M. smegmatis that accumulate detectable extracellular polyP survive better after phagocytosis than E. coli (16). As in macrophages, reduced expression of ppk1 in M. smegmatis bacteria reduces their survival in D. discoideum, and the addition of exogenous polyP potentiates their survival (16). Together, this suggests the intriguing possibility that there is a signal transduction pathway whereby either extracellular polyP or polyP secreted by a bacterium in a phagosome prevents cells from fusing the phagosome with a lysosome. In this report, we screened D. discoideum mutants to elucidate polyP signal transduction pathways that are needed for polyP to potentiate the survival of ingested bacteria in D. discoideum. We find that extracellular polyP requires the G protein-coupled receptor (GPCR) interacting arrestin-like protein AdcB, inositol hexakisphosphate kinase A (I6kA), the Rho GTPase RacE, and the TOR component Lst8 to potentiate E. coli survival in D. discoideum.

RESULTS

PolyP requires a G protein-coupled receptor but does not require G-protein subunits to potentiate the survival of Escherichia coli in D. discoideum

Wild-type (WT) D. discoideum cells accumulate extracellular polyP, and the polyP concentrations (≥470 µg/mL) corresponding to high cell densities (≥1 × 10⁷ cells/mL) inhibit proliferation, macropinocytosis, exocytosis, and killing of ingested bacteria (23, 26). PolyP concentrations between 5 and 47 µg/mL, which do not affect proliferation, macropinocytosis, or exocytosis, inhibit the killing of ingested bacteria in D. discoideum (16). To identify components of the polyP signal transduction pathway that potentiate the survival of bacteria in D. discoideum, 37 available mutants, representing a wide variety of signal transduction pathways and processes, derived from seven parental strains were tested for sensitivity to polyP-mediated E. coli survival as previously described (16) using exogenous polyP as the source of polyP since E. coli do not accumulate detectable levels of extracellular polyP (16) (Table 1). In these assays, Dictyostelium cells are allowed to ingest E. coli bacteria, the uningested bacteria are washed off, any remaining uningested bacteria are killed with the antibiotic gentamicin, which does not kill ingested bacteria (27), and at 4 and 48 hours, aliquots of the Dictyostelium cells are counted and are lysed with a detergent that does not kill E. coli, and the ingested bacteria are plated to obtain a count of live bacteria. Adding extracellular polyP has little effect on the bacterial survival at 4 hours, and strongly potentiates survival at 48 hours (16). To determine if polyP-mediated changes in intracellular E. coli numbers correspond to altered ingestion or digestion, the efficiency of phagocytic engulfment of Zymosan A bioparticles was measured for all strains. The data are graphed in nine groups: parental/wild-type cells (Fig. 1A and 2A; Fig. S1A and S2A), polyP receptor, G-proteins, and arrestin-like proteins (Fig. 1B and 2B; Fig. S1B and S2B), proteins involved in polyP production (Fig. 1C and 2C; Fig S1C and S2C), GTPases (Fig. 1D and 2D; Fig. S1D and S2D), phospholipase C (PLC)/IP3 pathway components (Fig. 1E and 2E; Fig. S1E and S2E), PI3 kinase signal transduction pathway components (Fig. 1F and 2F; Fig. S1F and S2F), TOR complex components/protein kinases (Fig. 1G and 2G; Fig. S1G and S2G), autophagy pathway components (Fig. 1H and 2H; Fig. S1H and S2H), and cytoskeleton regulating proteins (Fig. 1I and 2I; Fig. S1I and S2I).

TABLE 1.

D. discoideum sensitivity to polyP ^a

Strain	Parental strain	Ingestion (phagocytic index) relative to the respective parental strain (Fig. 2)	Viability of ingested E. coli at 4 hours relative to the respective parental strain (Fig. S1)	Viability of ingested E. coli at 48 hours relative to the respective parental strain (Fig. 1)	Sensitivity to polyP potentiation of viability of ingested E. coli at 48 hours (Fig. 1)
Ax2		Normal	Normal	Normal	Sensitive
Ax3		Normal	Normal	Normal	Sensitive
DH1		Normal	More	More	Sensitive
HPS400		Normal	More	More	Sensitive
JH8		Low	Normal	Normal	Sensitive
JH10		Low	Normal	Normal	Sensitive
KAx3		Normal	Normal	More	Sensitive
*adcB^¯*	Ax2	Same	Same	Same	Insensitive
*adcB^¯/adcC^¯*	Ax2	Less	Same	Same	Sensitive
*adcC^¯*	Ax2	Same	Same	Same	Sensitive
*atg6^¯*	Ax2	Same	Same	Same	Sensitive
*atg7^¯*	Ax2	Same	More	Same	Sensitive
*cnrN^¯*	Ax2	Less	Same	Same	Sensitive
*cnxA^¯*	Ax2	Less	Same	Same	Sensitive
*dagA^¯*	Ax3	Less	Less	Less	Sensitive
*dymA^¯*	Ax2	Same	More	More	Sensitive
*grlD^¯*	Ax2	More	More	More	Insensitive
*gα3^¯*	HPS400	Same	Same	Same	Sensitive
*gβ^¯*	DH1	More	Less	Less	Sensitive
*i6kA^¯*	Ax2	Same	Same	More	Insensitive
*i6kA^¯/i6kA*	Ax2	More	Same	Same	Sensitive
*iplA^¯*	Ax2	Same	Same	Same	Sensitive
*lst8^¯*	KAx3	Same	Less	Less	Insensitive
*pakD^¯*	Ax2	Same	More	Same	Sensitive
*piaA^¯*	Ax2	Less	Same	Same	Sensitive
*pikA^¯*	Ax2	Less	Same	Same	Sensitive
*pikB^¯*	Ax2	Less	Same	Same	Sensitive
*pipkinA^¯*	Ax2	Same	Same	Same	Sensitive
*pkaC^¯*	JH10	More	Same	Same	Sensitive
*pkbA^¯*	Ax2	Less	Same	Same	Sensitive
*pkbA^¯/pkgB^¯*	Ax2	Same	Same	Same	Sensitive
*plC^¯*	Ax2	Same	Same	Same	Sensitive
*ppk1^¯*	Ax2	More	Same	Same	Sensitive
*pten^¯*	Ax2	Same	More	Same	Sensitive
*racC^¯*	Ax2	Same	Same	Same	Sensitive
*racE^¯*	DH1	Same	Same	Same	Insensitive
*racF1A^¯*	Ax2	Same	Same	Same	Sensitive
*racG^¯*	Ax2	More	Same	Same	Sensitive
*racH^¯*	Ax2	Same	Same	Same	Sensitive
*rasC^¯*	Ax2	Same	Same	Same	Sensitive
*rasC^¯/rasG^¯*	Ax2	More	More	Same	Sensitive
*rasG^¯*	Ax2	Less	Same	Same	Sensitive
*scrA^¯*	JH8	More	Same	Same	Sensitive
*wasA^¯*	Ax3	Less	Less	Same	Sensitive

Open in a new tab

^{^a}

Forty-four D. discoideum strains including seven parental wild-type strains were tested for sensitivity to polyP for ingestion of Zymosan bioparticles and viability of ingested E. coli at 4 and 48 hours. Parental strains were compared against Ax2, which was considered normal, and mutants were compared against their parental strains and considered less, same, or more for the indicated parameters tested. Mutants that responded or did not respond to polyP potentiation of viability of ingested bacteria at 48 hours were considered sensitive or insensitive (highlighted in bold), respectively.

Fig 1 — PolyP potentiates the long-term survival of ingested *E. coli* in D. discoideum. (**A–I**) D. discoideum (Dicty) cells were incubated with *E. coli*, uningested *E. coli* were removed, and the number of viable ingested *E. coli* per 10⁶ *D. discoideum* cells in the absence (Control) or the presence of added polyphosphate (PolyP) was determined at 48 hours. Values are mean ± SEM from five independent experiments for each mutant/parental strain and 16 independent experiments for Ax2 wild type. *P < 0.05, **P < 0.01, and ***P < 0.001 by two-tailed Mann-Whitney test comparing the indicated mutant to its parental strain (Table 1), or the indicated parental strain to Ax2, in the absence of added polyP. #P < 0.05, ##P < 0.01, and ####P < 0.0001 by two-tailed Mann-Whitney test comparing control to polyP for the indicated strain.

Fig 2 — PolyP has negligible effect on the uptake of Zymosan A bioparticles in most strains. (**A-I**) The number of Zymosan A bioparticles ingested per *D. discoideum* cell in 60 minutes in the presence or absence of 15 µg/mL polyP was determined. Values are mean ± SEM from three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001 comparing the indicated mutant to its parental strain, or the indicated parental strain to Ax2, in the absence of added polyP by two-tailed Mann-Whitney test. ##P < 0.01 comparing control and polyP for the indicated strain by two-tailed Mann-Whitney test.

At 4 hours, polyP did not affect the number of viable ingested E. coli in the parental/WT strains or any of the mutants, with the exception of cells lacking the arrestin-like protein AdcC, where polyP caused a slight drop in the number of viable internalized E. coli (Fig. S1A to I; Table 1). At 48 hours, although DH1, HPS400, and KAx3 parental strains had significantly increased numbers of viable ingested E. coli in the absence of exogenous polyP compared to the Ax2 parental strain, polyP increased the number of viable, ingested E. coli in all of the parental strains (Fig. 1A and Table 1). In addition to the differences (in the absence of exogenous polyP) between these parental strains in the number of viable bacteria at 4 and at 48 hours (Fig. 1A; Fig. S1A; Table 1), there were also differences in phagocytosis (Fig. 2A; Fig. S2A; Table 1), indicating some strain-dependent differences in phagocytosis and phagosome/lysosome physiology. This may be due to genetic variations between different parental axenic strains (28). Some of the parental strains are auxotrophs, which may also affect phagocytosis and lysosomes.

To test if polyP affects Dictyostelium viability when incubated with bacteria, Dictyostelium cells with ingested bacteria at 4 and 48 hours of phagocytosis were stained with Trypan blue and the live and dead cells were counted. At 4 hours, there was no difference in Dictyostelium total, live, and dead cell densities in the absence or presence of polyP. At 48 hours, the total and live cell densities increased approximately threefold, and the presence of polyP did not affect the total, live, and dead cell densities (Fig. S3A), suggesting that polyP reduces the ability of D. discoideum cells to kill the ingested bacteria without affecting the viability of Dictyostelium cells.

Cells lacking the putative G protein-coupled polyP receptor GrlD are insensitive to polyP-induced proliferation inhibition (24, 25). Cells lacking the heterotrimeric G protein subunits Gβ and Gα3 have a reduced but non-zero sensitivity to polyP (25), suggesting the existence of an additional pathway downstream of GrlD. Compared to their Ax2 parental strain in the absence of exogenous polyP, cells lacking GrlD had slightly higher phagocytosis and higher viability of ingested bacteria at 4 and 48 hours (Fig. 1A, B and 2A, B; Fig. S1A and B; Table 1). GrlD was needed for polyP to potentiate E. coli viability at 48 hours (Fig. 1B and Table 1). These results suggest that GrlD inhibits phagocytosis and mediates the ability of polyP to potentiate the viability of ingested bacteria.

Compared to their HPS400 parental strain, cells lacking Gα3 had normal phagocytosis and viability of ingested E. coli (Fig. 1A, B and 2A, B; Fig. S1A and B; Table 1). In response to polyP, cells lacking Gα3 showed increased viability of ingested bacteria, although not as much as parental cells (Fig. 1A and B and Table 1). Compared to their DH1 parental strain, cells lacking Gβ had more phagocytosis, but less viability of ingested E. coli at 4 and 48 hours (Fig. 1A, B and 2A, B; Fig. S1A and B; Table 1). In response to polyP, cells lacking Gβ showed increased viability of ingested bacteria (Fig. 1A and B and Table 1). Together, these data suggest that Gβ inhibits phagocytosis and promotes the viability of ingested bacteria, and that polyP uses GrlD to activate a downstream pathway that bypasses, or partially bypasses G proteins.

PolyP requires the arrestin domain containing protein AdcB to potentiate E. coli survival

Persistent activation of GPCRs is dampened by phosphorylation of the cytoplasmic region of the receptors (29). Arrestins are scaffolding proteins that bind to the carboxyl terminus of phosphorylated GPCRs, uncouple GPCRs from their cognate G proteins, and turn off G protein mediated signaling (30, 31). In addition to desensitizing GPCRs, arrestins can also function as adaptor proteins for GPCR trafficking and G protein-independent signaling (32, 33). D. discoideum does not possess true arrestins, but has genes encoding six arrestin domain containing proteins (AdcA-F) (34). AdcB but not AdcC was needed for polyP potentiation of bacterial survival at 48 hours, although polyP potentiated bacterial survival in cells lacking both arrestin-like proteins (Fig. 1B and Table 1), suggesting the possibility that AdcB mediates polyP signaling downstream of the GrlD receptor, and that lack of both AdcB and AdcC might cause upregulation of a yet unknown component, possibly one of the four other arrestin-like proteins, that can compensate for the lack of AdcB.

PolyP requires an inositol hexakisphosphate kinase to potentiate E. coli survival

Ppk1 synthesizes polyP from ATP (2, 35). D. discoideum cells lacking Ppk1 (ppk1⁻ ) possess undetectable levels of intracellular polyP (36) and reduced but detectable levels of extracellular polyP (23). Inositol hexakisphosphate kinase (IP6K) synthesizes inositol pyrophosphates IP7 and IP8 from IP6 (37). D. discoideum cells lacking the IP6K homolog I6kA accumulate reduced levels of extracellular polyP (23). At 48 hours, polyP increased the number of viable ingested E. coli in ppk1⁻ cells but not i6kA⁻ cells, and the latter defect was rescued in i6kA⁻/i6kA cells (Fig. 1C and Table 1), indicating that D. discoideum requires I6kA to mediate polyP induced survival of ingested E. coli.

PolyP requires the Rho GTPase RacE to potentiate E. coli survival

Ras and Rho GTPases are involved in a variety of cellular processes including proliferation, differentiation, cell motility, cell polarity, and trafficking of vesicles and macromolecules (38, 39). PolyP requires RasC to inhibit proliferation and induce development of D. discoideum cells (25, 40), whereas the Rho GTPase RacC was not necessary for polyP mediated proliferation inhibition (25). The ability of polyP to potentiate the survival of ingested bacteria at 48 hours did not require RasC, RasG, RacC, RacF1A, RacG, RacH, or the large GTPase dynamin, which is involved in membrane remodeling during endocytosis and phagocytosis (41, 42) (Fig. 1D and Table 1). Although polyP potentiated the survival of bacteria in cells lacking dynamin (dymA⁻ ), the polyP effect was subtle in dymA⁻ cells compared to their parental Ax2 cells; this may have some mechanistic connection to the fact that dymA⁻ cells have inherently more viable, ingested bacteria at 4 and 48 hours (Fig. 1D and Table 1). However, the polyP effect did require the Rho GTPase RacE (43) (Fig. 1D and Table 1).

PolyP does not require several PLC/IP3 pathway components to potentiate E. coli survival

Phospholipase C, which converts PIP2 to diacylglycerol and inositol 1,4,5-trisphosphate (IP3), and the IP3 receptor-like protein IplA are required for polyP-mediated D. discoideum proliferation inhibition (25, 44). PTEN and the PTEN-like phosphatase CnrN catalyze the conversion of PIP3 to PIP2 (45, 46) and are involved in many cellular processes including proliferation and cell migration (25, 45, 46). PTEN but not CnrN is involved in polyP-mediated D. discoideum proliferation inhibition (25). Calnexin (Cnx) is a calcium binding protein and interacts with IP3 receptors (47). Other potential components of PIP3-associated pathways include phosphatidylinositol kinases PikA and PikB, phosphatidylinositol phosphate kinase A (pipkinA¯), the pleckstrin homology (PH) domain containing and PIP3 binding cytosolic regulator of adenylyl cyclase protein CRAC (DagA), and the cAMP-dependent protein kinase A catalytic subunit PkaC. PolyP potentiated bacterial survival at 48 hours in iplA⁻ , plC⁻ , pten⁻ , cnrN⁻ , cnxA⁻ , pikA⁻, pikB⁻, pipkinA⁻ dagA⁻, and pkaC⁻ cells (Fig. 1E and F and Table 1), suggesting that polyP does not use these components of the PLC/IP3 pathway to potentiate the survival of ingested bacteria.

PolyP requires the TOR complex protein Lst8 to potentiate E. coli survival

The TOR forms two distinct signaling complexes, TOR complex 1 (TORC1) and TORC2 (48). In mammals, TORC1 activation promotes anabolic metabolism and blocks catabolic processes such as autophagy and lysosome biogenesis (49, 50). TORC2 is involved in cytoskeletal reorganization during chemotactic cell movement (51 – 53). TORC1 and TORC2 complexes have shared and unique components. TOR and Lst8 are present in both TORC1 and TORC2 complexes, whereas PiaA (mammalian Rictor) is unique to TORC2 (48). PolyP requires PiaA to inhibit proliferation of D. discoideum cells, whereas cells lacking Lst8 (lst8⁻ ) are sensitive to polyP mediated proliferation inhibition (25). TORC2 regulates the activity of protein kinase B (PKB) (54). PolyP required Lst8 but not PiaA, the Akt/PKB protein kinase PkbA, or PkbA and the SGK family protein kinase PkgB to potentiate bacterial survival (Fig. 1G and Table 1). Compared to their KAx3 parental cells, in the absence of exogenous polyP, lst8⁻ cells had normal total phagocytosis but an inherently decreased percent of cells showing phagocytosis (Fig. 2A and G; Fig. S2A and G), and fewer viable ingested bacteria at 4 and 48 hours (Fig. 1A and G; Fig. S1A and G; Table 1). Together, this suggests that Lst8 increases the percent of cells that show phagocytosis, increases viability of ingested bacteria, and mediates the ability of polyP to increase the survival of ingested bacteria.

PolyP does not require the autophagy proteins Atg6 and Atg7 to potentiate E. coli survival

Autophagy is used to degrade and recycle cytoplasmic materials in eukaryotic cells (55), and TOR signaling regulates autophagy (56). D. discoideum cells feed on bacteria to acquire nutrients in the natural environment. The cells use autophagy machinery to kill bacteria only when the bacteria escape the phagosome in a process called xenophagy (57). D. discoideum uses the autophagy proteins Atg6 and Atg7 for autophagosome formation (58). PolyP potentiated the survival of ingested bacteria in atg6⁻ and atg7⁻ cells; however, the effect of polyP on atg6⁻ and atg7⁻ was mild compared to parental Ax2 cells. (Fig. 1H and Table 1). Together, these data suggest that polyP does not absolutely require Atg6 and Atg7 to potentiate bacterial survival, although these components of the autophagy pathway may contribute to this effect of polyP.

PolyP does not require selected cytoskeletal proteins to potentiate E. coli survival

Actin and actin-associated proteins play critical roles during phagocytic uptake and early phagosome formation processes (59 – 61). Although polyP concentrations (705 µg/mL) corresponding to very high cell densities reduced levels of actin cytoskeleton proteins (40), the lower polyP concentration that potentiates bacteria survival in WT cells did not require the cytoskeleton-associated proteins p21-activated kinase D (PakD), or Wiskott-Aldrich syndrome protein family protein SCAR to potentiate bacterial survival (Fig. 1I), suggesting that polyP prevents the killing of ingested bacteria without requiring these proteins. Although polyP potentiated the survival of bacteria in cells lacking Wiskott-Aldrich syndrome protein (WasA), the effect of polyP was subtle compared to parental Ax3 cells (Fig. 1A and I); this may have a mechanistic connection to, in the absence of exogenous polyP, the reduced phagocytosis, percent of cells showing phagocytosis, and viability of E. coli at 4 hours observed in wasA⁻ cells (Fig. S1A and I; Fig. 2A and I).

Defective polyP sensitivity is not due to a defect in the parental strain or defective phagocytosis

Cells lacking GrlD, AdcB, I6kA, RacE, and Lst8 (with genotypes verified by PCR, Fig. S3B t0 E) do not potentiate bacterial survival at 48 hours in response to polyP. Ax2 is the parental strain of grlD⁻ , adcB⁻ , and i6kA⁻ , DH1 is the parental strain of racE⁻ , and KAx3 is the parental strain of lst8⁻ (Table 1). All of these parental strains increased bacterial survival in response to polyP (Fig. 1A and Table 1), indicating that the defects in the above mutants are not due to a defect in the parental strain. Phagocytosis, as measured by the number of ingested zymosan particles, was normal in most of the above strains with defective polyP responses, with the exception of grlD⁻ , which had somewhat higher phagocytosis (Fig. 2 and Table 1). Compared to the respective parental strains, there was no consistent effect of these mutations on the percent of cells ingesting beads. Cells lacking GrlD were normal, a slightly higher percentage of cells lacking AdcB and I6kA ingested beads, and a somewhat lower percentage of cells lacking RacE and Lst8 ingested beads (Fig. S2). PolyP had no significant effect on these percentages (Fig. S2). Together, these results indicate that the above proteins are part of a mechanism where extracellular polyP potentiates the survival of ingested bacteria after phagocytosis of the bacteria.

PolyP inhibits proteasome activity

We previously found that 705 µg/mL polyP (the extracellular polyP concentration in stationary phase cultures) inhibits proteasome activity in D. discoideum (40). PolyP requires GrlD and RasC to inhibit proteasome activity in all nutrient conditions (40), but to inhibit proliferation, polyP inhibits proteasome activation only in low nutrient conditions, indicating that polyP inhibits proliferation of D. discoideum using different pathways depending on the nutritional conditions (40). To determine if the relatively low concentrations of polyP that potentiate the survival of E. coli also inhibit proteasome activity, we tested the effect of 15 µg/mL polyP on proteasome activity in Ax2 and the mutants that are insensitive to polyP-induced bacterial survival. PolyP reduced proteasome activity in Ax2 cells, and although grlD⁻ and racE⁻ cells had reduced basal proteasomal activity, polyP did not significantly affect proteasome activity in grlD⁻, adcB⁻, i6kA⁻, racE⁻, or lst8⁻ cells (Fig. 3A). This indicates that GrlD, AdcB, I6kA, RacE, and Lst8 may be parts of a polyP signaling pathway that reduces proteasome activity, although whether this is associated with, or independent of, the effects of this same pathway on survival of ingested bacteria remains unknown.

Fig 3 — PolyP affects protein ubiquitination and proteasome activity. (A) Proteasome activity of Ax2 (WT) and the indicated strains in the presence or absence of 15 µg/mL polyP were measured and normalized to the Ax2 (no polyP) control. Values are mean ± SEM from at least three independent experiments. *P < 0.05 by Holm-Šídák’s multiple comparisons test (two-way ANOVA). (B) Coomassie stains and anti-ubiquitin western blot images for 4 and 48 hours Ax2 lysates in the presence and absence of polyP. Images are representative of seven independent experiments. (C) The integrated staining intensities in the anti-ubiquitin Western blots were quantified at 4 hours as a percent of the 4 hours control and at 48 hours as a percent of the 48 hours control. Values are mean ± SEM from seven independent experiments. *P < 0.05 by two-tailed Mann-Whitney test.

Cells label proteins with ubiquitin to induce their degradation (62). To determine if polyP potentiation of bacterial survival grossly affects ubiquitinated protein levels, Western blots of D. discoideum lysates from the 4 and 48 hours bacterial survival assays were stained with anti-ubiquitin antibodies. PolyP slightly increased the level of ubiquitinated proteins at 4 and 48 hours compared to control (Fig. 3B and C). Together, these data suggest that polyP may modestly increase ubiquitinated protein levels, and that this effect of polyP may be due to reduced proteasome activity, which may cause accumulation of ubiquitinated proteins destined for degradation, and thus may be independent of the effect of polyP on facilitating the long term survival of bacteria.

PolyP requires AdcB and Lst8 to inhibit cell proliferation

We previously observed that 705 µg/mL polyP inhibits the proliferation of WT D. discoideum cells (23), and that the loss of GrlD, I6kA, or TORC2 complex protein PiaA reduces the ability of polyP to inhibit proliferation in a low nutrient (25% HL5) medium (25). To determine if the proteins that mediate polyP potentiation of bacterial survival also affect polyP inhibition of proliferation in normal nutrient conditions, we examined the effect of 705 µg/mL polyP on proliferation of mutants in SIH and HL5 media. In SIH, compared to WT cells, polyP had a reduced ability to inhibit the proliferation of grlD¯ and lst8¯ cells, and in HL5, polyP had a reduced ability to inhibit the proliferation of grlD¯, adcB¯, and lst8¯ cells (Fig. 4). Together, this indicates that some but not all polyP potentiation of bacterial survival signal transduction pathway components also mediate polyP proliferation inhibition, suggesting a partially shared pathway.

Fig 4 — PolyP requires GrlD, AdcB, and Lst8 to inhibit the proliferation of *D. discoideum* cells. Cells were cultured in either SIH (A) or HL5 (B) with or without 705 µg/mL polyP for 24 hours. The increase in cell density in the presence of polyP was calculated as a percentage of the increase in cell density in the absence of polyP for each strain. Values are mean ± SEM from at least three independent experiments. *P < 0.05 and **P < 0.01 by Holm-Šídák’s multiple comparisons test (one-way ANOVA), and #P < 0.05 by two-tailed Mann-Whitney test.

DISCUSSION

In this report, we found that to inhibit the killing of ingested bacteria in D. discoideum, polyP requires, in addition to the G protein-coupled receptor GrlD (16, 40), AdcB, I6kA, RacE, and Lst8. PolyP also appears to use AdcB and Lst8, but not I6kA and RacE, to inhibit proliferation. However, to inhibit killing of ingested bacteria, polyP does not require other components of the signal transduction pathway that it uses to inhibit cell proliferation such as Gβ, RasC, PakD, PiaA, PTEN, PLC, IplA, Ppk1, PiaA, and PkaC (23, 25), suggesting that polyP uses partially overlapping signal transduction pathways to inhibit proliferation and the killing of ingested bacteria (Fig. 5).

Fig 5 — Hypothesized polyP signal transduction pathways that inhibit the killing of bacteria in *D. discoideum* and pathways that inhibit cell proliferation. PolyP binds to the GrlD receptor, and the polyP signal is relayed downstream of GrlD by the arrestin-like protein AdcB, inositol hexakisphosphate kinase A (I6kA), the Rho GTPase RacE, and the TOR component Lst8 to inhibit the killing of ingested bacteria. AdcB and Lst8 also help polyP to inhibit *D. discoideum* proliferation. To inhibit proliferation, polyP signaling downstream of GrlD receptor is also mediated by Gαs and Gβγ, PTEN, and PLC, which cleaves PIP2 to IP3 and DAG. When IP3 binds to the IP3 receptor IplA, Ca²⁺ is released into the cytosol. The increase of IP3 and cytosolic Ca²⁺ levels by polyP depends on PTEN, PLC, and IplA. GefA converts GDP-bound RasC to GTP-bound RasC. Both GefA and PiaA are essential for the upregulation of IP3 levels by polyP, while RasC and Ppk1 are necessary for the increase of cytosolic Ca²⁺ levels. The proposed pathway diagram was created using BioRender.com.

Although polyP requires the G protein subunit Gβ to inhibit proliferation in 25% HL5 (25), polyP does not require Gα3 and Gβ to potentiate the survival of ingested bacteria in D. discoideum, but rather uses the arrestin-like protein AdcB downstream of GrlD. Arrestins are scaffolding proteins that deactivate a G protein-coupled receptor by binding to the cytoplasmic domain of the receptor, which induces a conformational change that allows the release of the G proteins subunits bound to the receptor (30, 31). Therefore, polyP appears to activate different pathways immediately downstream of GrlD to inhibit proliferation and the killing of ingested bacteria.

Eukaryotic cells including D. discoideum utilize autophagy for intracellular degradation of cytoplasm and organelles (58, 63 – 67). In addition to preventing phagosome-lysosome fusion, pathogens such as M. tuberculosis and Salmonella typhimurium break out of phagosomes and enter the cytosol (68). The eukaryotic cell then degrades the disrupted phagosome and attempts to kill the pathogen in the cytosol by autophagy (68 – 70). S. typhimurium, which requires polyphosphate kinase to prevent their killing in human macrophages (71), show increased survival in D. discoideum cells lacking the autophagy proteins Atg6 and Atg7 (65). However, polyP does not need Atg6 and Atg7 to increase the survival of E. coli in D. discoideum cells. Assuming that E. coli are unable to break out of the phagosome, this indicates that polyP may not require autophagy machinery to potentiate the survival of ingested bacteria in phagosomes, and that autophagy is a second line of defense against pathogens that do escape the phagosome.

The high polyP concentrations that inhibit proliferation of D. discoideum cells also inhibit proteasome activity in D. discoideum and human leukemia cell lines (40), and inhibition of proteasome activity has been suggested as a potential therapeutic for cancer (72). The low polyP concentration (15 µg/mL) that does not inhibit proliferation but potentiates survival of bacteria inhibits proteasome activity in WT cells but not in grlD⁻ , adcB⁻ i6kA⁻, lst8⁻, or racE⁻ cells. This indicates that components of the polyP pathway which inhibit the killing of ingested bacteria also inhibit proteasome activity. One possibility is that this pathway allows some D. discoideum cells to sense the relatively low concentrations of extracellular polyP, signaling that they are near each other and will eventually overgrow their food supply and should begin to conserve energy by storing nutrients (not killing some of ingested bacteria) and decreasing protein degradation.

In this report, we found that polyP inhibits killing of ingested bacteria in D. discoideum cells using signal transduction pathway components and mechanisms that have orthologs in human cells. PolyP from ingested pathogenic bacteria inhibits their killing in human macrophages (16). An intriguing possibility is that macrophages have a pathway similar to the Dictyostelium pathway to sense polyP, and that blocking this pathway could induce macrophages to kill internalized pathogens such as M. tuberculosis.

Contact for reagent and resource sharing

Further information and requests for reagents may be directed to, and will be fulfilled by, the authors Ramesh Rijal (rijalramesh@tamu.edu) and Richard Gomer (rgomer@tamu.edu).

MATERIALS AND METHODS

D. discoideum cell culture

D. discoideum strains were obtained from the Dictyostelium Stock Center (73) and were Ax2 (DBS0237699), Ax3 (DBS0235542), KAx3 (DBS0266758), DH1 (DBS0235700) , JH8 (DBS0236454), JH10 (DBS0236449), and HPS400 (DBS0236312), adcB¯ (DBS0350443), adcC¯ (DBS0350646), adcB¯/adcC¯ (DBS0350445), atg6¯ (DBS0236344), atg7¯ (DBS0236372), cnrN¯ (DBS0302655), cnxA¯ (DBS0236189), dagA¯ (DBS0235559), dymA¯ (DBS0347874), grlD¯ (DBS0350227), gβ¯ (DBS0236531), gα3¯ (DBS0235986), iplA¯ (DBS0236260), i6kA¯ (DBS0236426), i6kA¯/i6kA (23), lst8¯ (DBS0236517), pakD¯ (DBS0350281), piaA¯ (DBS0349879) , pikA¯ (DBS0350197), pikB¯ (DBS0350198), pipkinA¯ (DBS0236779), pkaC¯ (DBS0236783), pkbA¯ (DBS0349876), pkbA¯/pkgB¯ (DBS0236785), plC¯ (DBS0267124), ppk1¯ (DBS0350686), pten¯ (DBS0236830), racC¯ (DBS0350272), racE¯ (DBS0235413), racF1¯ (DBS0351505), racG¯ (DBS0236849), racH¯ (DBS0236850), rasC¯ (DBS0236853), rasG¯ (DBS0236862), rasC¯/rasG¯ (DBS0236858), scrA¯ (DBS0236926) and wasA¯ (wasA¯ strain was a kind gift from Robert Insall, Beatson Institute for Cancer Research, Glasgow, UK) (2, 43, 46, 52, 53, 73 – 104). D. discoideum cell cultures were maintained at 21°C on lawns Escherichia coli B/R20 (Dictyostelium Stock Center) on SM/5 agar plates (105) and in type 353003 100 mm tissue culture dishes (Corning, Durham, NC) in 10 mL of HL5 medium or SIH defined minimal medium (Formedium, Norfolk, England). HL5 or SIH containing 100 µg/mL dihydrostreptomycin and 100 µg/mL ampicillin was used to kill E. coli in D. discoideum cultures obtained from SM/5 agar (105). Cells encoding a selectable marker were grown under selection with appropriate antibiotics and supplements (5 µg/mL blasticidin, 5 µg/mL neomycin sulfate, 100 µg/mL thymidine, and/or 20 µg/mL uracil). All experiments in Fig. 1 and 2 used cells from at least two different frozen stocks for each strain.

Polyphosphate preparation

Sodium polyphosphate of average chain length of 45 monomers (16) (Cat#S0169, Spectrum, New Brunswick, NJ) was used for all assays. The sodium polyphosphate stock was prepared in PBM buffer [20 mM KH₂PO₄, 1 mM MgCl₂, 0.01 mM CaCl₂, pH 6.5 (23)] to a concentration of 70.5 mg/mL or 1.5 mg/mL, the pH was checked, and this stock was diluted 100× in cultures to make 705 µg/mL or 15 µg/mL polyP.

Bacterial survival assay and phagocytosis

E. coli K-12 survival in D. discoideum was performed as previously described (16). D. discoideum cells were plated in type 353047 24-well plates (Corning) with 1 mL of cells at 10⁶ cell/mL in each well. After 30 minutes, polyP from a 1.5 mg/mL stock was added to a final concentration of 15 µg/mL, or an equal volume of PBM was added, and mixed gently using a pipette. E. coli K-12 bacteria were washed twice in PBM buffer by centrifugation at 12,000 × g for 2 minutes, followed by resuspension in PBM buffer. The OD₆₀₀ was measured and bacteria were diluted in PBM to an OD₆₀₀ of 0.1. E. coli K-12 (50 µL) was added to D. discoideum cells and incubated for 2 hours. To remove uningested extracellular bacteria, D. discoideum cells were gently washed with SIH. Any remaining bacteria that were not ingested were eliminated by adding gentamicin (Sigma) to a final concentration of 200 µg/mL. After 2 hours, the cells were washed again to remove gentamicin. At 4 and 48 hours after plating, cells were washed by centrifugation of plates at 500 × g for 3 minutes, removing the media, resuspending cells in 200 µL PBM, and 20 µL of the cell suspension was taken for D. discoideum cells count, and 150 µL of the cell suspension was mixed with 1.5% of Triton X-100 (Alfa Aesar), and then lysed by gently pipetting at room temperature. For the cell counts, 10 µL of cells was mixed with 10 µL of 0.4% Trypan blue (Cat#11618, Kodak, Rochester, NY), and after 30 seconds a TC20 automated cell counter (Bio-Rad, Hercules, CA, USA) was used to count live (unstained) and dead (stained) Dictyostelium cells. The Triton lysates were plated on LB agar for E. coli K-12 growth and incubated at 37°C. For cultures with polyP, PolyP was present in all incubation steps prior to the Triton lysis step. After 24 hours, colonies of E. coli K-12 were visible. The bacterial colonies were counted, and the viable bacteria within D. discoideum cells were calculated as cfu/10⁶ D. discoideum cells.

Phagocytic index is a measurement of the uptake of particles by phagocytes (106). Fluorescence microscopy was used to visualize ingested Alexa 594-labeled Zymosan-A yeast BioParticles (Cat#Z23374, Thermo Fisher Scientific) in D. discoideum as described in (16). Briefly, D. discoideum cells were seeded in type 353219 96-well, black/clear, tissue-culture-treated plates (Corning). After 30 minutes, polyP added to the cells to a final concentration of 15 µg/mL and mixed by gentle pipetting. Zymosan bioparticles were resuspended in PBM buffer to a concentration of 0.5 mg/mL. Ten microliters of bioparticles was added to the cells and mixed by gentle pipetting, and the plates were spun down at 500 × g for 3 minutes. After 1 hour, images of D. discoideum cells were taken with a 40× objective on a Nikon Eclipse Ti2 (Nikon), and we used the Richardson-Lucy algorithm (107) for deconvolution of images in NIS-Elements AR software. The number of bioparticles ingested per cell per hour was calculated as a mean number of ingested bioparticles per phagocytosing D. discoideum cell multiplied by the percentage of D. discoideum cells engaged in phagocytosis.

Genotype verification

The genotype of D. discoideum strains that were insensitive to polyP (grlD¯, adcB¯, i6kA¯, lst8¯, and racE¯) were verified by PCR as previously described (53) using the specific primer pairs listed in Table 2.

TABLE 2.

Oligonucleotides for genotyping of polyP insensitive mutants by PCR

cDNA	5’−3’ Forward primer	5’−3’ Reverse primer
grlD	ATGAAAATTAATTCATTTTT	TTAATTATCACCATCATTATTTTCTTC
adcB	ATGGATAACAGAGGATTAAG	CTAATTATTTAATTTAAG
i6kA	ATGCACATATTTTATTTAGTAAACTCG	GTTTGTATTTATGACTGTATTTTGTTG
racE	ATGTCAGAAGATCAAGGTTCAGG	TTAAAGTATAATACAACCAG
lst8	ATGCCAGGTATTATATTGGC	TTATCTTGGTAAATCATTTAAAGC

Open in a new tab

Immunoblotting

One milliliter of 10⁶ D. discoideum cells in SIH was seeded in a type 353047 24-well tissue culture plate (Corning), and either 15 µg/mL polyP from a 15 mg/mL stock in PBM (20 mM KH₂PO₄, 1 mM MgCl₂, 0.01 mM CaCl₂, pH adjusted to 6.1 with KOH) or an equivalent volume of PBM was added. At 4 or 48 hours, the 24-well plate was centrifuged at 500 × g for 3 minutes, and the supernatant was replaced by 1 mL of PBM. This step was repeated once. The 24-well plate was centrifuged at 500 × g for 3 minutes, the supernatant was discarded, and cells at the bottom of each well were lysed with 100 µL of 1× SDS sample buffer. The lysates were collected, and Western blots and Coomassie staining of gels was performed as previously described (53). Western blots were stained with 1:1000 diluted mouse monoclonal anti-ubiquitin antibodies (Cat# 3936T; Cell Signaling Technology) to detect ubiquitinated proteins.

Proteasome activity assay

One hundred microliter of D. discoideum cells in SIH at 10⁶ cells/mL was seeded in type 353219, 96-well, black/clear, tissue-culture-treated, glass-bottom plates (Corning), spun down at 500 × g for 3 minutes, the medium was changed to SIH or SIH containing 15 µg/mL polyP, and the 96-well plate was incubated in a Tupperware container with wet paper towels (for humidity) for 48 hours. Proteasome activity was measured using a Proteasome Activity Kit (Cat#MAK172, Sigma, St Louis, MO) following the manufacturer’s instructions.

Proliferation inhibition

Proliferation of D. discoideum strains in the presence or absence of 705 µg/mL polyP was measured as previously described (23). Briefly, cells grown in HL5 or SIH (as described above) were diluted to 5 × 10⁵ cells/mL in 1 mL of HL5 or SIH, incubated in the presence or absence of 705 µg/mL polyP and the cell density was measured after 24 hours with a hemocytometer. For each strain, the increase in cell density in the presence of polyP was calculated as a percentage of the increase in cell density in the absence of polyP.

Statistical analysis

Statistical analyses were performed using Prism 9 (GraphPad, San Diego, CA) and the tests indicated in the figure legends. A P < 0.05 was considered to be significant.

ACKNOWLEDGMENTS

We thank Dr. Robert Insall, Beatson Institute for Cancer Research, Glasgow, UK, for the gift of wasA¯ cells, and we thank the Dictyostelium stock center for other cells.

Ryan J. Rahman was supported by awards from the Arnold and Mabel Beckman Foundation, the Goldwater Scholar Foundation, and the Astronaut Scholar Foundation. This work was supported by National Institutes of Health grants GM118355 and GM139486.

R.R. designed and performed experiments, analyzed data, and wrote the paper. R.J.R. performed experiments, analyzed data, and wrote the paper, S.J. performed experiments, T.-A.C. performed experiments, and R.H.G. coordinated the study, revised the paper, and acquired funding.

No competing interests are declared.

Contributor Information

Richard H. Gomer, Email: rgomer@tamu.edu.

Alejandro Aballay, School of Medicine, Oregon Health & Science University, Portland, Oregon, USA .

DATA AVAILABILITY

The article and its associated supplementary data contain all the necessary data to support the results. Further information may be directed to, and will be fulfilled by, the authors Ramesh Rijal (rijalramesh@tamu.edu) and Richard Gomer (rgomer@tamu.edu).

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/mbio.01939-23.

Supplemental Figures. mbio.01939-23-s0001.docx.

Fig. S1-S3.

Click here for additional data file.^{(385.3KB, docx)}

DOI: 10.1128/mbio.01939-23.SuF1

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1. Kulaev IS, Vagabov VM. 1983. Polyphosphate metabolism in micro-organisms. Adv Microb Physiol 24:83–171. doi: 10.1016/s0065-2911(08)60385-9 [DOI] [PubMed] [Google Scholar]
2. Zhang H, Gómez-García MR, Shi X, Rao NN, Kornberg A. 2007. Polyphosphate kinase 1, a conserved bacterial enzyme, in a eukaryote, Dictyostelium discoideum, with a role in cytokinesis. Proc Natl Acad Sci U S A 104:16486–16491. doi: 10.1073/pnas.0706847104 [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Fraley CD, Rashid MH, Lee SSK, Gottschalk R, Harrison J, Wood PJ, Brown MRW, Kornberg A. 2007. A polyphosphate kinase 1 (ppk1) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects. Proc Natl Acad Sci U S A 104:3526–3531. doi: 10.1073/pnas.0609733104 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Rashid MH, Rumbaugh K, Passador L, Davies DG, Hamood AN, Iglewski BH, Kornberg A. 2000. Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 97:9636–9641. doi: 10.1073/pnas.170283397 [DOI] [PMC free article] [PubMed] [Google Scholar]
5. Crooke E, Akiyama M, Rao NN, Kornberg A. 1994. Genetically altered levels of inorganic polyphosphate in Escherichia coli. J Biol Chem 269:6290–6295. [PubMed] [Google Scholar]
6. Gautam LK, Sharma P, Capalash N. 2019. Bacterial polyphosphate kinases revisited: role in pathogenesis and therapeutic potential. Curr Drug Targets 20:292–301. doi: 10.2174/1389450119666180801120231 [DOI] [PubMed] [Google Scholar]
7. Morrissey JH, Smith SA. 2015. Polyphosphate as modulator of hemostasis, thrombosis, and inflammation. J Thromb Haemost 13 Suppl 1:S92–7. doi: 10.1111/jth.12896 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Chrysanthopoulou A, Kambas K, Stakos D, Mitroulis I, Mitsios A, Vidali V, Angelidou I, Bochenek M, Arelaki S, Arampatzioglou A, Galani I-E, Skendros P, Couladouros EA, Konstantinides S, Andreakos E, Schäfer K, Ritis K. 2017. Interferon lambda1/IL-29 and inorganic polyphosphate are novel regulators of neutrophil-driven thromboinflammation. J Pathol 243:111–122. doi: 10.1002/path.4935 [DOI] [PubMed] [Google Scholar]
9. Suess PM, Chinea LE, Pilling D, Gomer RH. 2019. Extracellular polyphosphate promotes macrophage and fibrocyte differentiation, inhibits leukocyte proliferation, and acts as a chemotactic agent for neutrophils. J Immunol 203:493–499. doi: 10.4049/jimmunol.1801559 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Terashima-Hasegawa M, Ashino T, Kawazoe Y, Shiba T, Manabe A, Numazawa S. 2019. Inorganic polyphosphate protects against lipopolysaccharide-induced lethality and tissue injury through regulation of macrophage recruitment. Biochem Pharmacol 159:96–105. doi: 10.1016/j.bcp.2018.11.017 [DOI] [PubMed] [Google Scholar]
11. Dinarvand P, Hassanian SM, Qureshi SH, Manithody C, Eissenberg JC, Yang L, Rezaie AR. 2014. Polyphosphate amplifies proinflammatory responses of nuclear proteins through interaction with receptor for advanced glycation end products and P2Y1 purinergic receptor. Blood 123:935–945. doi: 10.1182/blood-2013-09-529602 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Holmström KM, Marina N, Baev AY, Wood NW, Gourine AV, Abramov AY. 2013. Signalling properties of inorganic polyphosphate in the mammalian brain. Nat Commun 4:1362. doi: 10.1038/ncomms2364 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Pauwels A-M, Trost M, Beyaert R, Hoffmann E. 2017. Patterns, receptors, and signals: regulation of phagosome maturation. Trends Immunol 38:407–422. doi: 10.1016/j.it.2017.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Neuhaus EM, Almers W, Soldati T. 2002. Morphology and dynamics of the endocytic pathway in Dictyostelium discoideum. Mol Biol Cell 13:1390–1407. doi: 10.1091/mbc.01-08-0392 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Vergne I, Chua J, Singh SB, Deretic V. 2004. Cell biology of mycobacterium tuberculosis phagosome. Annu Rev Cell Dev Biol 20:367–394. doi: 10.1146/annurev.cellbio.20.010403.114015 [DOI] [PubMed] [Google Scholar]
16. Rijal R, Cadena LA, Smith MR, Carr JF, Gomer RH. 2020. Polyphosphate is an extracellular signal that can facilitate bacterial survival in eukaryotic cells. Proc Natl Acad Sci U S A 117:31923–31934. doi: 10.1073/pnas.2012009117 [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Roewe J, Stavrides G, Strueve M, Sharma A, Marini F, Mann A, Smith SA, Kaya Z, Strobl B, Mueller M, Reinhardt C, Morrissey JH, Bosmann M. 2020. Bacterial polyphosphates interfere with the innate host defense to infection. Nat Commun 11:4035. doi: 10.1038/s41467-020-17639-x [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Wurst H, Kornberg A. 1994. A soluble exopolyphosphatase of saccharomyces cerevisiae purification and characterization. J Biol Chem 269:10996–11001. [PubMed] [Google Scholar]
19. Cardelli J. 2001. Phagocytosis and macropinocytosis in Dictyostelium: phosphoinositide-based processes, biochemically distinct. Traffic 2:311–320. doi: 10.1034/j.1600-0854.2001.002005311.x [DOI] [PubMed] [Google Scholar]
20. Vuillemin P. 1903. Une acrasiee bacteriophage. Comptes rendus des s eances de l’Acad emie des sciences de Paris, Vol. 137, p 387–389. [Google Scholar]
21. Cosson P, Soldati T. 2008. Eat, kill or die: when amoeba meets bacteria. Curr Opin Microbiol 11:271–276. doi: 10.1016/j.mib.2008.05.005 [DOI] [PubMed] [Google Scholar]
22. Martín-González J, Montero-Bullón J-F, Lacal J. 2021. Dictyostelium discoideum as a non-mammalian biomedical model. Microb Biotechnol 14:111–125. doi: 10.1111/1751-7915.13692 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Suess PM, Gomer RH. 2016. Extracellular polyphosphate inhibits proliferation in an autocrine negative feedback loop in Dictyostelium discoideum. J Biol Chem 291:20260–20269. doi: 10.1074/jbc.M116.737825 [DOI] [PMC free article] [PubMed] [Google Scholar]
24. Suess PM, Tang Y, Gomer RH. 2019. The putative G protein-coupled receptor GrlD mediates extracellular polyphosphate sensing in Dictyostelium discoideum. Mol Biol Cell 30:1118–1128. doi: 10.1091/mbc.E18-10-0686 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Tang Y, Rijal R, Zimmerhanzel DE, McCullough JR, Cadena LA, Gomer RH, Heitman J. 2021. An autocrine negative feedback loop inhibits Dictyostelium discoideum proliferation through pathways including IP3/Ca(2). mBio 12:e0134721. doi: 10.1128/mBio.01347-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Rijal R, Kirolos SA, Rahman RJ, Gomer RH. 2022. Dictyostelium discoideum cells retain nutrients when the cells are about to outgrow their food source. J Cell Sci 135:jcs260107. doi: 10.1242/jcs.260107 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Vaudaux P, Waldvogel FA. 1979. Gentamicin antibacterial activity in the presence of human polymorphonuclear leukocytes. Antimicrob Agents Chemother 16:743–749. doi: 10.1128/AAC.16.6.743 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Bloomfield G, Tanaka Y, Skelton J, Ivens A, Kay RR. 2008. Widespread duplications in the genomes of laboratory stocks of Dictyostelium discoideum. Genome Biol 9:R75. doi: 10.1186/gb-2008-9-4-r75 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Carman CV, Benovic JL. 1998. G-protein-coupled receptors: turn-ons and turn-offs. Curr Opin Neurobiol 8:335–344. doi: 10.1016/s0959-4388(98)80058-5 [DOI] [PubMed] [Google Scholar]
30. Aubry L, Klein G. 2013. Chapter two ‐ true arrestins and arrestin-fold proteins: a structure-based appraisal. Prog Mol Biol Transl Sci 118:21–56. doi: 10.1016/B978-0-12-394440-5.00002-4 [DOI] [PubMed] [Google Scholar]
31. Gurevich VV, Gurevich EV. 2019. GPCR signaling regulation: the role of GRKs and arrestins. Front Pharmacol 10:125. doi: 10.3389/fphar.2019.00125 [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Moore CAC, Milano SK, Benovic JL. 2007. Regulation of receptor trafficking by GRKs and arrestins. Annu Rev Physiol 69:451–482. doi: 10.1146/annurev.physiol.69.022405.154712 [DOI] [PubMed] [Google Scholar]
33. Shenoy SK, Lefkowitz RJ. 2011. β-Arrestin-mediated receptor trafficking and signal transduction. Trends Pharmacol Sci 32:521–533. doi: 10.1016/j.tips.2011.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Aubry L, Guetta D, Klein G. 2009. The arrestin fold: variations on a theme. Curr Genomics 10:133–142. doi: 10.2174/138920209787847014 [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Ahn K, Kornberg A. 1990. Polyphosphate kinase from Escherichia coli. purification and demonstration of a phosphoenzyme intermediate. J Biol Chem 265:11734–11739. [PubMed] [Google Scholar]
36. Livermore TM, Chubb JR, Saiardi A. 2016. Developmental accumulation of inorganic polyphosphate affects germination and energetic metabolism in Dictyostelium discoideum. Proc Natl Acad Sci U S A 113:996–1001. doi: 10.1073/pnas.1519440113 [DOI] [PMC free article] [PubMed] [Google Scholar]
37. Pisani F, Livermore T, Rose G, Chubb JR, Gaspari M, Saiardi A, Soldati T. 2014. Analysis of Dictyostelium discoideum Inositol pyrophosphate metabolism by GEL electrophoresis. PLoS ONE 9:e85533. doi: 10.1371/journal.pone.0085533 [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Wilkins A, Insall RH. 2001. Small GTPases in Dictyostelium: lessons from a social amoeba. Trends Genet 17:41–48. doi: 10.1016/s0168-9525(00)02181-8 [DOI] [PubMed] [Google Scholar]
39. Forbes G, Schilde C, Lawal H, Kin K, Du Q, Chen Z-H, Rivero F, Schaap P. 2022. Interactome and evolutionary conservation of dictyostelid small GTPases and their direct regulators. Small GTPases 13:239–254. doi: 10.1080/21541248.2021.1984829 [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Suess PM, Watson J, Chen W, Gomer RH. 2017. Extracellular polyphosphate signals through Ras and AKT to prime Dictyostelium discoideum cells for development. J Cell Sci 130:2394–2404. doi: 10.1242/jcs.203372 [DOI] [PMC free article] [PubMed] [Google Scholar]
41. Huynh KK, Grinstein S. 2008. Phagocytosis: dynamin's dual role in phagosome biogenesis. Curr Biol 18:R563–5. doi: 10.1016/j.cub.2008.05.032 [DOI] [PubMed] [Google Scholar]
42. Sundborger AC, Hinshaw JE. 2014. Regulating dynamin dynamics during endocytosis. F1000Prime Rep 6:85. doi: 10.12703/P6-85 [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Wang Y, Senoo H, Sesaki H, Iijima M. 2013. Rho GTPases orient directional sensing in chemotaxis. Proc Natl Acad Sci U S A 110:E4723–32. doi: 10.1073/pnas.1312540110 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Drayer AL, Van der Kaay J, Mayr GW, Van Haastert PJ. 1994. Role of phospholipase C in Dictyostelium: formation of Inositol 1,4,5-trisphosphate and normal development in cells lacking phospholipase C activity. EMBO J 13:1601–1609. doi: 10.1002/j.1460-2075.1994.tb06423.x [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Leslie NR, Batty IH, Maccario H, Davidson L, Downes CP. 2008. Understanding PTEN regulation: PIP2, polarity and protein stability. Oncogene 27:5464–5476. doi: 10.1038/onc.2008.243 [DOI] [PubMed] [Google Scholar]
46. Tang Y, Gomer RH. 2008. A protein with similarity to PTEN regulates aggregation territory size by decreasing cyclic AMP pulse size during Dictyostelium discoideum development. Eukaryot Cell 7:1758–1770. doi: 10.1128/EC.00210-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Higo T, Hattori M, Nakamura T, Natsume T, Michikawa T, Mikoshiba K. 2005. Subtype-specific and ER lumenal environment-dependent regulation of Inositol 1,4,5-trisphosphate receptor type 1 by Erp44. Cell 120:85–98. doi: 10.1016/j.cell.2004.11.048 [DOI] [PubMed] [Google Scholar]
48. Zoncu R, Efeyan A, Sabatini DM. 2011. mTOR: From growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol 12:21–35. doi: 10.1038/nrm3025 [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Shimobayashi M, Hall MN. 2014. Making new contacts: the mTOR network in metabolism and signalling crosstalk. Nat Rev Mol Cell Biol 15:155–162. doi: 10.1038/nrm3757 [DOI] [PubMed] [Google Scholar]
50. Laplante M, Sabatini DM. 2013. Regulation of mTORC1 and its impact on gene expression at a glance. J Cell Sci 126:1713–1719. doi: 10.1242/jcs.125773 [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Jacinto E, Loewith R, Schmidt A, Lin S, Rüegg MA, Hall A, Hall MN. 2004. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6:1122–1128. doi: 10.1038/ncb1183 [DOI] [PubMed] [Google Scholar]
52. Lee S, Comer FI, Sasaki A, McLeod IX, Duong Y, Okumura K, Yates JR, Parent CA, Firtel RA. 2005. TOR complex 2 integrates cell movement during chemotaxis and signal relay in Dictyostelium. Mol Biol Cell 16:4572–4583. doi: 10.1091/mbc.e05-04-0342 [DOI] [PMC free article] [PubMed] [Google Scholar]
53. Rijal R, Consalvo KM, Lindsey CK, Gomer RH. 2019. An endogenous chemorepellent directs cell movement by inhibiting pseudopods at one side of cells. Mol Biol Cell 30:242–255. doi: 10.1091/mbc.E18-09-0562 [DOI] [PMC free article] [PubMed] [Google Scholar]
54. Baffi TR, Lordén G, Wozniak JM, Feichtner A, Yeung W, Kornev AP, King CC, Del Rio JC, Limaye AJ, Bogomolovas J, Gould CM, Chen J, Kennedy EJ, Kannan N, Gonzalez DJ, Stefan E, Taylor SS, Newton AC. 2021. mTORC2 controls the activity of PKC and AKT by phosphorylating a conserved TOR interaction motif. Sci Signal 14:eabe4509. doi: 10.1126/scisignal.abe4509 [DOI] [PMC free article] [PubMed] [Google Scholar]
55. Stanley RE, Ragusa MJ, Hurley JH. 2014. The beginning of the end: how scaffolds nucleate autophagosome biogenesis. Trends Cell Biol 24:73–81. doi: 10.1016/j.tcb.2013.07.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
56. Zhu Z, Yang C, Iyaswamy A, Krishnamoorthi S, Sreenivasmurthy SG, Liu J, Wang Z, Tong B-K, Song J, Lu J, Cheung K-H, Li M. 2019. Balancing mTOR signaling and autophagy in the treatment of parkinson's disease. Int J Mol Sci 20:728. doi: 10.3390/ijms20030728 [DOI] [PMC free article] [PubMed] [Google Scholar]
57. Mesquita A, Cardenal-Muñoz E, Dominguez E, Muñoz-Braceras S, Nuñez-Corcuera B, Phillips BA, Tábara LC, Xiong Q, Coria R, Eichinger L, Golstein P, King JS, Soldati T, Vincent O, Escalante R. 2017. Autophagy in Dictyostelium: mechanisms, regulation and disease in a simple biomedical model. Autophagy 13:24–40. doi: 10.1080/15548627.2016.1226737 [DOI] [PMC free article] [PubMed] [Google Scholar]
58. Calvo-Garrido J, Carilla-Latorre S, Kubohara Y, Santos-Rodrigo N, Mesquita A, Soldati T, Golstein P, Escalante R. 2010. Autophagy in Dictyostelium: genes and pathways, cell death and infection. Autophagy 6:686–701. doi: 10.4161/auto.6.6.12513 [DOI] [PubMed] [Google Scholar]
59. Evans IR, Ghai PA, Urbančič V, Tan K-L, Wood W. 2013. SCAR/WAVE-mediated processing of engulfed apoptotic corpses is essential for effective macrophage migration in drosophila. Cell Death Differ 20:709–720. doi: 10.1038/cdd.2012.166 [DOI] [PMC free article] [PubMed] [Google Scholar]
60. Park H, Cox D. 2009. Cdc42 regulates FC gamma receptor-mediated Phagocytosis through the activation and Phosphorylation of Wiskott-Aldrich syndrome protein (WASP) and neural-WASP. Mol Biol Cell 20:4500–4508. doi: 10.1091/mbc.e09-03-0230 [DOI] [PMC free article] [PubMed] [Google Scholar]
61. Davidson A, Tyler J, Hume P, Singh V, Koronakis V. 2021. A kinase-independent function of PAK is crucial for pathogen-mediated actin remodelling. PLoS Pathog 17:e1009902. doi: 10.1371/journal.ppat.1009902 [DOI] [PMC free article] [PubMed] [Google Scholar]
62. Grumati P, Dikic I. 2018. Ubiquitin signaling and autophagy. J Biol Chem 293:5404–5413. doi: 10.1074/jbc.TM117.000117 [DOI] [PMC free article] [PubMed] [Google Scholar]
63. Yang Z, Klionsky DJ. 2010. Eaten alive: a history of macroautophagy. Nat Cell Biol 12:814–822. doi: 10.1038/ncb0910-814 [DOI] [PMC free article] [PubMed] [Google Scholar]
64. Mizushima N, Levine B, Cuervo AM, Klionsky DJ. 2008. Autophagy fights disease through cellular self-digestion. Nature 451:1069–1075. doi: 10.1038/nature06639 [DOI] [PMC free article] [PubMed] [Google Scholar]
65. Jia K, Thomas C, Akbar M, Sun Q, Adams-Huet B, Gilpin C, Levine B. 2009. Autophagy genes protect against salmonella typhimurium infection and mediate insulin signaling-regulated pathogen resistance. Proc Natl Acad Sci U S A 106:14564–14569. doi: 10.1073/pnas.0813319106 [DOI] [PMC free article] [PubMed] [Google Scholar]
66. Deretic V. 2011. Autophagy in immunity and cell-autonomous defense against intracellular microbes. Immunol Rev 240:92–104. doi: 10.1111/j.1600-065X.2010.00995.x [DOI] [PMC free article] [PubMed] [Google Scholar]
67. Pflaum K, Gerdes K, Yovo K, Callahan J, Snyder MLD. 2012. Lipopolysaccharide induction of autophagy is associated with enhanced bactericidal activity in Dictyostelium discoideum. Biochem Biophys Res Commun 422:417–422. doi: 10.1016/j.bbrc.2012.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
68. van der Wel N, Hava D, Houben D, Fluitsma D, van Zon M, Pierson J, Brenner M, Peters PJ. 2007. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell 129:1287–1298. doi: 10.1016/j.cell.2007.05.059 [DOI] [PubMed] [Google Scholar]
69. Birmingham CL, Smith AC, Bakowski MA, Yoshimori T, Brumell JH. 2006. Autophagy controls Salmonella infection in response to damage to the Salmonella-containing vacuole. J Biol Chem 281:11374–11383. doi: 10.1074/jbc.M509157200 [DOI] [PubMed] [Google Scholar]
70. Thurston TLM, Wandel MP, von Muhlinen N, Foeglein A, Randow F. 2012. Galectin 8 targets damaged vesicles for autophagy to defend cells against bacterial invasion. Nature 482:414–418. doi: 10.1038/nature10744 [DOI] [PMC free article] [PubMed] [Google Scholar]
71. Varas MA, Riquelme-Barrios S, Valenzuela C, Marcoleta AE, Berríos-Pastén C, Santiviago CA, Chávez FP. 2018. Inorganic polyphosphate is essential for Salmonella typhimurium virulence and survival in Dictyostelium discoideum. Front Cell Infect Microbiol 8:8. doi: 10.3389/fcimb.2018.00008 [DOI] [PMC free article] [PubMed] [Google Scholar]
72. Frankland-Searby S, Bhaumik SR. 2012. The 26S proteasome complex: an attractive target for cancer therapy. Biochim Biophys Acta 1825:64–76. doi: 10.1016/j.bbcan.2011.10.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
73. Fey P, Dodson RJ, Basu S, Chisholm RL. 2013. One stop shop for everything dictyostelium: dictybase and the dicty stock center in 2012, p 59–92. In Eichinger L, Rivero F (ed), Dictyostelium discoideum protocols. Humana Press, Totowa, NJ. doi: 10.1007/978-1-62703-302-2_4 [DOI] [PMC free article] [PubMed] [Google Scholar]
74. Cao X, Yan J, Shu S, Brzostowski JA, Jin T, Van Haastert P. 2014. Arrestins function in cAR1 GPCR-mediated signaling and cAR1 internalization in the development of Dictyostelium discoideum. Mol Biol Cell 25:3210–3221. doi: 10.1091/mbc.E14-03-0834 [DOI] [PMC free article] [PubMed] [Google Scholar]
75. Rivero F, Albrecht R, Dislich H, Bracco E, Graciotti L, Bozzaro S, Noegel AA. 1999. RacF1, a novel member of the Rho protein family in Dictyostelium discoideum, associates transiently with cell contact areas, macropinosomes, and phagosomes. Mol Biol Cell 10:1205–1219. doi: 10.1091/mbc.10.4.1205 [DOI] [PMC free article] [PubMed] [Google Scholar]
76. Somesh BP, Vlahou G, Iijima M, Insall RH, Devreotes P, Rivero F. 2006. Racg regulates morphology, phagocytosis, and chemotaxis. Eukaryot Cell 5:1648–1663. doi: 10.1128/EC.00221-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
77. Somesh BP, Neffgen C, Iijima M, Devreotes P, Rivero F. 2006. Dictyostelium RacH regulates endocytic vesicular trafficking and is required for localization of vacuolin. Traffic 7:1194–1212. doi: 10.1111/j.1600-0854.2006.00455.x [DOI] [PubMed] [Google Scholar]
78. Zhou K, Takegawa K, Emr SD, Firtel RA. 1995. A phosphatidylinositol (PI) kinase gene family in Dictyostelium discoideum: biological roles of putative mammalian P110 and yeast Vps34P PI 3-kinase homologs during growth and development. Mol Cell Biol 15:5645–5656. doi: 10.1128/MCB.15.10.5645 [DOI] [PMC free article] [PubMed] [Google Scholar]
79. Guo K, Nichol R, Skehel P, Dormann D, Weijer CJ, Williams JG, Pears C. 2001. A Dictyostelium nuclear phosphatidylinositol phosphate kinase required for developmental gene expression. EMBO J 20:6017–6027. doi: 10.1093/emboj/20.21.6017 [DOI] [PMC free article] [PubMed] [Google Scholar]
80. Brandon MA, Podgorski GJ. 1997. G alpha 3 regulates the cAMP signaling system in Dictyostelium. Mol Biol Cell 8:1677–1685. doi: 10.1091/mbc.8.9.1677 [DOI] [PMC free article] [PubMed] [Google Scholar]
81. Lilly P, Wu L, Welker DL, Devreotes PN. 1993. A G-protein beta-subunit is essential for Dictyostelium development. Genes Dev 7:986–995. doi: 10.1101/gad.7.6.986 [DOI] [PubMed] [Google Scholar]
82. Wu L, Valkema R, Van Haastert PJ, Devreotes PN. 1995. The G protein beta subunit is essential for multiple responses to chemoattractants in Dictyostelium. J Cell Biol 129:1667–1675. doi: 10.1083/jcb.129.6.1667 [DOI] [PMC free article] [PubMed] [Google Scholar]
83. Lim CJ, Spiegelman GB, Weeks G. 2001. RasC is required for optimal activation of Adenylyl cyclase and Akt/PKB during aggregation. EMBO J 20:4490–4499. doi: 10.1093/emboj/20.16.4490 [DOI] [PMC free article] [PubMed] [Google Scholar]
84. Bolourani P, Spiegelman GB, Weeks G. 2006. Delineation of the roles played by RasG and RasC in cAMP-dependent signal transduction during the early development of Dictyostelium discoideum. Mol Biol Cell 17:4543–4550. doi: 10.1091/mbc.e05-11-1019 [DOI] [PMC free article] [PubMed] [Google Scholar]
85. Traynor D, Milne JL, Insall RH, Kay RR. 2000. Ca2+ signalling is not required for chemotaxis in Dictyostelium. EMBO J 19:4846–4854. doi: 10.1093/emboj/19.17.4846 [DOI] [PMC free article] [PubMed] [Google Scholar]
86. Tang M, Iijima M, Kamimura Y, Chen L, Long Y, Devreotes P. 2011. Disruption of PKB signaling restores polarity to cells lacking tumor suppressor PTEN. Mol Biol Cell 22:437–447. doi: 10.1091/mbc.E10-06-0522 [DOI] [PMC free article] [PubMed] [Google Scholar]
87. Iijima M, Devreotes P. 2002. Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell 109:599–610. doi: 10.1016/s0092-8674(02)00745-6 [DOI] [PubMed] [Google Scholar]
88. Podgorski G, Deering RA. 1984. Thymidine-requiring mutants of Dictyostelium discoideum. Mol Cell Biol 4:2784–2791. doi: 10.1128/mcb.4.12.2784-2791.1984 [DOI] [PMC free article] [PubMed] [Google Scholar]
89. Hadwiger JA, Firtel RA. 1992. Analysis of G alpha 4, a G-protein subunit required for multicellular development in Dictyostelium. Genes Dev 6:38–49. doi: 10.1101/gad.6.1.38 [DOI] [PubMed] [Google Scholar]
90. Ashworth JM, Watts DJ. 1970. Metabolism of the cellular slime mould Dictyostelium discoideum grown in axenic culture. Biochem J 119:175–182. doi: 10.1042/bj1190175 [DOI] [PMC free article] [PubMed] [Google Scholar]
91. Caterina MJ, Milne JL, Devreotes PN. 1994. Mutation of the third intracellular loop of the cAMP receptor, CAR1, of Dictyostelium yields mutants impaired in multiple signaling pathways. J Biol Chem 269:1523–1532. doi: 10.1016/S0021-9258(17)42288-5 [DOI] [PubMed] [Google Scholar]
92. Nellen W, Silan C, Firtel RA. 1984. DNA-mediated transformation in Dictyostelium discoideum: regulated expression of an actin gene fusion. Mol Cell Biol 4:2890–2898. doi: 10.1128/mcb.4.12.2890-2898.1984 [DOI] [PMC free article] [PubMed] [Google Scholar]
93. Loomis WF. 1971. Sensitivity of Dictyostelium discoideum to nucleic acid analogues. Exp Cell Res 64:484–486. doi: 10.1016/0014-4827(71)90107-8 [DOI] [PubMed] [Google Scholar]
94. Luo HR, Huang YE, Chen JC, Saiardi A, Iijima M, Ye K, Huang Y, Nagata E, Devreotes P, Snyder SH. 2003. Inositol pyrophosphates mediate chemotaxis in Dictyostelium via pleckstrin homology domain-Ptdins(3,4,5)P3 interactions. Cell 114:559–572. doi: 10.1016/s0092-8674(03)00640-8 [DOI] [PubMed] [Google Scholar]
95. Garcia M, Ray S, Brown I, Irom J, Brazill D. 2014. PakD, a putative P21-activated protein kinase in Dictyostelium discoideum, regulates actin. Eukaryot Cell 13:119–126. doi: 10.1128/EC.00216-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
96. Meili R, Ellsworth C, Firtel RA. 2000. A novel Akt/PKB-related kinase is essential for morphogenesis in Dictyostelium. Curr Biol 10:708–717. doi: 10.1016/s0960-9822(00)00536-4 [DOI] [PubMed] [Google Scholar]
97. Mann SKO, Firtel RA. 1991. A developmentally regulated, putative serine/threonine protein kinase is essential for development in Dictyostelium. Mech Dev 35:89–101. doi: 10.1016/0925-4773(91)90060-j [DOI] [PubMed] [Google Scholar]
98. Davidson AJ, Amato C, Thomason PA, Insall RH. 2018. WASP family proteins and formins compete in pseudopod- and bleb-based migration. J Cell Biol 217:701–714. doi: 10.1083/jcb.201705160 [DOI] [PMC free article] [PubMed] [Google Scholar]
99. Otto GP, Wu MY, Clarke M, Lu H, Anderson OR, Hilbi H, Shuman HA, Kessin RH. 2004. Macroautophagy is dispensable for intracellular replication of legionella pneumophila in Dictyostelium discoideum. Mol Microbiol 51:63–72. doi: 10.1046/j.1365-2958.2003.03826.x [DOI] [PubMed] [Google Scholar]
100. King JS, Gueho A, Hagedorn M, Gopaldass N, Leuba F, Soldati T, Insall RH, Parent C. 2013. WASH is required for lysosomal recycling and efficient autophagic and phagocytic digestion. Mol Biol Cell 24:2714–2726. doi: 10.1091/mbc.E13-02-0092 [DOI] [PMC free article] [PubMed] [Google Scholar]
101. Otto GP, Wu MY, Kazgan N, Anderson OR, Kessin RH. 2004. Dictyostelium macroautophagy mutants vary in the severity of their developmental defects. J Biol Chem 279:15621–15629. doi: 10.1074/jbc.M311139200 [DOI] [PubMed] [Google Scholar]
102. Otto GP, Wu MY, Kazgan N, Anderson OR, Kessin RH. 2003. Macroautophagy is required for multicellular development of the social amoeba Dictyostelium discoideum. J Biol Chem 278:17636–17645. doi: 10.1074/jbc.M212467200 [DOI] [PubMed] [Google Scholar]
103. Müller-Taubenberger A, Lupas AN, Li H, Ecke M, Simmeth E, Gerisch G. 2001. Calreticulin and calnexin in the endoplasmic reticulum are important for phagocytosis. EMBO J 20:6772–6782. doi: 10.1093/emboj/20.23.6772 [DOI] [PMC free article] [PubMed] [Google Scholar]
104. Masud Rana Aykm, Tsujioka M, Miyagishima S, Ueda M, Yumura S. 2013. Dynamin contributes to cytokinesis by stabilizing actin filaments in the contractile ring. Genes Cells 18:621–635. doi: 10.1111/gtc.12060 [DOI] [PubMed] [Google Scholar]
105. Fey P, Kowal AS, Gaudet P, Pilcher KE, Chisholm RL. 2007. Protocols for growth and development of Dictyostelium discoideum. Nat Protoc 2:1307–1316. doi: 10.1038/nprot.2007.178 [DOI] [PubMed] [Google Scholar]
106. Kapellos TS, Taylor L, Lee H, Cowley SA, James WS, Iqbal AJ, Greaves DR. 2016. A novel real time imaging platform to quantify macrophage phagocytosis. Biochem Pharmacol 116:107–119. doi: 10.1016/j.bcp.2016.07.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
107. Laasmaa M, Vendelin M, Peterson P. 2011. Application of regularized richardson-lucy algorithm for deconvolution of confocal microscopy images. J Microsc 243:124–140. doi: 10.1111/j.1365-2818.2011.03486.x [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Figures. mbio.01939-23-s0001.docx.

Fig. S1-S3.

Click here for additional data file.^{(385.3KB, docx)}

DOI: 10.1128/mbio.01939-23.SuF1

Data Availability Statement

[B1] 1. Kulaev IS, Vagabov VM. 1983. Polyphosphate metabolism in micro-organisms. Adv Microb Physiol 24:83–171. doi: 10.1016/s0065-2911(08)60385-9 [DOI] [PubMed] [Google Scholar]

[B2] 2. Zhang H, Gómez-García MR, Shi X, Rao NN, Kornberg A. 2007. Polyphosphate kinase 1, a conserved bacterial enzyme, in a eukaryote, Dictyostelium discoideum, with a role in cytokinesis. Proc Natl Acad Sci U S A 104:16486–16491. doi: 10.1073/pnas.0706847104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3. Fraley CD, Rashid MH, Lee SSK, Gottschalk R, Harrison J, Wood PJ, Brown MRW, Kornberg A. 2007. A polyphosphate kinase 1 (ppk1) mutant of Pseudomonas aeruginosa exhibits multiple ultrastructural and functional defects. Proc Natl Acad Sci U S A 104:3526–3531. doi: 10.1073/pnas.0609733104 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Rashid MH, Rumbaugh K, Passador L, Davies DG, Hamood AN, Iglewski BH, Kornberg A. 2000. Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 97:9636–9641. doi: 10.1073/pnas.170283397 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B5] 5. Crooke E, Akiyama M, Rao NN, Kornberg A. 1994. Genetically altered levels of inorganic polyphosphate in Escherichia coli. J Biol Chem 269:6290–6295. [PubMed] [Google Scholar]

[B6] 6. Gautam LK, Sharma P, Capalash N. 2019. Bacterial polyphosphate kinases revisited: role in pathogenesis and therapeutic potential. Curr Drug Targets 20:292–301. doi: 10.2174/1389450119666180801120231 [DOI] [PubMed] [Google Scholar]

[B7] 7. Morrissey JH, Smith SA. 2015. Polyphosphate as modulator of hemostasis, thrombosis, and inflammation. J Thromb Haemost 13 Suppl 1:S92–7. doi: 10.1111/jth.12896 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Chrysanthopoulou A, Kambas K, Stakos D, Mitroulis I, Mitsios A, Vidali V, Angelidou I, Bochenek M, Arelaki S, Arampatzioglou A, Galani I-E, Skendros P, Couladouros EA, Konstantinides S, Andreakos E, Schäfer K, Ritis K. 2017. Interferon lambda1/IL-29 and inorganic polyphosphate are novel regulators of neutrophil-driven thromboinflammation. J Pathol 243:111–122. doi: 10.1002/path.4935 [DOI] [PubMed] [Google Scholar]

[B9] 9. Suess PM, Chinea LE, Pilling D, Gomer RH. 2019. Extracellular polyphosphate promotes macrophage and fibrocyte differentiation, inhibits leukocyte proliferation, and acts as a chemotactic agent for neutrophils. J Immunol 203:493–499. doi: 10.4049/jimmunol.1801559 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Terashima-Hasegawa M, Ashino T, Kawazoe Y, Shiba T, Manabe A, Numazawa S. 2019. Inorganic polyphosphate protects against lipopolysaccharide-induced lethality and tissue injury through regulation of macrophage recruitment. Biochem Pharmacol 159:96–105. doi: 10.1016/j.bcp.2018.11.017 [DOI] [PubMed] [Google Scholar]

[B11] 11. Dinarvand P, Hassanian SM, Qureshi SH, Manithody C, Eissenberg JC, Yang L, Rezaie AR. 2014. Polyphosphate amplifies proinflammatory responses of nuclear proteins through interaction with receptor for advanced glycation end products and P2Y1 purinergic receptor. Blood 123:935–945. doi: 10.1182/blood-2013-09-529602 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Holmström KM, Marina N, Baev AY, Wood NW, Gourine AV, Abramov AY. 2013. Signalling properties of inorganic polyphosphate in the mammalian brain. Nat Commun 4:1362. doi: 10.1038/ncomms2364 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Pauwels A-M, Trost M, Beyaert R, Hoffmann E. 2017. Patterns, receptors, and signals: regulation of phagosome maturation. Trends Immunol 38:407–422. doi: 10.1016/j.it.2017.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Neuhaus EM, Almers W, Soldati T. 2002. Morphology and dynamics of the endocytic pathway in Dictyostelium discoideum. Mol Biol Cell 13:1390–1407. doi: 10.1091/mbc.01-08-0392 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Vergne I, Chua J, Singh SB, Deretic V. 2004. Cell biology of mycobacterium tuberculosis phagosome. Annu Rev Cell Dev Biol 20:367–394. doi: 10.1146/annurev.cellbio.20.010403.114015 [DOI] [PubMed] [Google Scholar]

[B16] 16. Rijal R, Cadena LA, Smith MR, Carr JF, Gomer RH. 2020. Polyphosphate is an extracellular signal that can facilitate bacterial survival in eukaryotic cells. Proc Natl Acad Sci U S A 117:31923–31934. doi: 10.1073/pnas.2012009117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Roewe J, Stavrides G, Strueve M, Sharma A, Marini F, Mann A, Smith SA, Kaya Z, Strobl B, Mueller M, Reinhardt C, Morrissey JH, Bosmann M. 2020. Bacterial polyphosphates interfere with the innate host defense to infection. Nat Commun 11:4035. doi: 10.1038/s41467-020-17639-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18. Wurst H, Kornberg A. 1994. A soluble exopolyphosphatase of saccharomyces cerevisiae purification and characterization. J Biol Chem 269:10996–11001. [PubMed] [Google Scholar]

[B19] 19. Cardelli J. 2001. Phagocytosis and macropinocytosis in Dictyostelium: phosphoinositide-based processes, biochemically distinct. Traffic 2:311–320. doi: 10.1034/j.1600-0854.2001.002005311.x [DOI] [PubMed] [Google Scholar]

[B20] 20. Vuillemin P. 1903. Une acrasiee bacteriophage. Comptes rendus des s eances de l’Acad emie des sciences de Paris, Vol. 137, p 387–389. [Google Scholar]

[B21] 21. Cosson P, Soldati T. 2008. Eat, kill or die: when amoeba meets bacteria. Curr Opin Microbiol 11:271–276. doi: 10.1016/j.mib.2008.05.005 [DOI] [PubMed] [Google Scholar]

[B22] 22. Martín-González J, Montero-Bullón J-F, Lacal J. 2021. Dictyostelium discoideum as a non-mammalian biomedical model. Microb Biotechnol 14:111–125. doi: 10.1111/1751-7915.13692 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Suess PM, Gomer RH. 2016. Extracellular polyphosphate inhibits proliferation in an autocrine negative feedback loop in Dictyostelium discoideum. J Biol Chem 291:20260–20269. doi: 10.1074/jbc.M116.737825 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24. Suess PM, Tang Y, Gomer RH. 2019. The putative G protein-coupled receptor GrlD mediates extracellular polyphosphate sensing in Dictyostelium discoideum. Mol Biol Cell 30:1118–1128. doi: 10.1091/mbc.E18-10-0686 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Tang Y, Rijal R, Zimmerhanzel DE, McCullough JR, Cadena LA, Gomer RH, Heitman J. 2021. An autocrine negative feedback loop inhibits Dictyostelium discoideum proliferation through pathways including IP3/Ca(2). mBio 12:e0134721. doi: 10.1128/mBio.01347-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26. Rijal R, Kirolos SA, Rahman RJ, Gomer RH. 2022. Dictyostelium discoideum cells retain nutrients when the cells are about to outgrow their food source. J Cell Sci 135:jcs260107. doi: 10.1242/jcs.260107 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Vaudaux P, Waldvogel FA. 1979. Gentamicin antibacterial activity in the presence of human polymorphonuclear leukocytes. Antimicrob Agents Chemother 16:743–749. doi: 10.1128/AAC.16.6.743 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Bloomfield G, Tanaka Y, Skelton J, Ivens A, Kay RR. 2008. Widespread duplications in the genomes of laboratory stocks of Dictyostelium discoideum. Genome Biol 9:R75. doi: 10.1186/gb-2008-9-4-r75 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Carman CV, Benovic JL. 1998. G-protein-coupled receptors: turn-ons and turn-offs. Curr Opin Neurobiol 8:335–344. doi: 10.1016/s0959-4388(98)80058-5 [DOI] [PubMed] [Google Scholar]

[B30] 30. Aubry L, Klein G. 2013. Chapter two ‐ true arrestins and arrestin-fold proteins: a structure-based appraisal. Prog Mol Biol Transl Sci 118:21–56. doi: 10.1016/B978-0-12-394440-5.00002-4 [DOI] [PubMed] [Google Scholar]

[B31] 31. Gurevich VV, Gurevich EV. 2019. GPCR signaling regulation: the role of GRKs and arrestins. Front Pharmacol 10:125. doi: 10.3389/fphar.2019.00125 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32. Moore CAC, Milano SK, Benovic JL. 2007. Regulation of receptor trafficking by GRKs and arrestins. Annu Rev Physiol 69:451–482. doi: 10.1146/annurev.physiol.69.022405.154712 [DOI] [PubMed] [Google Scholar]

[B33] 33. Shenoy SK, Lefkowitz RJ. 2011. β-Arrestin-mediated receptor trafficking and signal transduction. Trends Pharmacol Sci 32:521–533. doi: 10.1016/j.tips.2011.05.002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Aubry L, Guetta D, Klein G. 2009. The arrestin fold: variations on a theme. Curr Genomics 10:133–142. doi: 10.2174/138920209787847014 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Ahn K, Kornberg A. 1990. Polyphosphate kinase from Escherichia coli. purification and demonstration of a phosphoenzyme intermediate. J Biol Chem 265:11734–11739. [PubMed] [Google Scholar]

[B36] 36. Livermore TM, Chubb JR, Saiardi A. 2016. Developmental accumulation of inorganic polyphosphate affects germination and energetic metabolism in Dictyostelium discoideum. Proc Natl Acad Sci U S A 113:996–1001. doi: 10.1073/pnas.1519440113 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37. Pisani F, Livermore T, Rose G, Chubb JR, Gaspari M, Saiardi A, Soldati T. 2014. Analysis of Dictyostelium discoideum Inositol pyrophosphate metabolism by GEL electrophoresis. PLoS ONE 9:e85533. doi: 10.1371/journal.pone.0085533 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Wilkins A, Insall RH. 2001. Small GTPases in Dictyostelium: lessons from a social amoeba. Trends Genet 17:41–48. doi: 10.1016/s0168-9525(00)02181-8 [DOI] [PubMed] [Google Scholar]

[B39] 39. Forbes G, Schilde C, Lawal H, Kin K, Du Q, Chen Z-H, Rivero F, Schaap P. 2022. Interactome and evolutionary conservation of dictyostelid small GTPases and their direct regulators. Small GTPases 13:239–254. doi: 10.1080/21541248.2021.1984829 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Suess PM, Watson J, Chen W, Gomer RH. 2017. Extracellular polyphosphate signals through Ras and AKT to prime Dictyostelium discoideum cells for development. J Cell Sci 130:2394–2404. doi: 10.1242/jcs.203372 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B41] 41. Huynh KK, Grinstein S. 2008. Phagocytosis: dynamin's dual role in phagosome biogenesis. Curr Biol 18:R563–5. doi: 10.1016/j.cub.2008.05.032 [DOI] [PubMed] [Google Scholar]

[B42] 42. Sundborger AC, Hinshaw JE. 2014. Regulating dynamin dynamics during endocytosis. F1000Prime Rep 6:85. doi: 10.12703/P6-85 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Wang Y, Senoo H, Sesaki H, Iijima M. 2013. Rho GTPases orient directional sensing in chemotaxis. Proc Natl Acad Sci U S A 110:E4723–32. doi: 10.1073/pnas.1312540110 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Drayer AL, Van der Kaay J, Mayr GW, Van Haastert PJ. 1994. Role of phospholipase C in Dictyostelium: formation of Inositol 1,4,5-trisphosphate and normal development in cells lacking phospholipase C activity. EMBO J 13:1601–1609. doi: 10.1002/j.1460-2075.1994.tb06423.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45. Leslie NR, Batty IH, Maccario H, Davidson L, Downes CP. 2008. Understanding PTEN regulation: PIP2, polarity and protein stability. Oncogene 27:5464–5476. doi: 10.1038/onc.2008.243 [DOI] [PubMed] [Google Scholar]

[B46] 46. Tang Y, Gomer RH. 2008. A protein with similarity to PTEN regulates aggregation territory size by decreasing cyclic AMP pulse size during Dictyostelium discoideum development. Eukaryot Cell 7:1758–1770. doi: 10.1128/EC.00210-08 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Higo T, Hattori M, Nakamura T, Natsume T, Michikawa T, Mikoshiba K. 2005. Subtype-specific and ER lumenal environment-dependent regulation of Inositol 1,4,5-trisphosphate receptor type 1 by Erp44. Cell 120:85–98. doi: 10.1016/j.cell.2004.11.048 [DOI] [PubMed] [Google Scholar]

[B48] 48. Zoncu R, Efeyan A, Sabatini DM. 2011. mTOR: From growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol 12:21–35. doi: 10.1038/nrm3025 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49. Shimobayashi M, Hall MN. 2014. Making new contacts: the mTOR network in metabolism and signalling crosstalk. Nat Rev Mol Cell Biol 15:155–162. doi: 10.1038/nrm3757 [DOI] [PubMed] [Google Scholar]

[B50] 50. Laplante M, Sabatini DM. 2013. Regulation of mTORC1 and its impact on gene expression at a glance. J Cell Sci 126:1713–1719. doi: 10.1242/jcs.125773 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51. Jacinto E, Loewith R, Schmidt A, Lin S, Rüegg MA, Hall A, Hall MN. 2004. Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive. Nat Cell Biol 6:1122–1128. doi: 10.1038/ncb1183 [DOI] [PubMed] [Google Scholar]

[B52] 52. Lee S, Comer FI, Sasaki A, McLeod IX, Duong Y, Okumura K, Yates JR, Parent CA, Firtel RA. 2005. TOR complex 2 integrates cell movement during chemotaxis and signal relay in Dictyostelium. Mol Biol Cell 16:4572–4583. doi: 10.1091/mbc.e05-04-0342 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53. Rijal R, Consalvo KM, Lindsey CK, Gomer RH. 2019. An endogenous chemorepellent directs cell movement by inhibiting pseudopods at one side of cells. Mol Biol Cell 30:242–255. doi: 10.1091/mbc.E18-09-0562 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54. Baffi TR, Lordén G, Wozniak JM, Feichtner A, Yeung W, Kornev AP, King CC, Del Rio JC, Limaye AJ, Bogomolovas J, Gould CM, Chen J, Kennedy EJ, Kannan N, Gonzalez DJ, Stefan E, Taylor SS, Newton AC. 2021. mTORC2 controls the activity of PKC and AKT by phosphorylating a conserved TOR interaction motif. Sci Signal 14:eabe4509. doi: 10.1126/scisignal.abe4509 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55. Stanley RE, Ragusa MJ, Hurley JH. 2014. The beginning of the end: how scaffolds nucleate autophagosome biogenesis. Trends Cell Biol 24:73–81. doi: 10.1016/j.tcb.2013.07.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56. Zhu Z, Yang C, Iyaswamy A, Krishnamoorthi S, Sreenivasmurthy SG, Liu J, Wang Z, Tong B-K, Song J, Lu J, Cheung K-H, Li M. 2019. Balancing mTOR signaling and autophagy in the treatment of parkinson's disease. Int J Mol Sci 20:728. doi: 10.3390/ijms20030728 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57. Mesquita A, Cardenal-Muñoz E, Dominguez E, Muñoz-Braceras S, Nuñez-Corcuera B, Phillips BA, Tábara LC, Xiong Q, Coria R, Eichinger L, Golstein P, King JS, Soldati T, Vincent O, Escalante R. 2017. Autophagy in Dictyostelium: mechanisms, regulation and disease in a simple biomedical model. Autophagy 13:24–40. doi: 10.1080/15548627.2016.1226737 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58. Calvo-Garrido J, Carilla-Latorre S, Kubohara Y, Santos-Rodrigo N, Mesquita A, Soldati T, Golstein P, Escalante R. 2010. Autophagy in Dictyostelium: genes and pathways, cell death and infection. Autophagy 6:686–701. doi: 10.4161/auto.6.6.12513 [DOI] [PubMed] [Google Scholar]

[B59] 59. Evans IR, Ghai PA, Urbančič V, Tan K-L, Wood W. 2013. SCAR/WAVE-mediated processing of engulfed apoptotic corpses is essential for effective macrophage migration in drosophila. Cell Death Differ 20:709–720. doi: 10.1038/cdd.2012.166 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60. Park H, Cox D. 2009. Cdc42 regulates FC gamma receptor-mediated Phagocytosis through the activation and Phosphorylation of Wiskott-Aldrich syndrome protein (WASP) and neural-WASP. Mol Biol Cell 20:4500–4508. doi: 10.1091/mbc.e09-03-0230 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B61] 61. Davidson A, Tyler J, Hume P, Singh V, Koronakis V. 2021. A kinase-independent function of PAK is crucial for pathogen-mediated actin remodelling. PLoS Pathog 17:e1009902. doi: 10.1371/journal.ppat.1009902 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B62] 62. Grumati P, Dikic I. 2018. Ubiquitin signaling and autophagy. J Biol Chem 293:5404–5413. doi: 10.1074/jbc.TM117.000117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B63] 63. Yang Z, Klionsky DJ. 2010. Eaten alive: a history of macroautophagy. Nat Cell Biol 12:814–822. doi: 10.1038/ncb0910-814 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B64] 64. Mizushima N, Levine B, Cuervo AM, Klionsky DJ. 2008. Autophagy fights disease through cellular self-digestion. Nature 451:1069–1075. doi: 10.1038/nature06639 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B65] 65. Jia K, Thomas C, Akbar M, Sun Q, Adams-Huet B, Gilpin C, Levine B. 2009. Autophagy genes protect against salmonella typhimurium infection and mediate insulin signaling-regulated pathogen resistance. Proc Natl Acad Sci U S A 106:14564–14569. doi: 10.1073/pnas.0813319106 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B66] 66. Deretic V. 2011. Autophagy in immunity and cell-autonomous defense against intracellular microbes. Immunol Rev 240:92–104. doi: 10.1111/j.1600-065X.2010.00995.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[B67] 67. Pflaum K, Gerdes K, Yovo K, Callahan J, Snyder MLD. 2012. Lipopolysaccharide induction of autophagy is associated with enhanced bactericidal activity in Dictyostelium discoideum. Biochem Biophys Res Commun 422:417–422. doi: 10.1016/j.bbrc.2012.05.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B68] 68. van der Wel N, Hava D, Houben D, Fluitsma D, van Zon M, Pierson J, Brenner M, Peters PJ. 2007. M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells. Cell 129:1287–1298. doi: 10.1016/j.cell.2007.05.059 [DOI] [PubMed] [Google Scholar]

[B69] 69. Birmingham CL, Smith AC, Bakowski MA, Yoshimori T, Brumell JH. 2006. Autophagy controls Salmonella infection in response to damage to the Salmonella-containing vacuole. J Biol Chem 281:11374–11383. doi: 10.1074/jbc.M509157200 [DOI] [PubMed] [Google Scholar]

[B70] 70. Thurston TLM, Wandel MP, von Muhlinen N, Foeglein A, Randow F. 2012. Galectin 8 targets damaged vesicles for autophagy to defend cells against bacterial invasion. Nature 482:414–418. doi: 10.1038/nature10744 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B71] 71. Varas MA, Riquelme-Barrios S, Valenzuela C, Marcoleta AE, Berríos-Pastén C, Santiviago CA, Chávez FP. 2018. Inorganic polyphosphate is essential for Salmonella typhimurium virulence and survival in Dictyostelium discoideum. Front Cell Infect Microbiol 8:8. doi: 10.3389/fcimb.2018.00008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B72] 72. Frankland-Searby S, Bhaumik SR. 2012. The 26S proteasome complex: an attractive target for cancer therapy. Biochim Biophys Acta 1825:64–76. doi: 10.1016/j.bbcan.2011.10.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B73] 73. Fey P, Dodson RJ, Basu S, Chisholm RL. 2013. One stop shop for everything dictyostelium: dictybase and the dicty stock center in 2012, p 59–92. In Eichinger L, Rivero F (ed), Dictyostelium discoideum protocols. Humana Press, Totowa, NJ. doi: 10.1007/978-1-62703-302-2_4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B74] 74. Cao X, Yan J, Shu S, Brzostowski JA, Jin T, Van Haastert P. 2014. Arrestins function in cAR1 GPCR-mediated signaling and cAR1 internalization in the development of Dictyostelium discoideum. Mol Biol Cell 25:3210–3221. doi: 10.1091/mbc.E14-03-0834 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B75] 75. Rivero F, Albrecht R, Dislich H, Bracco E, Graciotti L, Bozzaro S, Noegel AA. 1999. RacF1, a novel member of the Rho protein family in Dictyostelium discoideum, associates transiently with cell contact areas, macropinosomes, and phagosomes. Mol Biol Cell 10:1205–1219. doi: 10.1091/mbc.10.4.1205 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B76] 76. Somesh BP, Vlahou G, Iijima M, Insall RH, Devreotes P, Rivero F. 2006. Racg regulates morphology, phagocytosis, and chemotaxis. Eukaryot Cell 5:1648–1663. doi: 10.1128/EC.00221-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B77] 77. Somesh BP, Neffgen C, Iijima M, Devreotes P, Rivero F. 2006. Dictyostelium RacH regulates endocytic vesicular trafficking and is required for localization of vacuolin. Traffic 7:1194–1212. doi: 10.1111/j.1600-0854.2006.00455.x [DOI] [PubMed] [Google Scholar]

[B78] 78. Zhou K, Takegawa K, Emr SD, Firtel RA. 1995. A phosphatidylinositol (PI) kinase gene family in Dictyostelium discoideum: biological roles of putative mammalian P110 and yeast Vps34P PI 3-kinase homologs during growth and development. Mol Cell Biol 15:5645–5656. doi: 10.1128/MCB.15.10.5645 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B79] 79. Guo K, Nichol R, Skehel P, Dormann D, Weijer CJ, Williams JG, Pears C. 2001. A Dictyostelium nuclear phosphatidylinositol phosphate kinase required for developmental gene expression. EMBO J 20:6017–6027. doi: 10.1093/emboj/20.21.6017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B80] 80. Brandon MA, Podgorski GJ. 1997. G alpha 3 regulates the cAMP signaling system in Dictyostelium. Mol Biol Cell 8:1677–1685. doi: 10.1091/mbc.8.9.1677 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B81] 81. Lilly P, Wu L, Welker DL, Devreotes PN. 1993. A G-protein beta-subunit is essential for Dictyostelium development. Genes Dev 7:986–995. doi: 10.1101/gad.7.6.986 [DOI] [PubMed] [Google Scholar]

[B82] 82. Wu L, Valkema R, Van Haastert PJ, Devreotes PN. 1995. The G protein beta subunit is essential for multiple responses to chemoattractants in Dictyostelium. J Cell Biol 129:1667–1675. doi: 10.1083/jcb.129.6.1667 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B83] 83. Lim CJ, Spiegelman GB, Weeks G. 2001. RasC is required for optimal activation of Adenylyl cyclase and Akt/PKB during aggregation. EMBO J 20:4490–4499. doi: 10.1093/emboj/20.16.4490 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B84] 84. Bolourani P, Spiegelman GB, Weeks G. 2006. Delineation of the roles played by RasG and RasC in cAMP-dependent signal transduction during the early development of Dictyostelium discoideum. Mol Biol Cell 17:4543–4550. doi: 10.1091/mbc.e05-11-1019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B85] 85. Traynor D, Milne JL, Insall RH, Kay RR. 2000. Ca2+ signalling is not required for chemotaxis in Dictyostelium. EMBO J 19:4846–4854. doi: 10.1093/emboj/19.17.4846 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B86] 86. Tang M, Iijima M, Kamimura Y, Chen L, Long Y, Devreotes P. 2011. Disruption of PKB signaling restores polarity to cells lacking tumor suppressor PTEN. Mol Biol Cell 22:437–447. doi: 10.1091/mbc.E10-06-0522 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B87] 87. Iijima M, Devreotes P. 2002. Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell 109:599–610. doi: 10.1016/s0092-8674(02)00745-6 [DOI] [PubMed] [Google Scholar]

[B88] 88. Podgorski G, Deering RA. 1984. Thymidine-requiring mutants of Dictyostelium discoideum. Mol Cell Biol 4:2784–2791. doi: 10.1128/mcb.4.12.2784-2791.1984 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B89] 89. Hadwiger JA, Firtel RA. 1992. Analysis of G alpha 4, a G-protein subunit required for multicellular development in Dictyostelium. Genes Dev 6:38–49. doi: 10.1101/gad.6.1.38 [DOI] [PubMed] [Google Scholar]

[B90] 90. Ashworth JM, Watts DJ. 1970. Metabolism of the cellular slime mould Dictyostelium discoideum grown in axenic culture. Biochem J 119:175–182. doi: 10.1042/bj1190175 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B91] 91. Caterina MJ, Milne JL, Devreotes PN. 1994. Mutation of the third intracellular loop of the cAMP receptor, CAR1, of Dictyostelium yields mutants impaired in multiple signaling pathways. J Biol Chem 269:1523–1532. doi: 10.1016/S0021-9258(17)42288-5 [DOI] [PubMed] [Google Scholar]

[B92] 92. Nellen W, Silan C, Firtel RA. 1984. DNA-mediated transformation in Dictyostelium discoideum: regulated expression of an actin gene fusion. Mol Cell Biol 4:2890–2898. doi: 10.1128/mcb.4.12.2890-2898.1984 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B93] 93. Loomis WF. 1971. Sensitivity of Dictyostelium discoideum to nucleic acid analogues. Exp Cell Res 64:484–486. doi: 10.1016/0014-4827(71)90107-8 [DOI] [PubMed] [Google Scholar]

[B94] 94. Luo HR, Huang YE, Chen JC, Saiardi A, Iijima M, Ye K, Huang Y, Nagata E, Devreotes P, Snyder SH. 2003. Inositol pyrophosphates mediate chemotaxis in Dictyostelium via pleckstrin homology domain-Ptdins(3,4,5)P3 interactions. Cell 114:559–572. doi: 10.1016/s0092-8674(03)00640-8 [DOI] [PubMed] [Google Scholar]

[B95] 95. Garcia M, Ray S, Brown I, Irom J, Brazill D. 2014. PakD, a putative P21-activated protein kinase in Dictyostelium discoideum, regulates actin. Eukaryot Cell 13:119–126. doi: 10.1128/EC.00216-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B96] 96. Meili R, Ellsworth C, Firtel RA. 2000. A novel Akt/PKB-related kinase is essential for morphogenesis in Dictyostelium. Curr Biol 10:708–717. doi: 10.1016/s0960-9822(00)00536-4 [DOI] [PubMed] [Google Scholar]

[B97] 97. Mann SKO, Firtel RA. 1991. A developmentally regulated, putative serine/threonine protein kinase is essential for development in Dictyostelium. Mech Dev 35:89–101. doi: 10.1016/0925-4773(91)90060-j [DOI] [PubMed] [Google Scholar]

[B98] 98. Davidson AJ, Amato C, Thomason PA, Insall RH. 2018. WASP family proteins and formins compete in pseudopod- and bleb-based migration. J Cell Biol 217:701–714. doi: 10.1083/jcb.201705160 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B99] 99. Otto GP, Wu MY, Clarke M, Lu H, Anderson OR, Hilbi H, Shuman HA, Kessin RH. 2004. Macroautophagy is dispensable for intracellular replication of legionella pneumophila in Dictyostelium discoideum. Mol Microbiol 51:63–72. doi: 10.1046/j.1365-2958.2003.03826.x [DOI] [PubMed] [Google Scholar]

[B100] 100. King JS, Gueho A, Hagedorn M, Gopaldass N, Leuba F, Soldati T, Insall RH, Parent C. 2013. WASH is required for lysosomal recycling and efficient autophagic and phagocytic digestion. Mol Biol Cell 24:2714–2726. doi: 10.1091/mbc.E13-02-0092 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B101] 101. Otto GP, Wu MY, Kazgan N, Anderson OR, Kessin RH. 2004. Dictyostelium macroautophagy mutants vary in the severity of their developmental defects. J Biol Chem 279:15621–15629. doi: 10.1074/jbc.M311139200 [DOI] [PubMed] [Google Scholar]

[B102] 102. Otto GP, Wu MY, Kazgan N, Anderson OR, Kessin RH. 2003. Macroautophagy is required for multicellular development of the social amoeba Dictyostelium discoideum. J Biol Chem 278:17636–17645. doi: 10.1074/jbc.M212467200 [DOI] [PubMed] [Google Scholar]

[B103] 103. Müller-Taubenberger A, Lupas AN, Li H, Ecke M, Simmeth E, Gerisch G. 2001. Calreticulin and calnexin in the endoplasmic reticulum are important for phagocytosis. EMBO J 20:6772–6782. doi: 10.1093/emboj/20.23.6772 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B104] 104. Masud Rana Aykm, Tsujioka M, Miyagishima S, Ueda M, Yumura S. 2013. Dynamin contributes to cytokinesis by stabilizing actin filaments in the contractile ring. Genes Cells 18:621–635. doi: 10.1111/gtc.12060 [DOI] [PubMed] [Google Scholar]

[B105] 105. Fey P, Kowal AS, Gaudet P, Pilcher KE, Chisholm RL. 2007. Protocols for growth and development of Dictyostelium discoideum. Nat Protoc 2:1307–1316. doi: 10.1038/nprot.2007.178 [DOI] [PubMed] [Google Scholar]

[B106] 106. Kapellos TS, Taylor L, Lee H, Cowley SA, James WS, Iqbal AJ, Greaves DR. 2016. A novel real time imaging platform to quantify macrophage phagocytosis. Biochem Pharmacol 116:107–119. doi: 10.1016/j.bcp.2016.07.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B107] 107. Laasmaa M, Vendelin M, Peterson P. 2011. Application of regularized richardson-lucy algorithm for deconvolution of confocal microscopy images. J Microsc 243:124–140. doi: 10.1111/j.1365-2818.2011.03486.x [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Polyphosphate uses mTOR, pyrophosphate, and Rho GTPase components to potentiate bacterial survival in Dictyostelium

Ryan J Rahman

Ramesh Rijal

Shiyu Jing

Te-An Chen

Issam Ismail

Richard H Gomer

Roles

ABSTRACT

IMPORTANCE

INTRODUCTION

RESULTS

PolyP requires a G protein-coupled receptor but does not require G-protein subunits to potentiate the survival of Escherichia coli in D. discoideum

TABLE 1.

Fig 1.

Fig 2.

PolyP requires the arrestin domain containing protein AdcB to potentiate E. coli survival

PolyP requires an inositol hexakisphosphate kinase to potentiate E. coli survival

PolyP requires the Rho GTPase RacE to potentiate E. coli survival

PolyP does not require several PLC/IP3 pathway components to potentiate E. coli survival

PolyP requires the TOR complex protein Lst8 to potentiate E. coli survival

PolyP does not require the autophagy proteins Atg6 and Atg7 to potentiate E. coli survival

PolyP does not require selected cytoskeletal proteins to potentiate E. coli survival

Defective polyP sensitivity is not due to a defect in the parental strain or defective phagocytosis

PolyP inhibits proteasome activity

Fig 3.

PolyP requires AdcB and Lst8 to inhibit cell proliferation

Fig 4.

DISCUSSION

Fig 5.

Contact for reagent and resource sharing

MATERIALS AND METHODS

D. discoideum cell culture

Polyphosphate preparation

Bacterial survival assay and phagocytosis

Genotype verification

TABLE 2.

Immunoblotting

Proteasome activity assay

Proliferation inhibition

Statistical analysis

ACKNOWLEDGMENTS

Contributor Information

DATA AVAILABILITY

SUPPLEMENTAL MATERIAL

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases