Identification of “missing links” in C- and D-ring cleavage of steroids by Comamonas testosteroni TA441

Masae Horinouchi; Toshiaki Hayashi

doi:10.1128/aem.01050-23

. 2023 Oct 10;89(10):e01050-23. doi: 10.1128/aem.01050-23

Identification of “missing links” in C- and D-ring cleavage of steroids by Comamonas testosteroni TA441

Masae Horinouchi ^1,^2,^✉,², Toshiaki Hayashi ¹

Editor: Jennifer B Glass³

PMCID: PMC10654042 PMID: 37815342

ABSTRACT

Comamonas testosteroni TA441 is capable of aerobically degrading steroids through the aromatization and cleavage of the A- and B-rings, followed by D- and C-ring cleavage via β-oxidation. While most of the degradation steps have been previously characterized, a few intermediate compounds remained unidentified. In this study, we proposed that the cleavage of the D-ring at C13-17 required the ScdY hydratase, followed by C-ring cleavage via the ScdL1L2 transferase. The anticipated reaction was expected to yield 6-methyl-3,7-dioxo-decane-1,10-dioic acid-coenzyme A (CoA) ester. To confirm this hypothesis, we constructed a plasmid enabling the induction of targeted genes in TA441 mutant strains. Induction experiments of ScdL1L2 revealed that the major product was 3-hydroxy-6-methyl-7-oxo-decane-1,10-dioic acid-CoA ester. Similarly, induction experiments of ScdY demonstrated that the substrate of ScdY was a geminal diol, 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid-CoA ester. These findings suggest that ScdY catalyzes the addition of a water molecule at C14 of 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid-CoA ester, leading to D-ring cleavage at C13-17. Subsequently, the C9 ketone of the D-ring cleavage product is converted to a hydroxyl group, followed by C-ring cleavage, resulting in the production of 3-hydroxy-6-methyl-7-oxo-decane-1,10-dioic acid-CoA ester.

IMPORTANCE

Studies on bacterial steroid degradation were initiated more than 50 years ago primarily to obtain substrates for steroid drugs. In recent years, the role of steroid-degrading bacteria in relation to human health has gained significant attention, as emerging evidence suggests that the intestinal microflora plays a crucial role in human health. Furthermore, cholic acid, a major component of bile acid secreted in the intestines, is closely associated with the gut microbiota. While Comamonas testosteroni TA441 is recognized as the leading bacterial model for aerobic steroid degradation, the involvement of aerobic steroid degradation in the intestinal microflora remains largely unexplored. Nonetheless, the presence of C. testosteroni in the cecum suggests the potential influence of aerobic steroid degradation on gut microbiota. To establish essential information about the role of these bacteria, here, we identified the missing compounds and propose more details of C-, and D-ring cleavage, which have remained unclear until now.

KEYWORDS: Comamonas testosteroni, bile acid, cholic acid, testosterone, cholesterol, steroid, b-oxidation, brain-gut-microbiome axis, brain-gut axis, Mycobacterium tuberculosis

INTRODUCTION

Steroid compounds serve various functions in both plants and animals, including humans, such as acting as hormones, cholesterols, and bile acids. Studies on bacterial steroid degradation were initiated over 50 years ago, primarily to obtain materials for steroid drugs. At that time, the Actinobacterium Rhodococcus equi (formerly Nocardia restrictus) and Proteobacterium Comamonas testosteroni (formerly Pseudomonas testosteroni) were the representative bacteria well known for their ability to degrade steroid compounds. Extensive research conducted around 1960 elucidated the underlying mechanism and identified major intermediates in the A- and B-ring degradation processes, revealing a similar steroid degradation pathway in both bacteria (1 –5).

Recently, steroids have gained increasing attention due to their impact on human health, particularly in relation to pathogenic bacteria. In Mycobacterium tuberculosis H37Rv, the mce4 operon, which encodes a cholesterol import system, is crucial for bacterial persistence in the lungs of chronically infected animals and for growth within interferon-γ-activated macrophages (6). Cholesterol catabolism and its broader utilization by M. tuberculosis are important for the pathogen’s maintenance in the host (7). In the human liver, cholic acid and deoxycholic acid are synthesized from cholesterol. Cholic acid, a major component of bile acids, plays a vital role in lipid digestion and absorption. These bile acids are secreted into the bile and subsequently released into the intestine. In the intestine, primary bile acids are converted to secondary bile acids and other derivatives by intestinal bacteria, which have been implicated in various diseases and symptoms. Recent studies have revealed that bile acids also affect the gut microbiome (8, 9). The impact of intestinal bacteria on human health, as well as the brain-gut axis, has garnered great interest in recent years (10 –13). Anaerobic steroid degradation is known to be predominant in the gut microbiome. However, recent studies have reported aerobic steroid degradation in various genera of bacteria within Actinobacteria and Proteobacteria, including Pseudomonas, Sphingobium, Azoarcus, Mycobacterium, and others (7, 14). Sterols, including cholesterol, can only be degraded by Actinobacteria, with the exception of Sterolibacterium denitrificans (15, 16). Emerging data on the complex interplay between bile acids, gut microbiota, and host metabolism have shed new light on the potential impact of bile acids on the brain-gut-microbiota axis (8). Currently, aerobic steroid degradation is not believed to significantly affect the gut microbiota, since aerobic steroid-degrading bacteria have not been detected in fecal samples. However, the presence of C. testosteroni in the cecum (17) indicates its likely presence in the gut, possibly in the vicinity of the connection between the small and large intestines. To establish fundamental data for elucidating the role of these bacteria, our study aims to unravel the entire aerobic steroid degradation process.

Genetic studies on aerobic steroid degradation by C. testosteroni started around 1990, and the enzymes catalyzing the early steps of this process, 17β-dehydrogenase (18 –21), 3α-dehydrogenase (22 –26), 3-oxo-Δ5-steroid isomerase (27, 28), Δ1-dehydrogenase (29), Δ4-dehydrogenase (30), and a positive regulator (31), were identified. However, degradation of steroidal A-, B-, C-, and D-rings had remained unclear until we revealed the steroid degradation process in C. testosteroni TA441.

The current understanding of the mechanism employed by TA441 for degrading the four basic steroidal rings (A-, B-, C-, and D-rings) is summarized in Fig. 1. Initially, steroids such as testosterone, cholic acid, and their derivatives are converted to androsta-1,4-diene-3,17-dione (R1,R2 = H, in Fig. 1) or the corresponding derivative 7α,12α-dihydroxy-androsta-1,4-diene-3,17-dione (in cholic acid degradation) (I). The addition of a hydroxyl group at C9 leads to subsequent aromatization of the A-ring, followed by ring cleavage and hydrolysis, resulting in the formation of 2-hydroxyhexa-2,4-dienoic acid (VI) and 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid (VII) or the corresponding derivative 7α,9α-dihydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid (in cholic acid degradation) (32 –39).

In the subsequent set of reactions, which proceed through β-oxidation, coenzyme A (CoA) is incorporated into VII by the CoA transferase ScdA (40), and the cleaved B-ring in the VII-CoA ester is removed, leading to the formation of 9α-hydroxy-17-oxo-1,2,3,4,5,6,10,19-octanorandrostan-7-oic acid (XII)-CoA ester (41 –43). The C-ring is then dehydrogenated to 9,17-dioxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (XIV)-CoA ester, followed by D-ring cleavage with the CoA hydratase ScdY (44). Compounds isolated from a culture of ScdL1⁻L2⁻, the gene disrupted mutant of the enzymes essential for D-ring cleavage, suggested that 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-ene-7,17-dioic acid (XV)-CoA ester, 13-hydroxy-9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)–7,17-dioic acid (XVI)-CoA ester, and 9-hydroxy-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-13-ene-7,17-dioic acid (XVII)-CoA ester are products of D-ring cleavage (45). However, the precise involvement of these three compounds in the degradation process has remained unclear. Our latest study proposed that 14-hydroxy-9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrostane-7,17-dioic acid (XVIII)-CoA ester serves as the substrate for ScdL1L2 (46). The ring-cleavage product of XVIII-CoA ester is expected to be 6-methyl-3,7-dioxo-decane-1,10-dioic acid (XIX)-CoA ester, with a molecular weight (MW) of 244. While a small amount of XVIII was detected in the ScdL1⁻L2⁻ culture, we were unable to identify any potential product of ScdL1L2 with an MW of 244. It is important to consider the possibility of unidentified intermediates that may arise during the process of D-ring cleavage. In this study, we constructed a plasmid for the inducible expression of target genes in TA441 and investigated the “missing links” in C- and D-ring cleavage.

RESULTS AND DISCUSSION

Characterization of “missing link” intermediates in C- and D-ring cleavage

Our previous studies have identified the enoyl-CoA hydratase ScdY and the putative CoA transferase ScdL1L2 as the enzymes responsible for cleaving the D- and C-rings of steroid compounds, respectively, as shown in Fig. 1. Through homology searching, we found that ScdY belongs to the enoyl-CoA hydratase/isomerase family, which includes enzymes involved in converting 3-enoyl-CoA to 2-enoyl-CoA and vice versa. In our previous study, we isolated compound XIV (MW 208) from a ScdY-disrupted mutant (ScdY^-) and characterized it using nuclear magnetic resonance (NMR) and high-resolution mass spectrometry (HRMS) analyses. This suggested that XIV-CoA ester served as the substrate for ScdY. On the other hand, ScdL1L2 shows homology to the IpdAB hydrolase in M. tuberculosis H37Rv, which is reported to cleave the C-ring of XV-CoA ester by adding a water molecule at C14, resulting in the production of XIX-CoA ester (47, 48). This conversion by IpdAB requires a CoA transferase, corresponding to ScdF in TA441. However, despite our efforts, we were unable to detect XIX or its derivatives, even when using an ScdJ mutant (ScdJ⁻). ScdJ is the major CoA transferase for the conversion of the C-ring cleavage product (cf. Fig. 1). ScdJ⁻ is the only mutant that accumulated compounds with only the C-ring remaining, except for the ScdL1L2-disrupted mutant (ScdL1⁻L2⁻). XV (MW 226), decarboxylated derivatives of XV and XVI (MW 242), and XVII (MW 228) were identified through NMR and HRMS analyses in the culture of ScdL1⁻L2⁻ (45). Subsequent studies suggested that these compounds could potentially be formed during the isolation process, which was carried out under acidic conditions. Instead, XVIII-CoA ester was proposed as the substrate of ScdL1L2 (36). Nevertheless, the anticipated product, XIX (MW 244), was not detected by high-performance liquid chromatography (HPLC) with UV detection (samples were analyzed without extraction with ethyl acetate under acidic conditions) or ultraperformance liquid chromatography-mass spectrometry. From these results, it is anticipated that there are intermediate compounds that have not yet been discovered in the cleavage of the C- and D-rings. Therefore, in this study, we cultured ScdY⁻ and ScdL1⁻L2⁻ cells with cholic acid for 7 days and analyzed the cultures using reverse-phase liquid chromatography with tandem mass spectrometry (LC/MS/MS) (Fig. 2). In the ScdY⁻ culture, several overlapping peaks with m/z 207 were detected from retention time (RT) of 5.0 min to RT of 8.1 min (Fig. 2A). Diluting the sample 1/10 allowed us to better distinguish these peaks (Fig. 2B). The peak at RT of 8.1 min was identified as XIV based on comparison with known values (44), whereas the peak at RT of 5.0 min was a fragment of a peak with m/z 225 (Fig. 2C). This finding implied that the peak with m/z 207 at RT of 5.0 min was derived from XIV following the addition of a water molecule. The mass spectrum of the peak with m/z 225 at RT of 5.0 min revealed four major fragments (m/z 225, 207, 163, and 137), whereas that of the peak with m/z 207 at RT of 5.0 min revealed only three major fragments (m/z 207, 163, and 135), which corresponded to those of XIV (Fig. 3A through C). A water molecule can attack the C3 ketone, C17 ketone, or C8(14) double bond on XIV. The C17 geminal diol is converted automatically to XIV or XV, and the mass spectrum of XV shows the dominant fragment m/z 137 (Fig. 3D). These results indicate that the compound with m/z 225 at RT of 5.0 min was 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (XXIII) (Fig. 3). The mass chromatograms of the ScdL1⁻L2⁻ culture revealed only compounds already identified in previous studies (Fig. 2D through G).

Fig 2 — LC/MS/MS analysis of the culture of the ScdY⁻ and ScdL1⁻L2⁻ mutants. Panels indicate the mass chromatogram of *m/z* 207 (ScdY⁻) (A), 1/10 amount of A (B), *m/z* 225 (ScdY⁻) (C), *m/z* 225 (ScdL1⁻L2⁻) (D), *m/z* 243 (ScdL1⁻L2⁻) (E), *m/z* 241 (ScdL1⁻L2⁻) (F), and *m/z* 227 (ScdL1⁻L2⁻) (G). The arrowhead indicates newly detected possible intermediate compound with *m/z* 225 (without CoA). The vertical axis indicates intensity (count per second) and the horizontal axis indicates RT (minutes). Compounds shown in open box were isolated and identified using NMR and HRMS analyses. Compounds underlined were identified and experimentally confirmed using LC/MS/MS.

Fig 3 — The mass spectra of a peak with *m/z* 225 at RT of 5.0 min (A), a peak with *m/z* 207 at RT of 5.0 min (B), **XIV** (*m/z* 207) (C), and XV (*m/z* 225) (D) analyzed by LC/MS/MS. Compounds are 9,17-dioxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (**XIV**), 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-ene-7,17-dioic acid (XV), and 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (**XXIII**). The vertical axis indicates relative intensity (%), and the horizontal axis indicates mass (*m/z*). Compounds shown in open box were isolated and identified using NMR and HRMS analyses. Compounds underlined were identified and experimentally confirmed using LC/MS/MS. Compounds with asterisk (*): this study.

Construction of plasmid pMFYMhpR for the induction of target genes in TA441 mutants

The degradation of C- and D-rings, as well as that of the cleaved B-ring, proceeds via β-oxidation. The intermediates in this procedure are CoA-esters, which hinders their conversion using the purified enzyme. To investigate unknown intermediate compounds originating from C- and D-ring cleavage, we constructed a plasmid that enabled the gene cloned on the vector, which was induced with addition of 3-(3-hydroxyphenyl)propionic acid (3HPP) in various TA441 mutants. Degradation of 3-(3-hydroxyphenyl)propionic acid (3HPP) by TA441 depends on induction of the Mhp gene cluster (49). Specifically, Mhp catalytic genes are induced following binding of 3HPP and the positive regulator MhpR to the promoter region (Fig. 4). The DNA fragment containing mhpR and the promoter region were amplified and cloned into the PvuII site of the broad-host-range plasmid pMFY42 (50) to generate pMFYMhpR (Fig. 4).

Fig 4 — Construction of pMFYMhpR for inducing the target gene(s) in TA441 mutants. TA441 is capable of degrading 3-(3-hydroxyphenyl)propionic acid (3HPP) through *mhpRABD* (42). MhpR functions as a positive regulator for the *mhp* genes. MhpR binds to the promoter region with the conjugated 3HPP to activate the expression of *mhpABD*. A DNA fragment containing *mhpR* and the promoter region were amplified using pYT11, a pUC19 derivative carrying *mhpRABD* (42), and inserted into the *Pvu*II site of the broad-host-range plasmid pMFY42 (43) using the In-Fusion HD Cloning Kit (TAKARA Bio, Japan). Subsequently, the target gene, amplified by PCR, was inserted into the *Pvu*II site of pMFYMhpR along with a kanamycin-resistance gene for selection. *tet*, tetracycline resistance gene; neo, kanamycin resistance gene.

To confirm the functionality of the obtained plasmid and investigate the conversion of XXIII-CoA ester by ScdY, we introduced scdY into the PvuII site downstream of the mhp promoter on pMFYMhpR. This resulted in the creation of the pMFYMhpRScdY plasmid, which was then transferred to ScdY⁻ mutants. The mutants were incubated with cholic acid for 7 days, followed by the addition of 3HPP to the culture, and further incubated for 3 days. Mass chromatograms were recorded for peaks with m/z 207 and m/z 181, which were used for detecting XV', a decarboxylated derivative of XV. The analysis was performed at 0, 1, and 3 days after the addition of 3HPP, as depicted in Fig. 5. As a negative control, cultures incubated for 8 and 10 days without the addition of 3HPP were also analyzed and found to be nearly identical to the 7-day culture (in all induction experiments, cultures incubated for 10 days without 3HPP served as negative controls and showed results similar to the corresponding 7-day cultures). In the presence of 3HPP, the content of XIV and XXIII gradually decreased in the culture over time. The observed restrained decrease can be attributed to the accumulation of compounds without CoA, resulting from an excessive buildup of these compounds. When 3HPP was added at the beginning of the incubation with cholic acid, XIV and XXIII became barely detectable within 7 days. These findings indicate that ScdY was induced by the pMFYMhpR-based plasmid upon the addition of 3HPP and that XXIII-CoA is the substrate of ScdY. However, the potential products of ScdY, which are compounds accumulated in the ScdL1⁻L2⁻ culture as illustrated in Fig. 1, did not exhibit an increase in the presence of ScdY induced by the pMFYMhpRScdY plasmid (Fig. 5A2 through D2). This is likely due to the further degradation of the product by ScdY⁻ cells carrying the pMFYMhpRScdY plasmid, which contains all the necessary enzymes for steroid degradation.

Fig 5 — Induction of ScdY in the ScdY⁻ mutant and the conversion of XXIII by ScdY. ScdY⁻ carrying pMFYMhpRScdY was incubated with 0.1% cholic acid for 7 days, and then 0.1% 3HPP was added for induction. Mass chromatograms of the culture (A1-C1, *m/z* 207; A2-C2, *m/z* 181) in 0 day (**A1, A2**), 1 day (**B1, B2**), and 3 days (**C1, C2**) after addition of 3HPP are shown. D1 and D2 show chromatograms of *m/z* 207 and *m/z*181 of the culture incubated with 0.1% cholic acid and 3HPP for 7 days. Samples are 1/10th the amount of samples from other experiments. Compounds are 9,17-dioxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (**XIV**), 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (**XXIII**), and 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-en-17-oic acid (XV'). The vertical axis indicates intensity (count per second), and the horizontal axis indicates RT (minutes). Compounds shown in open box were isolated and identified using NMR and HRMS analyses. Compounds with asterisk (*): this study.

Characterization of the product of ScdY

In the previous section, XV, XVI, and XVII did not show a significant increase after induction with 3HPP. To further investigate the role of ScdY and ScdL1L2, we constructed another mutant deficient in both enzymes. However, it was difficult to generate a mutant with only ScdL2 and ScdY disrupted. Instead, a mutant ScdL2⁻N⁻Y⁻ was created. In this mutant, ScdN, which acts downstream of ScdL1L2, was disrupted, ensuring that it would not interfere with the investigation of ScdY conversion (Fig. 1). After introducing the pMFYMhpRScdY plasmid into ScdL2⁻N⁻Y⁻ cells, they were incubated with cholic acid for 7 days and then with 3HPP for an additional 3 days. The mass chromatograms in Fig. 6A1, A2, B1, and B2 showed peaks corresponding to XXIII, XIV, and XV' before and 3 days after the addition of 3HPP. Additional mass chromatograms in Fig. S1-1 of the Supplemental Material displayed peaks with m/z 183 (XVII'), m/z 197 (XVI'), and m/z 229 (XXIV). The samples for LC/MS/MS were diluted five times to avoid detection saturation. The content of XXIII and XIV slightly decreased, while XV', XVII', XVI', and XXIV showed a slight increase, although the changes in quantity were smaller than expected. It should be noted that ScdY is expressed from pMFYMhpRScdY at some level even without the addition of 3HPP, which explains the detection of these products before 3HPP addition. To confirm the induction of the cloned gene in ScdL2⁻N⁻Y⁻, another mutant, ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdL1L2Y, was constructed and analyzed under the same conditions. After 3 days of incubation with 3HPP, XXIII and XIV became undetectable, and XV', XVII', XVI', and XXIV became nearly undetectable (Fig. S1-2 of the Supplemental Material). This result indicated the successful induction of the cloned genes in ScdL2⁻N⁻Y⁻. Subsequently, ScdL2⁻N⁻Y⁻ cells carrying pMFYMhpRScdY were incubated with cholic acid and 3HPP from the beginning of incubation. After 7 days, XXIII and XIV became undetectable, and a new peak with m/z 181, named XXV', was detected at an RT of 7.3 min (Fig. 6A3 and B3). Upon reviewing past data, it was discovered that XXV' was occasionally detected in low amounts in the ScdL1⁻L2⁻ culture. Analysis of the culture of ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdY with cholic acid and 3HPP every 24 h showed an increase in the amount of XXV' during the first 2 days with 3HPP and during a day without 3HPP (Fig. 6C; Fig. S2 in Supplementary Materials). The increase was slower with 3HPP because the addition of 3HPP solution, maybe acetonitrile, delays the growth of TA441 mutants. Afterward, the amount of XXV' decreased. XXIII and XIV accumulated only in the culture without 3HPP, and the amounts of XV', XVI', XVII', and XXIV increased during the first 2–3 days and continued to increase slowly thereafter. The increase in XVII' and XXIV, which have a hydroxyl group at C9, was slower compared to XV' and XVI', which have a ketone moiety at C9. The mass spectrum of XXV' closely resembled that of XV' (Fig. 6D1 and D2), indicating a similar structure featuring a ketone moiety and a double bond in the C-ring. Among the intermediate compounds accumulated in the ScdL1⁻L2⁻ culture, XVII' was the only compound with a double bond in the C-ring, apart from the double bond at C8-14. Based on these observations, XXV' was identified as a decarboxylated derivative of 9-oxi-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-13 (14)-ene-7,17-dioic acid (XXV). From these findings, it was inferred that XXV' could be a derivative of the initial product of the ScdY reaction, along with XV' (and possibly XVI), and that compounds with a hydroxyl group at C9 were produced from it. From these results, the reaction of ScdY was proposed as shown in Fig. 6E: a water molecule is added at C14 of XXIII-CoA ester, leading to cleavage of the D-ring and the production of XVIII-CoA ester. XXV and XV are derived from XVIII through dehydration, and XXV can be further converted to XV or XVII, possibly by ScdG. Although substantial amounts of XVI were accumulated in ScdL2⁻N⁻Y⁻ cells carrying pMFYMhpRScdY, its specific role remains unclear. XVI was detected in ScdL1⁻L2⁻ cultures incubated with various steroid compounds, regardless of the presence of a C12-hydroxyl group (e.g., testosterone, cholic acid, deoxycholic acid, chenodeoxycholic acid, and lithocholic acid).

Fig 6 — Induction of ScdY in the ScdL2⁻N⁻Y⁻ mutant (ScdN acts downstream of ScdL1L2, so it does not interfere with the experiment to investigate the conversion by ScdY). A1-3 and B1-3 show the chromatograms of *m/z* 207 and *m/z* 181 of the culture, respectively. ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdY was incubated with 0.1% cholic acid (CA) for 7 days (**A1 and B1**), and then 0.1% 3HPP was added for induction and incubated for another 3 days (**A2 and B2**). ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdY incubated for 10 days with CA (negative control) showed mass chromatogram almost identical to those of 7-day culture (data not shown). A3 and B3 show the chromatograms of the culture incubated with CA and 3HPP for 7 days. 6C shows the time-related changes in amount of XXV' (a peak with *m/z* 181 at RT of 7.4 min) (C1), XV' (C2), XVI' (C3), XVII' (C4), and XXIV (C5) in the culture of ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdY incubated with CA and 3HPP. D1 and 6D2 are the mass spectrum of XV' and XXVs, respectively. E shows the putative product and the derivatives of ScdY indicated by this experiment. Compounds are 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-ene-7,17-dioic acid (XV), decarboxylated derivative of XV (XV'), 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-13-en-7,17-dioic acid (**XXV**), decarboxylated derivative of **XXV** (XXV'),9-hydroxy-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-13-en-7,17-dioic acid (**XVII**), decarboxylated derivative of XV (XVII'),9-hydroxy-1,2,3,4,5,6,10,19-octanor-13,17-secoandrostane-7,17-dioic acid (**XXIV**), 13-hydroxy-9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-en-17-oic acid (XVI'), and 17-dihydroxy-9-oxo-1,2,3,4,5,6,10,19-octanorandrost-8(14)-en-7-oic acid (**XXIII**). In mass chromatograms, the vertical axis indicates intensity (count per second), and the horizontal axis indicates RT (minutes) (A). In the mass spectrum, the vertical axis indicates relative intensity (%), and the horizontal axis indicates mass (*m/z*) (D). In Fig. 6C, the vertical axis indicates intensity (count) in peak area, and the horizontal axis indicates incubation time (day). Compounds in square: the compound or the derivative was isolated and identified by NMR, etc. Compounds shown in open box were isolated and identified using NMR and HRMS analyses. Compounds with asterisk (*): this study.

Characterization of the product of ScdL1L2

4-Methyl-5-oxo-octane-1,8-dioic acid (XX)-CoA ester is the major substrate of ScdM1M2 (Fig. 1 and 7), and a large amount of XX accumulates in ScdM1⁻M2⁻ cultures (46). XX is generated from the product of C-ring cleavage by the CoA transferase ScdJ (Fig. 1). In the mass chromatogram of the ScdJ⁻ culture, a compound with m/z 243, which was considered a candidate for XIX-CoA ester, was not detected (cf. Fig. S4A1 in the Supplemental Material; data of ScdJ⁻ were almost identical to ScdJ⁻ with pMFYMhpR). Although there were several small peaks in the mass chromatograms, they did not show an increase in amount after the induction of ScdL1L2, except for one peak at RT of 8.8 min (cf. Fig. S3A2). The mass spectrum of the peak at RT of 8.8 min showed m/z 243 as the major fragment (Fig. S4D1). XIX-CoA ester is prone to decarboxylation, which would result in a mass spectrum showing m/z 199 as the main fragment. Therefore, this peak will not be XIX. To investigate the production of XIX-CoA ester, scdL1L2 was introduced downstream of the mhp promoter in the pMFYMhpR plasmid. The resulting plasmid, pMFYMhpRScdL1L2, was transformed into ScdL1⁻L2⁻ cells. These cells were then incubated with cholic acid for 7 days, followed by 3HPP for an additional 3 days. It was anticipated that the mutant strain would accumulate higher amounts of the putative products or their derivatives. However, no suitable products or derivatives, such as XIX, were detected (data not shown). When 3HPP and cholic acid were added at the beginning of the incubation and the cells were cultured for 7 days, peaks corresponding to possible ScdL1L2 products (m/z 245 at RT = 5.6 min, m/z 241 at RT = 5.7 min, and m/z 227 at RT = 7.0 min and 7.7 min) were detected (Fig. 7A1–3 and B1–3). Mass chromatograms of peaks with m/z 243, 245, 241, 227, 225, and 229 from RT of 0 min to RT of 12 min are shown in Fig. S3 in Supplemental Material. A peak with m/z 241 at RT of 5.7 min was not detected when the initial steroid did not contain a C12-hydroxyl group. To further investigate the changes in the amount of compounds induced by ScdL1L2 and to identify its function, a plasmid pMFYMhpRScdL1L2Y, carrying the genes scdL1L2Y, was constructed. This plasmid was introduced into ScdL2⁻N⁻Y⁻ cells, which lacked ScdL2 and ScdY. We expected ScdL2⁻N⁻Y⁻ cells carrying pMFYMhpRScdL1L2Y to accumulate more putative ScdL1L2 products following addition of 3HPP because ScdN catalyzes two steps downstream of C-ring cleavage (Fig. 1). ScdL2⁻N⁻Y⁻ cells carrying pMFYMhpRScdL1L2Y were incubated with cholic acid for 7 days, followed by 3HPP for an additional 3 days. Induction of ScdL1L2 led to the accumulation of the more amount of the four candidate compounds than that of ScdL1⁻L2⁻ cells carrying pMFYMhpRScdL1L2 (Fig. 7D1-3), particularly those with m/z 227 (Fig. 7D3). These results suggested that these four compounds were the products of ScdL1L2 or their derivatives. To enhance their accumulation, we constructed one more mutant, ScdJ⁻, which did not accumulate any compounds with MW 244, but the only mutant which presented clear accumulation of XV', XVII', and XVI' except for ScdL1⁻L2⁻ (46). Therefore, ScdJ⁻ carrying pMFYMhpRScdL1L2 was expected to accumulate more amount of the putative ScdL1L2 products with 3HPP induction. LC/MS/MS analysis of ScdJ⁻ carrying pMFYMhpRScdL1L2 incubated with cholic acid for 7 days, followed by the addition of 3HPP and incubation for additional 3 days demonstrated a significant increase in the peak with m/z 245 at RT of 5.6 min (Fig. 7E1 through G1) and peaks with m/z 227 at RT of 7.0 min and 7.7 min in the induced cultures (Fig. 7E3 through G3) (The mass chromatograms of peaks with m/z 245, m/z 241, and m/z 227 from RT = 0 min to RT = 12 min are shown in Fig. S4A1 to 3, B1 to 3, and C1 to 3 in Supplemental Material. The chromatograms for m/z 181, m/z 183, m/z 197, and m/z 229 are presented in Fig. S5A in Supplemental Material). The mass spectrum of the peak with m/z 245 at RT of 5.6 min indicated that the compound was 3-hydroxy-6-methyl-7-oxo-decane-1,10-dioic acid (XXVI), a compound with the same structure as XIX but with a hydroxyl group instead of a ketone group at C3 (Fig. 8A). The peaks with m/z 227 at RT of 7.0 min and 7.7 min were identified as the dehydrated derivatives of XXVI, 6-methyl-7-oxo-dec-3-ene-1,10-dioic acid (XXVII), and 6-methyl-7-oxo-dec-2-ene-1,10-dioic acid (XXVIII), respectively (Fig. 8B and C). The mass spectrum of the peak with m/z 241 at RT of 5.7 min assigned the compound to 6-methyl-3,7-dioxo-dec-5-ene-1,10-dioic acid (XXIX) (Fig. 8D). XXIX was thought to be a dehydrated derivative of 5-hydroxy-6-methyl-3,7-dioxo-decane-1,10-dioic acid (XXX) because it was accumulated only when the initial steroid has a hydroxyl group at C12. These results indicate that XXVI-CoA ester is the major product of C-ring cleavage by ScdL1L2. The product of D-ring cleavage is considered to be XVIII-CoA ester. However, the accumulation of a large amount of XXVI suggests that the CoA-ester of 9,14-dihydroxy-1,2,3,4,5,6,10,19-octanor-13,17-secoandrostane-7,17-dioic acid (XXXI), which has the same structure as XVIII but with a hydroxyl group instead of a ketone group at C9, is the substrate for ScdL1L2. In the induction experiment using ScdJ⁻ cells carrying pMFYMhpRScdL1L2, no significant decrease in the peaks of XVII', XVI', and XVIV' was observed (Fig. S5, m/z 183, 197, and 229, respectively). XV and XV' showed a decrease (Fig. S5 in Supplemental Material, m/z 181), but the reduction was small compared to the increase in XXVI, XXVII, and XXVIII. Therefore, we compared the total ion chromatograms before and after induction with 3HPP to identify any other reduced peaks. A decrease was observed for the peak at RT of 5.7 min and the peak at RT of 6.4 min: the peak at RT of 6.4 min corresponded to XV, while the peak at RT of 5.7 min showed a reduction despite containing XXVI (Fig. S5B). Examination of the ions in the peak at RT of 5.7 min revealed that the ion at m/z 155 was the most diminished (Fig. S5B). However, we were not able to identify the original compound of this fragment because XXI was also detected as a peak of m/z 155 with the same retention time. On the other hand, a peak with m/z 245 at RT of 1.7 min, detected in the culture of ScdL1⁻L2⁻ cells carrying pMFYMhpRScdL1L2 without induction, was hypothesized to be XXXI. This hypothesis was based on the analysis of various ScdL1⁻L2⁻ mutant culture (cf. Fig. S3B1 and B2 in the Supplementary Materials) and the similarity of the overall fragment pattern in the mass spectrum to that of XVIII with the detection of a characteristic fragment of m/z 129, which is indicative of the C-ring cleaved product XXVI and its derivatives (Fig. S6C4 and C5 for m/z 129, Fig. 8). During the detailed data analysis, a new peak with m/z 229 at RT of 7.2 min was found to increase upon induction. The mass spectrum of this peak was overall similar to that of XXVII, and based on the molecular weight and relative abundance of fragments, it was expected to be 6-methyl-7-oxo-decane-1,10-dioic acid, a compound with the same structure as XXVI but without a hydroxyl group at C3 (Fig. S5C1 and C2). Additionally, a small peak was detected at RT of 6.7 min along with the peak at RT of 7.2 min, but the compound could not be deduced from the mass spectrum (Fig. S5C3). In addition to the above findings, the accumulation of XXIX suggested that C- and D-ring cleavage occurred in the presence of the C12-hydroxyl group, but degradation was less efficient compared to compounds lacking the C12-hydroxyl group.

Fig 7 — Induction of ScdL1L2 in the ScdL1⁻L2⁻ mutant (**A, B**), ScdL1L2Y in the ScdL2⁻N⁻Y⁻ mutant (**C, D**), and ScdL1L2 in the ScdJ⁻ mutant (**F, G**). ScdL1⁻L2⁻ carrying pMFYMhpRScdL1L2 was incubated with 0.1% cholic acid (A) and with 0.1% cholic acid and 0.1% 3HPP (B) for 7 days. ScdL2⁻N⁻Y⁻ carrying pMFYMhpRScdL1L2Yc(C, D), ScdJ⁻ carrying pMFY42 (E, negative control), and ScdJ⁻ carrying pMFYMhpRScdL1L2 (**F, G**) were incubated with 0.1% cholic acid for 7 days. Then 0.1% 3HPP was added for induction and incubated for another 3 days (**D, G**) (ScdJ⁻ carrying pMFY42 incubated for 3 days with 3HPP is not shown because it was almost the same as E). Arrowheads indicate possible product and the derivatives of ScdL1L2. Mass chromatograms of *m/z* 245 (**A1-G1**), *m/z* 241 (**A2-G2**), and *m/z* 227 (**A3-G3**) are shown. The vertical axis indicates intensity (count per second), and the horizontal axis indicates RT (minutes). Compounds shown in open box were isolated and identified using NMR and HRMS analyses. Compounds underlined were identified and experimentally confirmed using LC/MS/MS.

Fig 8 — The mass spectra of a peak with *m/z* 245 at RT of 5.6 min (A), a peak with *m/z* 227 at RT of 7.0 min (B), a peak with *m/z* 227 at RT of 7.7 min (C), and a peak with *m/z* 241 at RT of 5.7 min (D). Compounds are 3-hydroxy-6-methyl-7-oxo-decane-1,10-dioic acid (**XXVI**), 6-methyl-7-oxo-dec-3-ene-1,10-dioic acid (**XXVII**), 6-methyl-7-oxo-dec-2-ene-1,10-dioic acid (**XXVIII**), and 6-methyl-3,7-dioxo-dec-5-ene-1,10-dioic acid (**XXIX**). The vertical axis indicates relative intensity (%), and the horizontal axis indicates mass (*m/z*).

Conclusion

The degradation pathway discovered in this study is illustrated in Fig. 9. The substrate for the ScdY hydratase is a geminal diol, XXIII-CoA ester, and hydration at C14 by ScdY leads to cleavage of the D-ring at C13-C17, producing XVIII-CoA ester. Hydration at C14 by ScdY leads to the cleavage of the D-ring at C13-C17, resulting in the formation of XVIII-CoA ester. This is supported by the presence of XVIII and its derivatives and their varying quantities observed in the culture of the mutant expressing ScdL1L2.

The primary product resulting from subsequent C-ring cleavage by ScdL1L2 is XXVI-CoA ester. ScdL1L2 shares high homology with CoA-transferases and glucose isomerases, indicating that its substrate is likely to be XXXI-CoA ester, which has the same structure as XVIII-CoA ester except for a hydroxyl group at the C9 position instead of a ketone group. XVIII-CoA ester is anticipated to undergo hydrogenation at C9 before the cleavage of the C-ring. This hypothesis is supported by the presence of accumulated XVII' and XXIV in ScdL1⁻L2⁻ cultures, both of which have a hydroxyl group at C9, indicating potential involvement of ScdG. However, the confirmation of this reaction remains inconclusive. In M. tuberculosis H37Rv, IpdAB hydrolase, which corresponds to ScdL1L2, has been reported to cleave the C-ring of XV-CoA ester to produce XIX-CoA ester in the presence of a CoA transferase similar to ScdF of TA441. However, in TA441, XV decreased only slightly in the presence of ScdL1L2, compared to the significant increase in XXVI (Fig. 7; Fig. S5 in the Supplemental Material). This suggests that XV-CoA ester is unlikely to be the direct substrate for ScdL1L2 in TA441.

MATERIALS AND METHODS

Culture conditions

Mutant strains of C. testosteroni TA441 were grown at 30°C in a mixture of equal volumes of Lysogeny broth (LB) medium and C medium (a mineral medium for TA441) (32) with suitable carbon sources. These mixed media are used because the mutants accumulate more amount of intermediate compounds than with C medium or LB medium (unpublished data). Cholic acid and other steroids were added as filter-sterilized DMSO solutions with a final concentration of 0.1% (wt/vol). 3-(3-Hydroxyphenyl)propionic acid was added as acetonitrile solution with a final concentration of 0.1% (wt/vol). 3HPP was purchased from Alfa Aesar (Lancashire, UK). Addition of 3HPP solution, maybe acetonitrile, delays the growth of TA441 mutants, while addition of acetonitrile showed no influence when added after 7 days incubation. In all the experiments, LC/MS analysis of the mutant culture was performed at least several times with triplet or quartet samples. When the amount of the compounds was small or the data were unstable, we repeated more or construct other mutants to support the data.

Construction of deletion mutants, plasmids, and mutants for complementation experiments

To construct the ScdL2⁻N⁻Y⁻ mutant (Table 1), a DNA fragment containing scdK and scdY::Km^r (bearing the kanamycin resistance gene) was amplified using the pUC19-based plasmid pUCORF5(scdY)-Km^r, which had been generated in a previous study (44) to delete scdY. A DNA fragment containing scdM1M2F was amplified using pUCScdM1M2F, a pUC19 derivative (Tables 2 and 3). Then, the two fragments were introduced into a pHSG397 derivative carrying tesB and scdL1 using the In-Fusion HD Cloning Kit (TaKaRa Bio, Japan). This yielded the pHSGScdL2NY-Km^r plasmid carrying tesB, scdL1, scdK, scdY::Km^r, and scdM1M2F. The plasmid was introduced into TA441 cells via electroporation. Successful transformants were selected on LB plates with kanamycin and chloramphenicol. Deletion of scdL2, insertion of Km^r in scdY, and the presence of scdK were confirmed by PCR amplification with several different pairs of primers and treatment with restriction enzymes. To construct pMFYMhpR, a DNA fragment containing mhpR and the promoter region was amplified using pYT11, a pUC19 derivative carrying mhpRABD (49), and cloned into the PvuII site of the broad-host-range pMFY42 plasmid (Fig. 4) (50). pMFYMhpR contained a unique PvuII site downstream of the promoter. The target genes were PCR-amplified with Km^r for subsequent selection and introduced into the PvuII site of pMFYMhpR using the In-Fusion HD Cloning Kit.

TABLE 1.

Strains

Strains	Characteristics	Source or reference
TA441	Wild type	(53)^a
ScdY⁻	ScdY: :Km^r mutant (SmaI site) of TA441	(32)^b
ScdL1⁻L2⁻	ScdL1L2: :Km^r mutant (Apa1 site to EcoT221 site) of TA441	(43)^c
ScdG⁻	ScdG: :Km^r mutant (ClaI site) of TA441	(45)^d
ScdL2⁻N⁻Y⁻	ScdL1N: :deletion, ScdY: :Km^r mutant (SmaI site) of TA441	This work

Open in a new tab

^{^a}

Arai et al. 1998. Microbiology 144: 2895–2903.

^{^b}

Horinouchi et al. 2001. Microbiology 147:3367–3375.

^{^c}

Horinouchi et al. 2019. Appl Environ Microbiol 85:e001204-19.

^{^d}

Horinouchi et al. 2019. J Steroid Biochem Mol Biol, 185: 268–276.

^{^e}

Km^r: Km resistance

TABLE 2.

Plasmids

Plasmids	Characteristics	Source or reference
pUC19	Ap^r, lacZ	(52)^a
pMFY42	Tc^r, Km^r, RSF1010-based broad host range plasmid	(51)^b
pYT11	pUC19 derivative carrying mhpRABD (5.2-kb BglII-fragment)	(50)^c
pMFYMhpRA	pUC19 derivative carrying mhpR and the promoter of mhp genes	This work
pMFYMhpScdY	pMFYMhpRA derivative carrying scdY	This work
pMFYMhpScdL1L2	pMFYMhpRA derivative carrying scdL1L2	This work
pMFYMhpScdL1L2Y	pMFYMhpRA derivative carrying scdL1L2Y	This work
pUCORF5(scdY)-Km^r	pUC19 derivative carrying DNA fragment containing scdK and scdY: :Km^r (SmaI site)	(44)^d
pHSGtesBscdL1	pHSG397 derivative carrying tesB and ScdL1	This work
pUCScdM1M2F	pUC19 derivative carrying scdM1M2F	This work
pHSGScdL2NY-Km^r	pHSGtesBscdL1 derivative with scdK, scdY: :Km^r, and scdM1M2F	This work

Open in a new tab

pSuperCosI* (Stratagene, CA, USA).

^{^a}

Vieira, J., and Messing, J. 1987. Methods Enzymol. 153: 3–11.

^{^b}

Nagata Y. et al. 1993. J Bacteriol 175:6403–6410.

^{^c}

Arai H. et al. 1999. Microbiology 145:2813–2820.

^{^d}

Horinouchi M, et al. 2018. Appl Environ Microbiol 84:e01324-18.

^{^e}

Km^r: Km resistance.

^{^f}

pSuperCosI* (Stratagene, CA).

TABLE 3.

Primers^b

Primers	Sequences	Source or reference
MhpRA_H.	ACAAGACCTTCCCGGTTGAA	This work
MhpRA_PvuII_T	ATCAGCTGGGCCAGATTCTCC	This work
MFYPvuII_Kmr._T	GACAACGTCGAGCAGGTGGGCGAAGAACTC	This work
MhpRAPvuII_scdL1	GAGAATCTGGCCCAGATGGCCAATAAATTG	This work
MhpRAPvuII_scdY	GAGAATCTGGCCCAGATGTCCACTCAACAA	This work
ScdL2_Km	GCCATGGGAGTCTGAAAGCTTCACGCTGCC	This work
ScdL2_Km_T	GGCAGCGTGAAGCTTTCAGACTCCCATGGC	This work
ScdY_Km	TGCGTCTGCAGGTCGAAGCTTCACGCTGCC	This work
ScdY_Km_T	GGCAGCGTGAAGCTTCGACCTGCAGACGCA	This work
ScdL2_scdY	GCCATGGGAGTCTGAATGGTCGGCGTGGT	This work
ScdL2_scdY_T	ACCACGCCGACCATTCAGACTCCCATGGC	This work
Dra_scdK	TTTAAAATGGGCAGTCTGCGCACTCC	(44)^a
ScdL1_ScdK	TTGCCCGTGTTCTGAATGAGCAATATGAAC	This work
ScdL1_ScdK_T	GTTCATATTGCTCATTCAGAACACGGGCAA	This work
Km_ScdM1	TTCTTCGCCCACCCCATGGATTTGACCTAT	This work
Km_ScdM1_T	ATAGGTCAAATCCATGGGGTGGGCGAAGAA	This work
ScdK_pUC19ScE	ATCGAACGTCTCTGAACCGAGCTCGAATTC	This work
ScdK_pUC19ScE_T	GAATTCGAGCTCGGTTCAGAGACGTTCGAT	This work
Dra_tesB	TTTAAAATGATGGAAATACGTGGACT	This work
Dra_ScdL1_T	TTTAAATCAGAACACGGGCAAGGGC	This work

Open in a new tab

^{^a}

Horinouchi M, et al. 2018. Appl Environ Microbiol 84:e01324-18.

^{^b}

Km^r :Km-resistance.

Reverse-phase liquid chromatography with tandem mass spectrometry

For LC/MS/MS analysis, 2 µL of the samples prepared the same way as those for HPLC/MS analysis was injected into the system. Agilent 1100 HPLC (Agilent, CA, USA) with a mass spectrometer, 4000 QTRAP MS/MS system (AB SCIEX, Framingham, MA, USA) in negative ion mode, was used with L-column2 ODS (1.5 × 150 mm) Type L2-C 18.5 µm, 12 mm (GL Science, Tokyo, Japan), and elution was carried out using 90% solution A (H₂O:HCOOH = 100:0.1) and 10% acetonitrile for 1 min, followed by a linear gradient from 90% solution A and 10% acetonitrile to 20% solution A and 80% acetonitrile over 7 min, which was maintained for 2 min. The flow rate was 0.2 mL/min. The MS/MS conditions were as follows: ion source temperature, 450°C; spray needle voltage, −4.5 kV; sheath gas pressures, 60 units for gas 1 and 70 units for gas 2; and curtain gas flow, 15 units. The collision energy was 20 V. In chromatograms, ions were detected by Q3 detector of the MS/MS.

Sample preparation for LC/MS/MS

Five hundred microliters of the culture was acidified with HCl (pH 2) and extracted with 1-mL ethyl acetate twice. The ethyl acetate layer was dried, resolved in 600-µL methanol, and stored at −60°C, and 2 µL of the methanol solution was subjected to LC/MS/MS analysis within 2 days.

ACKNOWLEDGMENTS

M.H. appreciates Dr. Reizo Kato (head of Condensed Molecular Materials Laboratory, RIKEN) and Dr. Yousoo Kim (head of Surface and Interface Science Laboratory, RIKEN) for thoughtful supports and advice.

The authors thank Dr. Takemichi Nakamura (Molecular Structure Characterization Unit, RIKEN CSRS, WAKO) for his assistance in mass spectrometry and Dr. Hiroyuki Koshino (Molecular Structure Characterization Unit, RIKEN CSRS, WAKO) for his assistance in NMR analysis.

Contributor Information

Masae Horinouchi, Email: masae@riken.jp.

Jennifer B. Glass, Georgia Institute of Technology, Atlanta, Georgia, USA

DATA AVAILABILITY

The data that support the findings of this study are available from the corresponding author, M.H., upon reasonable request.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aem.01050-23.

Fig. S1. aem.01050-23-s0001.pdf.

Fig. S1.

Click here for additional data file.^{(350.1KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF1

Fig. S2. aem.01050-23-s0002.pdf.

Fig. S2.

Click here for additional data file.^{(382.9KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF2

Fig. S3. aem.01050-23-s0003.pdf.

Fig. S3.

Click here for additional data file.^{(434.9KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF3

Fig. S4. aem.01050-23-s0004.pdf.

Fig. S4.

Click here for additional data file.^{(442.7KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF4

Fig. S5. aem.01050-23-s0005.pdf.

Fig. S5.

Click here for additional data file.^{(488.3KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF5

Fig. S6. aem.01050-23-s0006.pdf.

Fig. S6.

Click here for additional data file.^{(210.4KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF6

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.

REFERENCES

1. Dodson RM, Muir RD. 1961. Microbiological transformations. IV. The microbiological aromatization of steroids. J Am Chem Soc 83:4627–4631. doi: 10.1021/ja01483a029 [DOI] [Google Scholar]
2. Sih CJ, Wang KC, Gibson DT, Whitlock HW. 1965. On the mechanism of ring a cleavage in the degradation of 9,10-seco steroids by microorganisms. J Am Chem Soc 87:1386–1387. doi: 10.1021/ja01084a043 [DOI] [PubMed] [Google Scholar]
3. Sih CJ, Lee SS, Tsong YK, Wang KC. 1966. Mechanisms of steroid oxidation by microorganisms. VIII. 3,4-dihydroxy-9,10-secoandrosta-1,3,5(10)-triene-9,17-dione, an intermediate in the microbiological degradation of ring a of androst-4-ene-3,17-dione. J Biol Chem 241:540–550. [PubMed] [Google Scholar]
4. Gibson DT, Wang KC, Sih CJ, Whitlock H. 1966. Mechanisms of steroid oxidation by microorganisms. IX. on the mechanism of ring a cleavage in the degradation of 9,10-seco steroids by microorganisms. J Biol Chem 241:551–559. [PubMed] [Google Scholar]
5. Coulter AW, Talalay P. 1968. Studies on the microbiological degradation of steroid ring A. J Biol Chem 243:3238–3247. [PubMed] [Google Scholar]
6. Pandey AK, Sassetti CM. 2008. Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci U S A 105:4376–4380. doi: 10.1073/pnas.0711159105 [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Wipperman MF, Sampson NS, Thomas ST. 2014. Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis. Crit Rev Biochem Mol Biol 49:269–293. doi: 10.3109/10409238.2014.895700 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. An C, Chon H, Ku W, Eom S, Seok M, Kim S, Lee J, Kim D, Lee S, Koo H, Cho H, Han S, Moon J, Kang M, Ryu K. 2022. Bile acids: major regulator of the gut microbiome. Microorganisms 10:1792. doi: 10.3390/microorganisms10091792 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Diviccaro S, FitzGerald JA, Cioffi L, Falvo E, Crispie F, Cotter PD, O’Mahony SM, Giatti S, Caruso D, Melcangi RC. 2022. Gut steroids and microbiota: effect of gonadectomy and sex. Biomolecules 12:767. doi: 10.3390/biom12060767 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Zhang YJ, Li S, Gan RY, Zhou T, Xu DP, Li HB. 2015. Impacts of gut bacteria on human health and diseases. Int J Mol Sci 16:7493–7519. doi: 10.3390/ijms16047493 [DOI] [PMC free article] [PubMed] [Google Scholar]
11. Clemente JC, Ursell LK, Parfrey LW, Knight R. 2012. The impact of the gut microbiota on human health: an integrative view. Cell 148:1258–1270. doi: 10.1016/j.cell.2012.01.035 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Mulak A. 2021. Bile acids as key modulators of the brain-gut-microbiota axis in alzheimer’s disease. J Alzheimers Dis 84:461–477. doi: 10.3233/JAD-210608 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Martin CR, Osadchiy V, Kalani A, Mayer EA. 2018. The brain-gut-microbiome axis. Cell Mol Gastroenterol Hepatol 6:133–148. doi: 10.1016/j.jcmgh.2018.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
14. Feller FM, Holert J, Yücel O, Philipp B. 2021. Degradation of bile acids by soil and water bacteria. Microorganisms 9:1759. doi: 10.3390/microorganisms9081759 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Tarlera S, Denner EBM. 2003. Sterolibacterium denitrificans gen. nov., sp. nov., a novel cholesterol-oxidizing, denitrifying member of the beta-proteobacteria. Int J Syst Evol Microbiol 53:1085–1091. doi: 10.1099/ijs.0.02039-0 [DOI] [PubMed] [Google Scholar]
16. Wang PH, Yu CP, Lee TH, Lin CW, Ismail W, Wey SP, Kuo AT, Chiang YR. 2014. Anoxic androgen degradation by the denitrifying bacterium Sterolibacterium denitrificans via the 2,3-seco pathway. Appl Environ Microbiol 80:3442–3452. doi: 10.1128/AEM.03880-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Ryan MP, Sevjahova L, Gorman R, White S. 2022. The emergence of the genus comamonas as important opportunistic pathogens. Pathogens 11:1032. doi: 10.3390/pathogens11091032 [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Genti-Raimondi S, Tolmasky ME, Patrito LC, Flury A, Actis LA. 1991. Molecular cloning and expression of the b-hydroxysteroid dehydrogenase gene from Pseudomonas testosteroni. Gene 105:43–49. doi: 10.1016/0378-1119(91)90512-a [DOI] [PubMed] [Google Scholar]
19. Cabrera JE, Pruneda Paz JL, Genti-Raimondi S. 2000. Steroid-inducible transcription of the 3β/17β-hydroxysteroid dehydrogenase gene (3β/17β-hsd) in Comamonas testosteroni. J Steroid Biochem Mol Biol 73:147–152. [DOI] [PubMed] [Google Scholar]
20. Benach J, Filling C, Oppermann UCT, Roversi P, Bricogne G, Berndt KD, Jörnvall H, Ladenstein R. 2002. Structure of bacterial 3β/17β-hydroxysteroid dehydrogenase at 1.2 a resolution: a model for multiple steroid recognition. Biochemistry 41:14659–14668. doi: 10.1021/bi0203684 [DOI] [PubMed] [Google Scholar]
21. Pruneda-Paz JL, Linares M, Cabrera JE, Genti-Raimondi S. 2004. Identification of a novel steroid inducible gene associated with the beta hsd locus of Comamonas testosteroni. J Steroid Biochem Mol Biol 88:91–100. doi: 10.1016/j.jsbmb.2003.10.010 [DOI] [PubMed] [Google Scholar]
22. Oppermann UC, Maser E. 1996. Characterization of a 3α-hydroxysteroid dehydrogenase/carbonyl reductase from the gram-negative bacterium Comamonas testosteroni. Eur J Biochem 241:744–749. doi: 10.1111/j.1432-1033.1996.00744.x [DOI] [PubMed] [Google Scholar]
23. Möbus E, Maser E. 1999. Cloning and sequencing of a new Comamonas testosteroni gene encoding 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase. Adv Exp Med Biol 463:395–402. doi: 10.1007/978-1-4615-4735-8_49 [DOI] [PubMed] [Google Scholar]
24. Grimm C, Maser E, Möbus E, Klebe G, Reuter K, Ficner R. 2000. The crystal structure of 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas Testosteroni shows a novel oligomerization pattern within the short chain dehydrogenase/reductase family. J Biol Chem 275:41333–41339. doi: 10.1074/jbc.M007559200 [DOI] [PubMed] [Google Scholar]
25. Maser E, Möbus E, Xiong G. 2000. Functional expression, purification, and characterization of 3α-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas testosteroni. Biochem Biophys Res Commun 272:622–628. doi: 10.1006/bbrc.2000.2813 [DOI] [PubMed] [Google Scholar]
26. Maser E, Xiong G, Grimm C, Ficner R, Reuter K. 2001. 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas testosteroni: biological significance, three-dimensional structure and gene regulation. Chem Biol Interact 130–132:707–722. doi: 10.1016/s0009-2797(00)00302-1 [DOI] [PubMed] [Google Scholar]
27. Cho HS, Ha NC, Choi G, Kim HJ, Lee D, Oh KS, Kim KS, Lee W, Choi KY, Oh BH. 1999. Crystal structure of Δ(5)-3-ketosteroid isomerase from Pseudomonas testosteroni in complex with equilenin settles the correct hydrogen bonding scheme for transition state stabilization. J Biol Chem 274:32863–32868. doi: 10.1074/jbc.274.46.32863 [DOI] [PubMed] [Google Scholar]
28. Pollack RM, Thornburg LD, Wu ZR, Summers MF. 1999. Mechanistic insights from the three-dimensional structure of 3-oxo-Δ(5)-steroid isomerase. Arch Biochem Biophys 370:9–15. doi: 10.1006/abbi.1999.1384 [DOI] [PubMed] [Google Scholar]
29. Plesiat P, Grandguillot M, Harayama S, Vragar S, Michel-Briand Y. 1991. Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroidδ1-dehydrogenase. J Bacteriol 173:7219–7227. doi: 10.1128/jb.173.22.7219-7227.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
30. Florin C, Köhler T, Grandguillot M, Plesiat P. 1996. Comamonas testosteroni 3-ketosteroid-Δ4(5α)-dehydrogenase: gene and protein characterization. J Bacteriol 178:3322–3330. doi: 10.1128/jb.178.11.3322-3330.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Pruneda-Paz JL, Linares M, Cabrera JE, Genti-Raimondi S. 2004. TeiR, a LuxR-type transcription factor required for testosterone degradation in Comamonas testosteroni. J Bacteriol 186:1430–1437. doi: 10.1128/JB.186.5.1430-1437.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
32. Horinouchi M, Yamamoto T, Taguchi K, Arai H, Kudo T. 2001. Meta-cleavage enzyme gene tesB is necessary for testosterone degradation in Comamonas testosteroni TA441. Microbiology (Reading) 147:3367–3375. doi: 10.1099/00221287-147-12-3367 [DOI] [PubMed] [Google Scholar]
33. Horinouchi M, Hayashi T, Koshino H, Yamamoto T, Kudo T. 2003. Gene encoding the hydrolase for the product of the meta-cleavage reaction in testosterone degradation by Comamonas testosteroni. Appl Environ Microbiol 69:2139–2152. doi: 10.1128/AEM.69.4.2139-2152.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Horinouchi M, Hayashi T, Yamamoto T, Kudo T. 2003. A new bacterial steroid degradation gene cluster which consists of aromatic compound degradation genes for seco-steroids and 3-ketosteroid dehydrogenase genes in Comamonas testosteroni TA441. Appl Environ Microbiol 69:4421–4430. doi: 10.1128/AEM.69.8.4421-4430.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Horinouchi M, Hayashi T, Kudo T. 2004. The genes encoding the hydroxylase of 3-hydroxy-9,10-secoandrosta-1,3,5(10)-triene-9,17-dione in steroid degradation in Comamonas testosteroni TA441. J Steroid Biochem Mol Biol 92:143–154. doi: 10.1016/j.jsbmb.2004.09.002 [DOI] [PubMed] [Google Scholar]
36. Horinouchi M, Kurita T, Yamamoto T, Hatori E, Hayashi T, Kudo T. 2004. Steroid degradation gene cluster of Comamonas testosteroni consisting of 18 putative genes from meta-cleavage enzyme gene tesB to regulator gene tesR. Biochem Biophys Res Commun 324:597–604. doi: 10.1016/j.bbrc.2004.09.096 [DOI] [PubMed] [Google Scholar]
37. Horinouchi M, Hayashi T, Koshino H, Kurita T, Kudo T. 2005. Identification of 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid, 4-hydroxy-2-oxohexanoic acid, and 2-hydroxyhexa-2,4-dienoic acid and related enzymes involved in testosterone degradation in Comamonas testosteroni TA441. Appl Environ Microbiol 71:5275–5281. doi: 10.1128/AEM.71.9.5275-5281.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Horinouchi M, Kurita T, Hayashi T, Kudo T. 2010. Steroid degradation genes in Comamonas testosteroni TA441: isolation of genes encoding a delta4(5)-isomerase and 3alpha- and 3beta-dehydrogenases and evidence for a 100 kb steroid degradation gene hot spot. J Steroid Biochem Mol Biol 122:253–263. doi: 10.1016/j.jsbmb.2010.06.002 [DOI] [PubMed] [Google Scholar]
39. Horinouchi M, Hayashi T, Kudo T. 2012. Steroid degradation in Comamonas testosteroni. J Steroid Biochem Mol Biol 129:4–14. doi: 10.1016/j.jsbmb.2010.10.008 [DOI] [PubMed] [Google Scholar]
40. Horinouchi M, Hayashi T, Koshino H, Kudo T. 2006. ORF18-disrupted mutant of Comamonas testosteroni TA441 accumulates significant amounts of 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid and its derivatives after incubation with steroids. J Steroid Biochem Mol Biol 101:78–84. doi: 10.1016/j.jsbmb.2006.06.006 [DOI] [PubMed] [Google Scholar]
41. Horinouchi M, Hayashi T, Koshino H, Malon M, Hirota H, Kudo T. 2014. Identification of 9alpha-hydroxy-17-oxo-1,2,3,4,10,19-Hexanorandrost-6-en-5-oic acid and beta-oxidation products of the C-17 side chain in cholic acid degradation by Comamonas testosteroni TA441. J Steroid Biochem Mol Biol 143:306–322. doi: 10.1016/j.jsbmb.2014.04.014 [DOI] [PubMed] [Google Scholar]
42. Horinouchi M, Hayashi T, Koshino H, Malon M, Hirota H, Kudo T. 2014. Identification of 9alpha-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid in steroid degradation by Comamonas testosteroni TA441 and its conversion to the corresponding 6-en-5-oyl coenzyme A (CoA) involving open reading frame 28 (ORF28)- and ORF30-encoded acyl-CoA dehydrogenases. J Bacteriol 196:3598–3608. doi: 10.1128/JB.01878-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2019. Steroid degradation in Comamonas testosteroni TA441: identification of the entire β-oxidation cycle of the cleaved B ring. Appl Environ Microbiol 85:e01204-19. doi: 10.1128/AEM.01204-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2018. Steroid degradation in Comamonas testosteroni TA441: identification of metabolites and the genes involved in the reactions necessary before D-ring cleavage. Appl Environ Microbiol 84:e01324-18. doi: 10.1128/AEM.01324-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
45. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2019. Identification of 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-ene-7,17-dioic acid as a metabolite of steroid degradation in Comamonas testosteroni TA441 and the genes involved in the conversion. J Steroid Biochem Mol Biol 185:268–276. doi: 10.1016/j.jsbmb.2018.07.009 [DOI] [PubMed] [Google Scholar]
46. Horinouchi M, Hayashi T. 2021. Identification of the coenzyme a (CoA) ester intermediates and genes involved in the cleavage and degradation of the steroidal c-ring by Comamonas testosteroni TA441. Appl Environ Microbiol 87:e0110221. doi: 10.1128/AEM.01102-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
47. Crowe AM, Workman SD, Watanabe N, Worrall LJ, Strynadka NCJ, Eltis LD. 2018. IpdAB, a virulence factor in Mycobacterium tuberculosis, is a cholesterol ring-cleaving hydrolase. Proc Natl Acad Sci U S A 115:E3378–E3387. doi: 10.1073/pnas.1717015115 [DOI] [PMC free article] [PubMed] [Google Scholar]
48. Crowe AM, Casabon I, Brown KL, Liu J, Lian J, Rogalski JC, Hurst TE, Snieckus V, Foster LJ, Eltis LD. 2017. Catabolism of the last two steroid rings in Mycobacterium tuberculosis and other bacteria. mBio 8:e00321-17. doi: 10.1128/mBio.00321-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
49. Arai H, Yamamoto T, Ohishi T, Shimizu T, Nakata T, Kudo T. 1999. Genetic organization and characteristics of the 3-(3-hydroxyphenyl)propionic acid degradation pathway of Comamonas testosteroni TA441. Microbiology (Reading) 145 (Pt 10):2813–2820. doi: 10.1099/00221287-145-10-2813 [DOI] [PubMed] [Google Scholar]
50. Nagata Y, Nariya T, Ohtomo R, Fukuda M, Yano K, Takagi M. 1993. Cloning and sequencing of a dehalogenase gene encoding an enzyme with hydrolase activity involved in the degradation of γ-hexachlorocyclohexane (γ-HCH) in Pseudomonas paucimobilis. J Bacteriol 175:6403–6410. doi: 10.1128/jb.175.20.6403-6410.1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
51. Arai H, Akahira S, Ohishi T, Maeda M, Kudo T. 1998. Adaptation of Comamonas testosteroni TA441 to utilize phenol: organization and regulation of the genes involved in phenol degradation. Microbiology (Reading) 144 (Pt 10):2895–2903. doi: 10.1099/00221287-144-10-2895 [DOI] [PubMed] [Google Scholar]
52. Vieira J, Messing J. 1987. Production of single-stranded plasmid DNA. Methods Enzymol 153:3–11. doi: 10.1016/0076-6879(87)53044-0 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. aem.01050-23-s0001.pdf.

Fig. S1.

Click here for additional data file.^{(350.1KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF1

Fig. S2. aem.01050-23-s0002.pdf.

Fig. S2.

Click here for additional data file.^{(382.9KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF2

Fig. S3. aem.01050-23-s0003.pdf.

Fig. S3.

Click here for additional data file.^{(434.9KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF3

Fig. S4. aem.01050-23-s0004.pdf.

Fig. S4.

Click here for additional data file.^{(442.7KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF4

Fig. S5. aem.01050-23-s0005.pdf.

Fig. S5.

Click here for additional data file.^{(488.3KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF5

Fig. S6. aem.01050-23-s0006.pdf.

Fig. S6.

Click here for additional data file.^{(210.4KB, pdf)}

DOI: 10.1128/aem.01050-23.SuF6

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, M.H., upon reasonable request.

[B1] 1. Dodson RM, Muir RD. 1961. Microbiological transformations. IV. The microbiological aromatization of steroids. J Am Chem Soc 83:4627–4631. doi: 10.1021/ja01483a029 [DOI] [Google Scholar]

[B2] 2. Sih CJ, Wang KC, Gibson DT, Whitlock HW. 1965. On the mechanism of ring a cleavage in the degradation of 9,10-seco steroids by microorganisms. J Am Chem Soc 87:1386–1387. doi: 10.1021/ja01084a043 [DOI] [PubMed] [Google Scholar]

[B3] 3. Sih CJ, Lee SS, Tsong YK, Wang KC. 1966. Mechanisms of steroid oxidation by microorganisms. VIII. 3,4-dihydroxy-9,10-secoandrosta-1,3,5(10)-triene-9,17-dione, an intermediate in the microbiological degradation of ring a of androst-4-ene-3,17-dione. J Biol Chem 241:540–550. [PubMed] [Google Scholar]

[B4] 4. Gibson DT, Wang KC, Sih CJ, Whitlock H. 1966. Mechanisms of steroid oxidation by microorganisms. IX. on the mechanism of ring a cleavage in the degradation of 9,10-seco steroids by microorganisms. J Biol Chem 241:551–559. [PubMed] [Google Scholar]

[B5] 5. Coulter AW, Talalay P. 1968. Studies on the microbiological degradation of steroid ring A. J Biol Chem 243:3238–3247. [PubMed] [Google Scholar]

[B6] 6. Pandey AK, Sassetti CM. 2008. Mycobacterial persistence requires the utilization of host cholesterol. Proc Natl Acad Sci U S A 105:4376–4380. doi: 10.1073/pnas.0711159105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7. Wipperman MF, Sampson NS, Thomas ST. 2014. Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis. Crit Rev Biochem Mol Biol 49:269–293. doi: 10.3109/10409238.2014.895700 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. An C, Chon H, Ku W, Eom S, Seok M, Kim S, Lee J, Kim D, Lee S, Koo H, Cho H, Han S, Moon J, Kang M, Ryu K. 2022. Bile acids: major regulator of the gut microbiome. Microorganisms 10:1792. doi: 10.3390/microorganisms10091792 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Diviccaro S, FitzGerald JA, Cioffi L, Falvo E, Crispie F, Cotter PD, O’Mahony SM, Giatti S, Caruso D, Melcangi RC. 2022. Gut steroids and microbiota: effect of gonadectomy and sex. Biomolecules 12:767. doi: 10.3390/biom12060767 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Zhang YJ, Li S, Gan RY, Zhou T, Xu DP, Li HB. 2015. Impacts of gut bacteria on human health and diseases. Int J Mol Sci 16:7493–7519. doi: 10.3390/ijms16047493 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11. Clemente JC, Ursell LK, Parfrey LW, Knight R. 2012. The impact of the gut microbiota on human health: an integrative view. Cell 148:1258–1270. doi: 10.1016/j.cell.2012.01.035 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Mulak A. 2021. Bile acids as key modulators of the brain-gut-microbiota axis in alzheimer’s disease. J Alzheimers Dis 84:461–477. doi: 10.3233/JAD-210608 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Martin CR, Osadchiy V, Kalani A, Mayer EA. 2018. The brain-gut-microbiome axis. Cell Mol Gastroenterol Hepatol 6:133–148. doi: 10.1016/j.jcmgh.2018.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14. Feller FM, Holert J, Yücel O, Philipp B. 2021. Degradation of bile acids by soil and water bacteria. Microorganisms 9:1759. doi: 10.3390/microorganisms9081759 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Tarlera S, Denner EBM. 2003. Sterolibacterium denitrificans gen. nov., sp. nov., a novel cholesterol-oxidizing, denitrifying member of the beta-proteobacteria. Int J Syst Evol Microbiol 53:1085–1091. doi: 10.1099/ijs.0.02039-0 [DOI] [PubMed] [Google Scholar]

[B16] 16. Wang PH, Yu CP, Lee TH, Lin CW, Ismail W, Wey SP, Kuo AT, Chiang YR. 2014. Anoxic androgen degradation by the denitrifying bacterium Sterolibacterium denitrificans via the 2,3-seco pathway. Appl Environ Microbiol 80:3442–3452. doi: 10.1128/AEM.03880-13 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Ryan MP, Sevjahova L, Gorman R, White S. 2022. The emergence of the genus comamonas as important opportunistic pathogens. Pathogens 11:1032. doi: 10.3390/pathogens11091032 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18. Genti-Raimondi S, Tolmasky ME, Patrito LC, Flury A, Actis LA. 1991. Molecular cloning and expression of the b-hydroxysteroid dehydrogenase gene from Pseudomonas testosteroni. Gene 105:43–49. doi: 10.1016/0378-1119(91)90512-a [DOI] [PubMed] [Google Scholar]

[B19] 19. Cabrera JE, Pruneda Paz JL, Genti-Raimondi S. 2000. Steroid-inducible transcription of the 3β/17β-hydroxysteroid dehydrogenase gene (3β/17β-hsd) in Comamonas testosteroni. J Steroid Biochem Mol Biol 73:147–152. [DOI] [PubMed] [Google Scholar]

[B20] 20. Benach J, Filling C, Oppermann UCT, Roversi P, Bricogne G, Berndt KD, Jörnvall H, Ladenstein R. 2002. Structure of bacterial 3β/17β-hydroxysteroid dehydrogenase at 1.2 a resolution: a model for multiple steroid recognition. Biochemistry 41:14659–14668. doi: 10.1021/bi0203684 [DOI] [PubMed] [Google Scholar]

[B21] 21. Pruneda-Paz JL, Linares M, Cabrera JE, Genti-Raimondi S. 2004. Identification of a novel steroid inducible gene associated with the beta hsd locus of Comamonas testosteroni. J Steroid Biochem Mol Biol 88:91–100. doi: 10.1016/j.jsbmb.2003.10.010 [DOI] [PubMed] [Google Scholar]

[B22] 22. Oppermann UC, Maser E. 1996. Characterization of a 3α-hydroxysteroid dehydrogenase/carbonyl reductase from the gram-negative bacterium Comamonas testosteroni. Eur J Biochem 241:744–749. doi: 10.1111/j.1432-1033.1996.00744.x [DOI] [PubMed] [Google Scholar]

[B23] 23. Möbus E, Maser E. 1999. Cloning and sequencing of a new Comamonas testosteroni gene encoding 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase. Adv Exp Med Biol 463:395–402. doi: 10.1007/978-1-4615-4735-8_49 [DOI] [PubMed] [Google Scholar]

[B24] 24. Grimm C, Maser E, Möbus E, Klebe G, Reuter K, Ficner R. 2000. The crystal structure of 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas Testosteroni shows a novel oligomerization pattern within the short chain dehydrogenase/reductase family. J Biol Chem 275:41333–41339. doi: 10.1074/jbc.M007559200 [DOI] [PubMed] [Google Scholar]

[B25] 25. Maser E, Möbus E, Xiong G. 2000. Functional expression, purification, and characterization of 3α-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas testosteroni. Biochem Biophys Res Commun 272:622–628. doi: 10.1006/bbrc.2000.2813 [DOI] [PubMed] [Google Scholar]

[B26] 26. Maser E, Xiong G, Grimm C, Ficner R, Reuter K. 2001. 3alpha-hydroxysteroid dehydrogenase/carbonyl reductase from Comamonas testosteroni: biological significance, three-dimensional structure and gene regulation. Chem Biol Interact 130–132:707–722. doi: 10.1016/s0009-2797(00)00302-1 [DOI] [PubMed] [Google Scholar]

[B27] 27. Cho HS, Ha NC, Choi G, Kim HJ, Lee D, Oh KS, Kim KS, Lee W, Choi KY, Oh BH. 1999. Crystal structure of Δ(5)-3-ketosteroid isomerase from Pseudomonas testosteroni in complex with equilenin settles the correct hydrogen bonding scheme for transition state stabilization. J Biol Chem 274:32863–32868. doi: 10.1074/jbc.274.46.32863 [DOI] [PubMed] [Google Scholar]

[B28] 28. Pollack RM, Thornburg LD, Wu ZR, Summers MF. 1999. Mechanistic insights from the three-dimensional structure of 3-oxo-Δ(5)-steroid isomerase. Arch Biochem Biophys 370:9–15. doi: 10.1006/abbi.1999.1384 [DOI] [PubMed] [Google Scholar]

[B29] 29. Plesiat P, Grandguillot M, Harayama S, Vragar S, Michel-Briand Y. 1991. Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroidδ1-dehydrogenase. J Bacteriol 173:7219–7227. doi: 10.1128/jb.173.22.7219-7227.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30. Florin C, Köhler T, Grandguillot M, Plesiat P. 1996. Comamonas testosteroni 3-ketosteroid-Δ4(5α)-dehydrogenase: gene and protein characterization. J Bacteriol 178:3322–3330. doi: 10.1128/jb.178.11.3322-3330.1996 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Pruneda-Paz JL, Linares M, Cabrera JE, Genti-Raimondi S. 2004. TeiR, a LuxR-type transcription factor required for testosterone degradation in Comamonas testosteroni. J Bacteriol 186:1430–1437. doi: 10.1128/JB.186.5.1430-1437.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32. Horinouchi M, Yamamoto T, Taguchi K, Arai H, Kudo T. 2001. Meta-cleavage enzyme gene tesB is necessary for testosterone degradation in Comamonas testosteroni TA441. Microbiology (Reading) 147:3367–3375. doi: 10.1099/00221287-147-12-3367 [DOI] [PubMed] [Google Scholar]

[B33] 33. Horinouchi M, Hayashi T, Koshino H, Yamamoto T, Kudo T. 2003. Gene encoding the hydrolase for the product of the meta-cleavage reaction in testosterone degradation by Comamonas testosteroni. Appl Environ Microbiol 69:2139–2152. doi: 10.1128/AEM.69.4.2139-2152.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Horinouchi M, Hayashi T, Yamamoto T, Kudo T. 2003. A new bacterial steroid degradation gene cluster which consists of aromatic compound degradation genes for seco-steroids and 3-ketosteroid dehydrogenase genes in Comamonas testosteroni TA441. Appl Environ Microbiol 69:4421–4430. doi: 10.1128/AEM.69.8.4421-4430.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Horinouchi M, Hayashi T, Kudo T. 2004. The genes encoding the hydroxylase of 3-hydroxy-9,10-secoandrosta-1,3,5(10)-triene-9,17-dione in steroid degradation in Comamonas testosteroni TA441. J Steroid Biochem Mol Biol 92:143–154. doi: 10.1016/j.jsbmb.2004.09.002 [DOI] [PubMed] [Google Scholar]

[B36] 36. Horinouchi M, Kurita T, Yamamoto T, Hatori E, Hayashi T, Kudo T. 2004. Steroid degradation gene cluster of Comamonas testosteroni consisting of 18 putative genes from meta-cleavage enzyme gene tesB to regulator gene tesR. Biochem Biophys Res Commun 324:597–604. doi: 10.1016/j.bbrc.2004.09.096 [DOI] [PubMed] [Google Scholar]

[B37] 37. Horinouchi M, Hayashi T, Koshino H, Kurita T, Kudo T. 2005. Identification of 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid, 4-hydroxy-2-oxohexanoic acid, and 2-hydroxyhexa-2,4-dienoic acid and related enzymes involved in testosterone degradation in Comamonas testosteroni TA441. Appl Environ Microbiol 71:5275–5281. doi: 10.1128/AEM.71.9.5275-5281.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Horinouchi M, Kurita T, Hayashi T, Kudo T. 2010. Steroid degradation genes in Comamonas testosteroni TA441: isolation of genes encoding a delta4(5)-isomerase and 3alpha- and 3beta-dehydrogenases and evidence for a 100 kb steroid degradation gene hot spot. J Steroid Biochem Mol Biol 122:253–263. doi: 10.1016/j.jsbmb.2010.06.002 [DOI] [PubMed] [Google Scholar]

[B39] 39. Horinouchi M, Hayashi T, Kudo T. 2012. Steroid degradation in Comamonas testosteroni. J Steroid Biochem Mol Biol 129:4–14. doi: 10.1016/j.jsbmb.2010.10.008 [DOI] [PubMed] [Google Scholar]

[B40] 40. Horinouchi M, Hayashi T, Koshino H, Kudo T. 2006. ORF18-disrupted mutant of Comamonas testosteroni TA441 accumulates significant amounts of 9,17-dioxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid and its derivatives after incubation with steroids. J Steroid Biochem Mol Biol 101:78–84. doi: 10.1016/j.jsbmb.2006.06.006 [DOI] [PubMed] [Google Scholar]

[B41] 41. Horinouchi M, Hayashi T, Koshino H, Malon M, Hirota H, Kudo T. 2014. Identification of 9alpha-hydroxy-17-oxo-1,2,3,4,10,19-Hexanorandrost-6-en-5-oic acid and beta-oxidation products of the C-17 side chain in cholic acid degradation by Comamonas testosteroni TA441. J Steroid Biochem Mol Biol 143:306–322. doi: 10.1016/j.jsbmb.2014.04.014 [DOI] [PubMed] [Google Scholar]

[B42] 42. Horinouchi M, Hayashi T, Koshino H, Malon M, Hirota H, Kudo T. 2014. Identification of 9alpha-hydroxy-17-oxo-1,2,3,4,10,19-hexanorandrostan-5-oic acid in steroid degradation by Comamonas testosteroni TA441 and its conversion to the corresponding 6-en-5-oyl coenzyme A (CoA) involving open reading frame 28 (ORF28)- and ORF30-encoded acyl-CoA dehydrogenases. J Bacteriol 196:3598–3608. doi: 10.1128/JB.01878-14 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2019. Steroid degradation in Comamonas testosteroni TA441: identification of the entire β-oxidation cycle of the cleaved B ring. Appl Environ Microbiol 85:e01204-19. doi: 10.1128/AEM.01204-19 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2018. Steroid degradation in Comamonas testosteroni TA441: identification of metabolites and the genes involved in the reactions necessary before D-ring cleavage. Appl Environ Microbiol 84:e01324-18. doi: 10.1128/AEM.01324-18 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45. Horinouchi M, Koshino H, Malon M, Hirota H, Hayashi T. 2019. Identification of 9-oxo-1,2,3,4,5,6,10,19-octanor-13,17-secoandrost-8(14)-ene-7,17-dioic acid as a metabolite of steroid degradation in Comamonas testosteroni TA441 and the genes involved in the conversion. J Steroid Biochem Mol Biol 185:268–276. doi: 10.1016/j.jsbmb.2018.07.009 [DOI] [PubMed] [Google Scholar]

[B46] 46. Horinouchi M, Hayashi T. 2021. Identification of the coenzyme a (CoA) ester intermediates and genes involved in the cleavage and degradation of the steroidal c-ring by Comamonas testosteroni TA441. Appl Environ Microbiol 87:e0110221. doi: 10.1128/AEM.01102-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47. Crowe AM, Workman SD, Watanabe N, Worrall LJ, Strynadka NCJ, Eltis LD. 2018. IpdAB, a virulence factor in Mycobacterium tuberculosis, is a cholesterol ring-cleaving hydrolase. Proc Natl Acad Sci U S A 115:E3378–E3387. doi: 10.1073/pnas.1717015115 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48. Crowe AM, Casabon I, Brown KL, Liu J, Lian J, Rogalski JC, Hurst TE, Snieckus V, Foster LJ, Eltis LD. 2017. Catabolism of the last two steroid rings in Mycobacterium tuberculosis and other bacteria. mBio 8:e00321-17. doi: 10.1128/mBio.00321-17 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49. Arai H, Yamamoto T, Ohishi T, Shimizu T, Nakata T, Kudo T. 1999. Genetic organization and characteristics of the 3-(3-hydroxyphenyl)propionic acid degradation pathway of Comamonas testosteroni TA441. Microbiology (Reading) 145 (Pt 10):2813–2820. doi: 10.1099/00221287-145-10-2813 [DOI] [PubMed] [Google Scholar]

[B50] 50. Nagata Y, Nariya T, Ohtomo R, Fukuda M, Yano K, Takagi M. 1993. Cloning and sequencing of a dehalogenase gene encoding an enzyme with hydrolase activity involved in the degradation of γ-hexachlorocyclohexane (γ-HCH) in Pseudomonas paucimobilis. J Bacteriol 175:6403–6410. doi: 10.1128/jb.175.20.6403-6410.1993 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51. Arai H, Akahira S, Ohishi T, Maeda M, Kudo T. 1998. Adaptation of Comamonas testosteroni TA441 to utilize phenol: organization and regulation of the genes involved in phenol degradation. Microbiology (Reading) 144 (Pt 10):2895–2903. doi: 10.1099/00221287-144-10-2895 [DOI] [PubMed] [Google Scholar]

[B52] 52. Vieira J, Messing J. 1987. Production of single-stranded plasmid DNA. Methods Enzymol 153:3–11. doi: 10.1016/0076-6879(87)53044-0 [DOI] [PubMed] [Google Scholar]

PERMALINK

Identification of “missing links” in C- and D-ring cleavage of steroids by Comamonas testosteroni TA441

Masae Horinouchi

Toshiaki Hayashi

Roles

ABSTRACT

IMPORTANCE

INTRODUCTION

Fig 1.

RESULTS AND DISCUSSION

Characterization of “missing link” intermediates in C- and D-ring cleavage

Fig 2.

Fig 3.

Construction of plasmid pMFYMhpR for the induction of target genes in TA441 mutants

Fig 4.

Fig 5.

Characterization of the product of ScdY

Fig 6.

Characterization of the product of ScdL1L2

Fig 7.

Fig 8.

Conclusion

Fig 9.

MATERIALS AND METHODS

Culture conditions

Construction of deletion mutants, plasmids, and mutants for complementation experiments

TABLE 1.

TABLE 2.

TABLE 3.

Reverse-phase liquid chromatography with tandem mass spectrometry

Sample preparation for LC/MS/MS

ACKNOWLEDGMENTS

Contributor Information

DATA AVAILABILITY

SUPPLEMENTAL MATERIAL

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases