Skip to main content
PMC home page
eLife logoLink to eLife
. 2023 Nov 22;12:RP88745. doi: 10.7554/eLife.88745

Overburdened ferroptotic stress impairs tooth morphogenesis

Haisheng Wang 1,†, Xiaofeng Wang 1,2,†, Liuyan Huang 1,2, Chenglin Wang 2, Fanyuan Yu 1,2,✉, Ling Ye 1,2,✉
Editors: Carlos Isales3, Carlos Isales4
PMCID: PMC10665014  PMID: 37991825

Abstract

The role of regulated cell death in organ development, particularly the impact of non-apoptotic cell death, remains largely uncharted. Ferroptosis, a non-apoptotic cell death pathway known for its iron dependence and lethal lipid peroxidation, is currently being rigorously investigated for its pathological functions. The balance between ferroptotic stress (iron and iron-dependent lipid peroxidation) and ferroptosis supervising pathways (anti-lipid peroxidation systems) serves as the key mechanism regulating the activation of ferroptosis. Compared with other forms of regulated necrotic cell death, ferroptosis is critically related to the metabolism of lipid and iron which are also important in organ development. In our study, we examined the role of ferroptosis in organogenesis using an ex vivo tooth germ culture model, investigating the presence and impact of ferroptotic stress on tooth germ development. Our findings revealed that ferroptotic stress increased during tooth development, while the expression of glutathione peroxidase 4 (Gpx4), a crucial anti-lipid peroxidation enzyme, also escalated in dental epithelium/mesenchyme cells. The inhibition of ferroptosis was found to partially rescue erastin-impaired tooth morphogenesis. Our results suggest that while ferroptotic stress is present during tooth organogenesis, its effects are efficaciously controlled by the subsequent upregulation of Gpx4. Notably, an overabundance of ferroptotic stress, as induced by erastin, suppresses tooth morphogenesis.

Research organism: Mouse

Introduction

A delicate balance between cell division and regulated cell death (RCD) is crucial for the development of tissues and organs (Ghose and Shaham, 2020). In organs such as the nervous, immune, and reproductive systems, cells are initially produced in excess and are subsequently removed by RCD. During organ development, structures with transient functions are also eliminated by RCD when they are no longer necessary (Reynaud and Driancourt, 2000). The best-known example of this is the formation of digits in higher vertebrates, where the interdigital webs are eliminated primarily through the apoptotic machinery (Lindsten et al., 2000). RCD plays a vital role in animal development and adult life by eliminating abnormal and potentially harmful cells (Opferman and Korsmeyer, 2003). Apoptosis is the most extensively studied form of RCD which shrinks the nucleus and buds the plasma membrane (without rupturing it), making it essential in achieving cell number regulation, tissue remodeling, and sculpting structures, driving morphogenesis during organ development (Fuchs and Steller, 2011).

However, several new types of cell death, including pyroptosis, necroptosis, and ferroptosis, have been discovered (Galluzzi et al., 2018). Unlike apoptosis, these newly discovered RCDs are characterized by pore formation and/or rupture of the plasma membrane, thus termed as regulated necrotic cell death (RNCD) (Bedoui et al., 2020). While apoptosis benefits organ morphogenesis in certain circumstances, whether RNCD and its regulatory mechanisms are biologically required in organ development remains poorly understood. Pyroptosis and necroptosis are mainly activated by external pathogens or damage-associated molecular patterns (Yuan et al., 2016), whereas ferroptosis is a distinct form of iron-dependent, lipid peroxidation-driven programmed cell death (Stockwell, 2022). Ferroptosis is a particular type of cell death that links lipid metabolism, reactive oxygen species (ROS) biology, iron regulation, and disease (Stockwell et al., 2017). Despite the pathological role of ferroptosis and/or ferroptotic stress in multiple diseases (Zou and Schreiber, 2020; Jiang et al., 2021), recent studies have identified the occurrence of ferroptosis in embryonal erythropoiesis and aging (Zheng et al., 2021) and aged skeletal muscle (Ding et al., 2021), indicating its unrecognized role in physiological processes. Unlike autonomous activation of apoptosis during organ development, the broken balance between ferroptotic stress and its suppressing mechanisms is now considered the main reason for ferroptosis. Recent studies demonstrated that MYSM1 deficiency causes human hematopoietic stem cell loss by ferroptosis, highlighting the broader developmental and regenerative role of ferroptosis (Zhao et al., 2023). The investigation into the potential involvement of ferroptosis and/or ferroptotic stress, other than rest forms of non-apoptotic cell death like pyroptosis and necroptosis, in organ morphogenesis is an area of great interest. However, conducting high-throughput analysis through in vivo studies presents challenges as it relies heavily on generating specific transgenic mice since erastin, the classic small molecule used to induce ferroptosis, is feasible in vivo (Gao et al., 2016). Thus, there is a crucial need for a more adequate model to explore the ferroptosis/ferroptotic stress involved in development.

The process of tooth development, which contains cell number regulation (proliferation, differentiation, and extinction of ameloblast), tissue remodeling (elimination of transient structure called enamel knot), and sculpting structures (cusp formation) (Zhang et al., 2005; Liu et al., 2008), is an ideal model for the investigation of RCD in organ development. Moreover, ex vivo culture of tooth germ is a well-established study system that allows the controlled manipulation of environmental, genetic, and pharmacological factors (like erastin), which can influence the developmental events of tooth (He et al., 2019), providing compelling evidence for its usefulness as an efficient research model in studying ferroptosis/ferroptotic stress within the developmental process (Dunglas et al., 1999).

In this study, erastin was used in an ex vivo culture model of tooth germ to investigate the possible role of ferroptosis during tooth morphogenesis. To definitively identify ferroptosis, multiple markers are needed, including lipid peroxidation, iron accumulation, mitochondria injury, and the expression of ferroptosis-related genes (Stockwell, 2022). According to our results, glutathione peroxidase 4 (Gpx4, a peroxidase to counter the oxidation of lipids in membranes) (Yang et al., 2014) is upregulated according to odontogenesis and amelogenesis, together with obvious accumulation of iron. Erastin significantly suppressed the morphogenesis of cultured tooth germ and showed a dose-dependent manner. Meanwhile, erastin-treated tooth germ has elevated lipid peroxidation indicated by expression of 4-hydroxy-2-nonenal (4-HNE, end-product of lipid peroxidation), enhanced iron accumulation, shrunken mitochondria, and alternated expression of ferroptosis related genes. However, all these phenomena could be partially rescued by ferrostatin-1 (Fer-1), a classical inhibitor of ferroptosis.

In summary, our results suggest that erastin induces morphological defects of tooth germ conducted by the activation of ferroptosis. Ferroptotic stress and its regulatory mechanism participate in tooth morphogenesis, which borders our understanding of the physiological function of non-apoptotic RCD in organ development.

Results

Spatiotemporal characterization of Gpx4 expression and iron accumulation in tooth morphogenesis

In the different developmental stages of the mouse’s first mandibular molar, the expression of Gpx4 was detected by immunohistochemistry (IHC) (Figure 1A). These data revealed gradually upregulated expression of Gpx4 in tooth germ from embryonic day (E) 13.5 to E17.5 (Figure 1Aa–c), but started to decrease from PN1 to PN3 (Figure 1Ad and e). An enlarged view of each group indicated a different expression level of Gpx4 between dental epithelia and mesenchyme (Figure 1Aa’–e’). After calculating the integrated optical density (IOD) Figure 1—source data 1 of Gpx4 in epithelia, mesenchyme, and total area of tooth germ, respectively, we found that Gpx4 in dental epithelia is higher than that in mesenchyme, although they both increased from E13.5 to E17.5, which could be observed in Figure 1Aa’–d’. Negative controls are listed in Figure 1—figure supplement 1A.

Figure 1. Spatiotemporal characterization of glutathione peroxidase 4 (Gpx4) expression and iron accumulation in tooth morphogenesis.

(A) (i–v) HE staining for tooth germ in E13.5 to PN3, scale bars = 200 μm. (a–e) Gpx4 expression detected by immunohistochemistry (IHC), scale bars = 200 μm. (a’–e’) Enlarged view of each Gpx4 staining, scale bars = 50 μm; epithelia versus mesenchyme, n=3, ***p<0.001. (B) (i–v) Iron probe staining in for tooth germ in E13.5 to PN3, scale bars = 200 μm. (a–e) Enlarged view of selected region, scale bars = 100 μm, low concentration (a’–e’, blue) and high concentration of iron (a’’–e’’, red) are present, scale bars = 100 μm. Epi, Epithelia; Mes, = mesenchyme.

Figure 1—source data 1. Source data for the integrated optical density of glutathione peroxidase 4 (Gpx4) in epithelia, mesenchyme, and total area of tooth in Figure 1A.

Figure 1.

Figure 1—figure supplement 1. Negative control of IHC staining and the general view of ex vivo cultured tooth germ from D0 to D7.

Figure 1—figure supplement 1.

(A) Negative control of different developmental stage of molar germ in glutathione peroxidase 4 (Gpx4) immunohistochemistry (IHC) staining. (B) Ex vivo culture of tooth molar germ from D0 to D7. Scale bars = 20 μm.
Open in a new tab

Iron accumulation, one of the core risk factors for ferroptosis, was detected by TPE-o-Py (ortho-substituted pyridinyl-functionalized tetraphenylethylene) (Feng et al., 2018 using IF Figure 1B). The results showed accumulation of iron is upregulated within dental epithelium and mesenchymal cells during differentiation of odontoblast and ameloblast (Figure 1Ba–c) then decreased at PN1 which is consistent to the expression pattern of Gpx4. However, at PN3, the active secretory period of both ameloblast and odontoblast, the accumulation of iron rebound to a high level and distributed within enamel (Figure 1Be).

Collectively, our results demonstrated that at early stage of tooth development, enhancing risk factors of ferroptosis (iron accumulation) was accompanied by strengthening anti-ferroptosis mechanism (upregulation of Gpx4), and the accumulation of iron and the expression of Gpx4 in dental epithelium/mesenchymal cells and extracellular matrix are critically related to the developmental stage.

Erastin impairs tooth morphogenesis, especially within dental mesenchyme

To investigate the possible function of ferroptosis in tooth development, an ex vivo culture model of the molar germ was established as described before (Jiang et al., 2017), with or without treatment of erastin. Successful ex vivo culturing of tooth germ from D0 to D7 is presented in Figure 1—figure supplement 1B. All the molar germs were dissected from E15.5 mousses’ mandibles and cultured in medium with or without erastin (10 μM) for 1, 3, and 5 d (Figure 2A). Comparing Figure 2Ad and h, gross anatomy showed apparent tiny tooth germ in the erastin-treated group than that of CTRL (Control group) on day 5 (D5). Histological analysis of D5 was performed in Figure 2B; treatment of erastin (10 μM) elevated the number of necrotic-like cells (NLCs), especially in dental mesenchyme (Figure 2Bb’ and d’). We also found a dose-dependent manner of erastin in suppressing tooth morphogenesis (Figure 2C). In D5 incubation of different concentrations (1.5, 5, 10, and 20 μM) of erastin, tooth germ deteriorated morphologically (decreasing size, Figure 2Ca–e) and histologically (elevating number of NLCs within dental mesenchyme, Figure 2Cf’–j’) according to the increasing concentration of erastin of erastin treatment. Relative development suppression of tooth germs was then calculated by height, width, and coronal area compared to the CTRL (Figure 2D); the radar graph showed significant dose-dependent impairment of erastin to tooth germ, and the original bar graphs are listed in Figure 2—figure supplement 1 (Figure 2—figure supplement 1—source data 1).

Figure 2. Erastin impairs tooth morphogenesis, especially within dental mesenchyme.

(A) Gross anatomy of tooth germ cultured ex vivo for 5 d, scale bars = 500 μm. (B) (a, c) HE staining for tooth germ on day 5 (D5), scale bars = 100 μm. (b, d) High resolution of epi-mes junction papilla, scale bars = 50 μm; black stars point out necrotic-like cells (NLCs). (b’, d’) NLCs indicated by black stars. (C) (a–e) Gross anatomy of tooth germs in different concentrations of erastin on D5, scale bars = 500 μm. (f–j) HE staining of different concentration-treated tooth germ on D5. (f’–j’) High-resolution view of epi-mes junction region of each tooth germ, scale bars = 50 μm. (D) Rada graph for calculation of height, width, and area in each tooth germ. Black dotted line outlines ameloblasts. AM, ameloblast; DP, dental papilla.

Figure 2.

Figure 2—figure supplement 1. Original bar graphs of height, width, and area of erastin-treated tooth germ.

Figure 2—figure supplement 1.

*p<0.05, **p<0.01, ***p<0.001.
Figure 2—figure supplement 1—source data 1. Source data for the bar graphs in Figure 2—figure supplement 1.
Open in a new tab

Ferroptosis is activated in erastin-treated molar germ

Accurate identification of ferroptosis should be determined by series markers, including iron concentration, lipid peroxidation, mitochondria dysmorphia, and overexpression of ferroptotic genes. We estimated the activation of ferroptosis in tooth germ. Indicated by TPE-o-Py detection in Era-10 μM of D5 (Figure 3Aa–b’’), more iron is accumulated than that in CTRL and the region of high concentration mainly located in dental mesenchyme (red, Figure 3Aa and b). Lipid peroxidation was indicated by the expression of 4-HNE; the distribution pattern of 4-HNE was similar to iron accumulation, which suggested the activation of iron-dependent lipid peroxidation occurred within Era-10 μM of D5 (Figure 3Ac–d’’). Results of D1 and D3 showed similar patterns in the accumulation of iron and the expression of 4-HNE (Figure 3—figure supplement 1), also in a dose-dependent manner on D5 (Figure 3—figure supplement 2). Morphological changes of mitochondria revealed severe shrinkage of mitochondria in dental mesenchyme of Era-10 μM (Figure 3B). The size of mitochondria in each group is calculated in Figure 3C (Figure 3—source data 1); results clearly showed the main size distribution of Era-10 μM is significantly decreased. Then, the expression of Gpx4, Slc7a11, and Ptgs2 in each tooth germ was modulated by q-PCR. Figure 3D (Figure 3—source data 2) shows that Ptgs2, a gene representing the peroxidation level, dramatically increased in tooth germ after erastin treatment, while Gpx4 and Slc7a11, anti-ferroptosis related genes, underwent upregulated but much more moderate expression. All these results contributed to the confirmation of the activated ferroptosis occurred in erastin-treated molar germ and demonstrated that no lethal concentration of erastin could lead to tooth morphogenesis partially through activation of ferroptosis in dental mesenchyme.

Figure 3. Ferroptosis is activated in erastin-treated molar germ.

(A) (a, b) High-density Fe3+ (red) in CTRL and Era-10 μM of day 5 (D5); white star points out strong fluorescence signal of Fe3+, scale bars = 50 μm. (a’, b’) Low-density Fe3+ (gray) and (a’’, b’’) merged view of iron probe staining. (c, d) Merged view of immunofluorescence (IF) staining of 4-hydroxy-2-nonenal (4-HNE) (magenta) and DAPI (blue), white star points out strong fluorescence signal of 4-HNE, scale bars = 5050 μm. (c’, d’) For DAPI and (c’’, d’’) 4-HNE. AM, ameloblast; DP, dental papilla; HD, high density; LD, low density. (B) Transmission electron microscope (TEM) scanning for CTRL and Era-10 μM on D5. (a, d) epi-mes junction area of CTRL and Era-10 μM on D5 are detected, scale bars = 5 μm. (b, c) Representative view of cells in epithelia and mesenchyme for CTRL, scale bars = 2 μm; black arrow points out typical mitochondria in each region (b’) for epithelia and (c’) mesenchyme, outlined by the white dotted line. (e, f) Representative view of cells in epithelia and mesenchyme for Era-10 μM, scale bars = 2 μm; black arrow points out typical mitochondria in each region (e’) for epithelia and (f’) mesenchyme, outlined by the white dotted line. (C) Relative frequency of the mitochondrial size in both groups. (D) Fold changes of gene expression in CTRL and Era-10 μM on D5 versus CTRL ***p<0.001.

Figure 3—source data 1. Source data for the calculation of the mitochondrial area in Figure 3C.
Figure 3—source data 2. Source data for the gene expression of Gpx4, Slc7a11, and Ptgs2 in Figure 3D.

Figure 3.

Figure 3—figure supplement 1. Results for iron accumulation and 4-hydroxy-2-nonenal (4-HNE) expression in Era-10 μM of D1 and D3.

Figure 3—figure supplement 1.

Scale bars = 50 μm.
Figure 3—figure supplement 2. Results for iron accumulation and 4-hydroxy-2-nonenal (4-HNE) expression in Era-1.5 μM, Era-5 μM, Era-10 μM, and Era-20 μM of D5.

Figure 3—figure supplement 2.

Scale bars = 50 μm.
Open in a new tab

Ferroptotic inhibitors partially rescue erastin-impaired tooth organogenesis

To further prove the function of ferroptosis in the suppression of tooth germ morphogenesis, a rescue assay was applied using Fer-1 (classical inhibitor of ferroptosis), liproxstatin-1 (Lip-1) (inhibitor of lipid peroxidation), and deferasirox (DFO) (iron chelator) to co-incubated tooth germ with erastin.

As the results show in Figure 4A, although all these three molecules show rescuing efficiency, Fer-1 holds the highest efficiency in recovering the organogenesis of molar germ in gross anatomy (Figure 4Ac) and reducing the number of NLCs at the histological level (Figure 4Ah and h’). Calculating the height, width, area of tooth germ (Figure 4B; original bar graphs are listed in Figure 4—figure supplement 1 and Figure 4—figure supplement 1—source data 1), and the number of NLCs (Figure 4C, Figure 4—source data 1) showed inhibitors could partially rescue impairment by erastin, while Fer-1 rescued most.

Figure 4. Ferroptotic inhibitors partially rescue erastin-impaired tooth organogenesis.

(A) (a–e) Gross anatomy of tooth germs in the differently treated group, scale bars = 500 μm. (f–j) HE staining of differently treated tooth germ, scale bars = 100 μm. (f’–j’) High-resolution view of epi-mes junction region of each tooth germ; black dotted line outlines ameloblasts, black star points out necrotic-like cells (NLCs). AM, ameloblast; DP, dental papilla; scale bars = 50 μm. (B) Rada graph for calculation of height, width, and area in each tooth germ. (C) Average number of NLCs in each group versus Era-1.5 μM, ***p<0.001, versus Era-1.5 μM + Lip-1, ##p<0.01. (D) 3D reconstructed view of tooth germ on day 5 (D5). (a–d) CTRL from the front view, coronal plane, sagittal plane, and 45° side view. (e–h) Era-1.5 μM and (i–l) Era-1.5 μM + Fer-1 are viewed the same way. Scale bars = 100 μm.

Figure 4—source data 1. Source data for the bar graphs in Figure 4C.

Figure 4.

Figure 4—figure supplement 1. Original bar graphs of height, width, and area of tooth germ in rescue assay.

Figure 4—figure supplement 1.

*p<0.05, **p<0.01, ***p<0.001.
Figure 4—figure supplement 1—source data 1. Source data for the bar graphs in Figure 4—figure supplement 1.
Figure 4—figure supplement 2. Source sequential HE slides for 3D reconstruction of CTRL.

Figure 4—figure supplement 2.

Figure 4—figure supplement 3. Source sequential HE slides for 3D reconstruction of Era-1.5 μM.

Figure 4—figure supplement 3.

Figure 4—figure supplement 4. Source sequential HE slides for 3D reconstruction of Era-1.5 μM + Fer.

Figure 4—figure supplement 4.

Open in a new tab

To avoid bias caused by sectioning, sequential HE slides of CTRL and Era-1.5 μM were applied for 3D reconstruction as previously described (Wu et al., 2020). In Figure 5Da–j, tooth germ in CTRL showed well-developed morphology in the 3D models. However, cusp formation in Era-1.5 μM (Figure 4De–h) underwent significant suppression compared with CTRL in different directions of view; original sequential slides are listed in Figure 4—figure supplement 2 for CTRL and Figure 4—figure supplement 3 for Era-1.5 μM. 3D reconstruction was also performed in Era-1.5 μM + Fer-1 (Figure 4Di–l). Compared to Era-1.5 μM (Figure 4De–h), Fer-1 reversed abnormal features dramatically in tooth morphology and cusp formation. Source sequential sections are listed in Figure 4—figure supplement 4.

Figure 5. Ferroptosis is the dominant cell death type contributing to erastin-impaired tooth morphogenesis.

(A) (a–c) High-density Fe3+ (red) in CTRL, Era-1.5 μM, and Era-1.5 μM + Fer-1 of day 5 (D5), white star points out strong fluorescence signal of Fe3+, scale bars = 50 μm. (a’–c’) Low-density Fe3+ (gray) and (a’’–c’’) merged view of iron probe staining. (d–f) Merged view of immunofluorescence (IF) staining of 4-hydroxy-2-nonenal (4-HNE) (magenta) and DAPI (blue), white star points out strong fluorescence signal of 4-HNE, scale bars = 50 μm. (d’–f’) DAPI and (d’’–f’’) 4-HNE, AM, ameloblast; DP, dental papilla; HD, high density; LD, low density. (B) Transmission electron microscope (TEM) scanning of Era-1.5 μM and Era-1.5 μM + Fer-1 on D5. (a, d) epi-mes junction area of Era-1.5 μM and Era-1.5 μM + Fer-1 on D5 is detected, scale bars = 5 μm. (b, c) Representative view of cells in epithelia and mesenchyme for Era-1.5 μM, scale bars = 2 μm; black arrow points out typical mitochondria in each region (b’) for epithelia and (c’) mesenchyme, outlined by the white dotted line. (e, f) Representative view of cells in epithelia and mesenchyme for Era-1.5 μM + Fer-1, scale bars = 2 μm; black arrow points out typical mitochondria in each region (e’) for epithelia and (f’) mesenchyme, outlined by the white dotted line. (C) Relative frequency of the mitochondrial size in both groups. (D) (a–c) Expression of CL-CASP3 (green) in CTRL, Era-1.5 μM, and Era-1.5 μM + Fer-1 on D5, scale bars = 200 μm. (a’–c’) Enlarged view of CL-CASP3 in each group, scale bars = 50 μm. (E) Schematic model illustrates the overburdened ferroptotic stress impaired tooth morphogenesis in ex vivo organ culture model.

Figure 5—source data 1. Source data for the calculation of the mitochondrial area in Figure 5C.

Figure 5.

Figure 5—figure supplement 1. Activation of apoptosis indicated by CL-CASP3 and TUNEL staining.

Figure 5—figure supplement 1.

(A) Mean influence intensity of ROI (Region of Interest) of CL-CASP3 in CTRL, Era-1.5 μM, and Era-1.5 μM + Fer-1. Both Era-1.5 μM and Era-1.5 μM + Fer-1 showed slightly increased CL-CASP3 activation than that in CTRL but showed no statistical differences. (B) Results of TUNEL assay in each experimental group. DNA damage detected by TUNEL assay is similar to that of CL-CASP3, which indicated that apoptosis is not significantly activated in erastin-treated tooth germ. Scale bars = 200 μm.
Figure 5—figure supplement 1—source data 1. Source data for the bar graphs in Figure 5—figure supplement 1.
Open in a new tab

Ferroptosis is the dominant cell death type contributing to erastin-impaired tooth morphogenesis

We further estimated the key characteristics of ferroptosis to assess whether Fer-1 rescued erastin-impaired tooth germ by inhibiting ferroptosis. Comparing with the CTRL group after 5 d ex vivo culture (Figure 5Aa and d), iron accumulation and lipid peroxidation (indicated by 4-HNE) in Era-1.5 μM is much higher (Figure 5Ab and e). Fer-1 treatment vanished iron accumulation and lipid peroxidation caused by erastin (Figure 5Ac and f). Results of transmission electron microscope (TEM) clearly showed decreased mitochondria shrinkage in Era-1.5 μM + Fer-1 than that of Era-1.5 μM (Figure 5B and C, Figure 5—source data 1). All these data convinced that Fer-1 rescued erastin-impaired tooth morphogenesis by inhibiting ferroptosis.

Apoptosis is the main innate cell death type in physiological process. To exclude possible overactivation of apoptosis induced by erastin treatment, we detected CL-CASP3 by IF staining, main executor protein of apoptosis, in each group. In Figure 5D, CL-CASP3 is weakly expressed in the CTRL group since the activation of apoptosis is physiologically required in tooth development (Figure 5D). The expression of CL-CASP3 slightly increased in both Era-1.5 μM and Era-1.5 μM + Fer-1, but showed no statistical differences compared with the CTRL group (Figure 5—figure supplement 1A, Figure 5—figure supplement 1—source data 1). TUNEL assay is also performed to identify apoptotic cells by detecting DNA damage, and results further convinced that apoptosis is not significantly activated in erastin-treated tooth germ (Figure 5—figure supplement 1B). Taken together, ferroptosis is the dominant cell death led by erastin treatment in impaired tooth germ.

Discussion

In the last several decades, the beneficial role of apoptosis in regulating organ development and tissue regeneration has been identified (Singh et al., 2019). Apoptosis in tooth development had been characterized by the activation of Caspase 3 and DNA damage, which revealed a spatiotemporal apoptotic cell death pattern due to different stages of tooth morphogenesis (Shigemura et al., 2001). This raises the question of whether other newly determined non-apoptotic cell death pathways also participate in the physiological processes like development, maintaining homeostasis, aging, etc. Except for NETosis, a neutrophil extracellular trap-related cell death, the possible function and mechanism of the rest of the non-apoptotic cell death including pyroptosis, necroptosis, and ferroptosis are still barely investigated. Characterized by its close relationship with the metabolism of lipid, iron, and ROS (Bonadonna et al., 2022; Bowers et al., 2020), risk factors inducing ferroptotic stress and/or activating ferroptosis are also critically involved in development and aging, which made ferroptosis and its regulatory mechanism, other than apoptosis, pyroptosis, and necroptosis, a promising undiscovered type of cell death during tooth development.

To explore the potential involvement of ferroptosis in organogenesis, we have developed an ex vivo culture model of tooth germ morphogenesis. This system allows for the application of erastin to induce significant activation of ferroptosis throughout the developmental process and offers a valuable opportunity to investigate the specific mechanisms underlying the role of ferroptosis in organ development. Our study detected the expression of Gpx4 and the accumulation of iron both in mouse mandibular incisor and developing first molar. Although Gpx4 is expressed ubiquitously in both tooth germ and incisor of mouse, its abundance differs in different cell types. Results revealed an increasing iron accumulation both in odontoblast and ameloblast according to the developmental process. The spatiotemporal expression of Gpx4 is also positively linked to odontogenesis and amelogenesis. This phenomenon indicated growing ferroptotic stress (accumulating iron) and strengthening anti-ferroptosis mechanism (increasing expression of Gpx4) physiologically coexisted and may maintain a critical balance along with the differentiation and maturation of odontoblast and ameloblast. However, the discovery of changes in iron and lipid metabolism during tooth morphogenesis is not novel. In the 1930s, pioneer scientists in dental biology had already identified the presence of iron in the tooth of different animals (Rosebury, 1934; Ratner, 1935; Suga et al., 1992), and then found some defects of enamel in mouse are related to abnormal iron metabolism (Puri et al., 2015). Lipid metabolism and lipid peroxidation, the other core risk factors of ferroptosis, were also described in the early stage of dental biology research (Dunglas et al., 1999; Goldberg et al., 1995; Yoshida et al., 2012). Even when the risk factors of ferroptosis had been reported to participate in tooth development, there are still no reports about the exact ferroptosis-related tooth developmental defects. Our results provided a new perspective to reconsider the underlying function of all these ancient studies in a comprehensive manner. They illustrated the importance of the Gpx4-dependent anti-ferroptosis pathway in managing all these already existing ferroptotic stress during tooth morphogenesis. Future in vivo studies utilizing transgenic mice are needed to systematically analyze the role of ferroptosis/ferroptotic stress during tooth and other organ development.

To further investigate the meaning of this precarious balance between ferroptotic stress and expression of Gpx4, we use erastin to inhibit the internalization of GSH, which is the critical substrate for Gpx4 to protect cells from lipid peroxidation. The developmental role of Gpx4 had been studied even before the ferroptosis was formally described (before 2012). In situ hybridization indicated expression of Gpx4 in all developing germ layers during gastrulation and in the somite stage in the developing central nervous system and in the heart (Borchert et al., 2006), which made Gpx4 (-/-) mice die embryonically in utero by midgestation (E7.5) and are associated with a lack of normal structural compartmentalization (Yant et al., 2003). Specific deletion of Gpx4 during developmental process was found to participate in the maturation and survival of cerebral and photoreceptor cell (Wirth et al., 2010; Ueta et al., 2012). In recent years, more ferroptosis-related functions of Gpx4 were discovered in neutrophil (Li et al., 2021) and chondrocyte (Wang et al., 2022) of adult mice, in which specific deletion will lead to ferroptosis-induced organ dysregulation and degeneration. Thus, it is essential to assess the biological function Gpx4-dependent ferroptotic suppressing system. In our study, erastin significantly impaired tooth morphogenesis in a dose-dependent manner within the ex vivo tooth germ culture model. The ex vivo organ culture of tooth germ is a well-established classical model for the study of tooth morphogenesis. Compared to in vivo study, the ex vivo culture of tooth germ is convenient for manipulating culture conditions and investigating factors affecting tooth germ in a high-throughput way (Nakao et al., 2007). Although lacking circulation and immune system, the ex vivo culture of the tooth germ, other than the traditional 2D culture of dental cells in vitro, can retain most properties of tooth development, like interactions among oral epithelia, mesenchyme, and stromal cells. We successfully established this model, and the tooth germs from D0 to D7 are well developed (Figure 1—figure supplement 1B). To induce ferroptosis, erastin is the most used agent inhibiting GSH transport but is not stable in vivo, which makes ex vivo organ culture of tooth germ the ideal way to study the possible function of ferroptosis/ferroptotic stress in tooth morphogenesis. Moreover, according to our results, erastin treatment will not induce overactivation of apoptosis in tooth germ (Figure 5D).

The histological analysis by HE staining showed an increased number of NLCs located in dental mesenchyme of erastin-treated tooth germ. 3D reconstruction of all the slides convinced that necrotic mainly occurred in the region of the odontoblast layer. Unlike CL-CASP3 to apoptosis, membrane localization of the GSDM family proteins and MLKL to pyroptosis and necroptosis, respectively, ferroptosis is a special type of cell death which has unique inducer but no special proteins reflecting its activation. Thus, ferroptosis in erastin-treated tooth germ is determined by the accumulation of iron, upregulation of 4-HNE, shrunken and condensed mitochondria, dramatically upregulated expression of Psg2 (risk marker to ferroptosis), and mildly increased expression of Gpx4, Slc7a11 (protective factor to ferroptosis). These results indicated that erastin could lead to abnormal tooth morphology via activating ferroptosis. Moreover, characterized by more apparent NLCs, stronger iron and 4-HNE fluorescence signal, and severer mitochondria degeneration, dental mesenchyme cell/odontoblast seems more sensitive to erastin-induced ferroptosis than that of dental epithelium cell/ameloblast.

According to our results, ferroptotic stress is physiologically increased during tooth development. Thus, rather than ‘initially activate ferroptosis’ in tooth morphogenesis, erastin, a system xc- inhibitor, inhibits GSH production and induced ferroptosis in tooth germ is more likely led by ‘overburdened ferroptotic stress.’ As a multistep process of cell death, the different inhibitor has a different target to suppress ferroptosis. In this study, regular ferroptosis inhibitors were applied in the rescue assay of impaired tooth morphogenesis. Tooth germ was treated by Fer-1, Lip-1 (radical trapping agents that inhibit the propagation of lipid peroxidation), and DFO (an iron chelator). Surprisingly, although all these inhibitors could reverse erastin-induced impairment of tooth morphogenesis, Fer-1 reduced the number of NLCs much more efficiently than lip-1 and DFO. Different from lip-1 or DFO, which only targets lipid peroxidation or labile iron accumulation, Fer-1 could both inhibit lipid peroxidation and reduce the labile iron pool in cells, and is notably not consumed while inhibiting iron-dependent lipid peroxidation (Miotto et al., 2020). Sustaining double effects of Fer-1 in inhibiting ferroptosis possibly enables it to effectively rescue the impairment of tooth germ than other agents.

In conclusion, using ex vivo culture model of tooth germ, we identified a continuing accumulation of ferroptotic stress in both odontogenesis and amelogenesis during tooth development. Activation of ferroptosis impaired tooth morphogenesis, especially within dental mesenchyme, and could be partially rescued by ferroptotic inhibitor. This study provides a promising model to effectively investigate the developmental role of ferroptosis and will broaden our knowledge about the possible involvement of non-apoptotic RCD during organogenesis.

Materials and methods

Animals and organ culture

ICR mice were purchased from Chengdu Dossy Experimental Animals Co., Ltd (Sichuan, China). All animal work was done according to the National Institutes of Health guidebook and approved by the Committee of the Ethics of Animal Experiments of Sichuan University (WCHSIRB-D-2021-12544).

The presence of a vaginal plug was used as an indication of embryonic day 0 (E0). The first mandibular molar tooth germs of E15.5 were dissected under stereomicroscope (Carl Zeiss, Germany); each experimental group contains at least three tooth germs from different mouse embryos. All the dissection steps were performed on ice. The dissected tooth germs were randomly placed in the upper chamber of the Trans-well (3450, Corning, USA) and four tooth germs were placed on one dish.

The culture medium and drugs were mixed and placed in the lower chamber. Tooth germs were cultured in DMEM/F12 supplemented with 10% fetal bovine serum, 50 U/ml penicillin/streptomycin, and 100 μg/ml ascorbic acid and incubated at 37°C and 5% CO2. Medium was changed every other day. Tooth germs were cultured for 5 d in the presence of different concentration of erastin (0 μM, 1.5 μM, 5 μM, 10 μM, and 20 μM). Culture medium added with Fer-1 (1 μM), Lip-1 (200 nM), and DFO (100 μM) was used to pretreat molar germ for 4 hr. All these small molecules were purchased from Selleck. After 5 d of cultivation, the tooth germs were fixed in 4% PFA and embedded in paraffin. Tooth germs were photographed at 0 d, 1 d, 3 d, and 5 d, and each tooth size (width, height, and area) were measured (n = 9 for each group) using the modified method reported in the literature previously. Each experiment was repeated three times (Jiang et al., 2019).

Immunohistochemistry

Sections were dewaxed and rehydrated before antigen repair, and then cooled to room temperature. Sections were incubated overnight at 4°C with Gpx4 (1:200, Invitrogen, PA5-102521) in 2% bovine serum albumin (BSA)/phosphate-buffered saline (PBS), pH 7.4. Negative control sections were incubated with 2% BSA/PBS. After washing, sections were then incubated with SignalStain Boost IHC Detection Reagent (8114S, Cell Signaling Technology, USA), then washed and incubated with diaminobenzidine (DAB) to detect any reactions, and then examined by light microscopy after counterstaining with hematoxylin.

Immunofluorescence and iron probe staining

Tissue sections were treated with PBS and 0.5% Triton X-100 for permeabilization. After washing and blocking, sections were incubated with 4-HNE (1:200, Abcam, ab48506) and cleaved Caspase 3 (1:200, Cell Signaling Technology, 9664) in blocking buffer (PBS and 2% BSA) overnight at 4℃. After washing, second antibody Alexa Fluor 488 (1:200, Abcam, ab150077) and Alexa Fluor 594 (1:200, Abcam, ab150116) mixed with 4′,6-diamidino-2-phenylindole (DAPI) was applied. Then they were incubated at room temperature for 1–2 hr and washed, and the slices were sealed.

To accurately detect the changes in iron accumulation within differently cultured tooth germs, we used an aggregation-induced emission featured iron (III) probe of TPE-o-Py (Feng et al., 2018), which was kindly gifted by Prof. Youhong Tang. This probe displays high sensitivity and selectivity toward iron (III) detection. The recognition arises from the position isomer of ortho-substitution and the fact that TPE-o-Py has a low acid dissociation constant (pKa) that is close to that of hydrolyzed Fe3+. The iron probe staining was performed as described. Briefly, TPE-o-Py was dissolved in tetrahydrofuran before being added to PBS and diluted to working concentration of 20 μM. The working solution was placed in sections and incubated at room temperature for half an hour and aspirated and sealed, then a laser confocal microscope (Olympus FV3000, Japan) was used to detect the fluorescence signal. Since the TPE-o-Py probe pronounced red shift in fluorescence emission that is positively related to the concentration of iron, low concentration of Fe3+ was detected under fluorescence channel of Alexa Fluor 405 (excitation wavelength: 402 nm; emission wavelength: 421 nm), while Alexa Fluor 594 (excitation wavelength: 590 nm; emission wavelength: 617 nm) for high concentration.

Tissue preparation for transmission electron microscope

Prefixed with a 3% glutaraldehyde, the tissue was then postfixed in 1% osmium tetroxide, dehydrated in series acetone, infiltrated in Epox 812 for longer, and embedded. The semithin sections were stained with methylene blue, and ultrathin sections were cut with a diamond knife and stained with uranyl acetate and lead citrate. Sections were examined with JEM-1400-FLASH Transmission Electron Microscope.

RNA extraction and qPCR

Total RNA of tooth germs (E15.5 cultured for 5 d) were extracted using TRIzol Reagent (Invitrogen, USA) according to manufacturer’s instructions. The amount and integrity of RNA were assessed by measurement of absorbance at 260 and 280 nm. First-strand cDNA synthesis was performed with a HiScript III Q RT SuperMix for qPCR (Vazyme, China). The levels of Gpx4, Ptgs2, and Slc7a11 were measured by quantitative real-time PCR (Bio-Rad, USA) with ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) and normalized to the level of β-actin mRNA. These experiments were performed in triplicate. The primer sequences used in qPCR are listed below.

Gene Sequence
Gpx4 F: CCTCCCCAGTACTGCAACAG
R: GGCTGAGAATTCGTGCATGG
Ptgs2 F: CTGCGCCTTTTCAAGGATGG
R: GGGGATACACCTCTCCACCA
Slc7a11 F: GATGGTCCTAAATAGCACGAGTG
R: GGGCAACCCCATTAGACTTGT
Actb F: AGATGTGGATCAGCAAGCAG
R: GCGCAAGTTAGGTTTTGTCA
Open in a new tab

3D reconstruction of tooth germ sections

Sequential section and subsequent HE staining of each tooth germ were performed as described before. Digital pathological system (Olympus vs200) was used to scan all the stained sections and reconstructed by following the previously described protocol (Wu et al., 2020).

TUNEL assay

We used a One Step TUNEL Apoptosis Assay Kit (Beyotime, C1090) to detect the possible DNA damage in apoptotic cell of tooth germs. The TUNEL assay was performed following instructions.

Statistical analysis

Analysis of Gpx4 relative expression levels was carried out with Image-pro plus7.0 (Media Cybernetics, USA). Statistical analyses were carried out using the GraphPad Prism version 8.00 (GraphPad Software, San Diego, CA). All statics are shown as the arithmetic mean ± standard error of the mean. The significance of differences between groups was tested using the one-sample t-test. Differences were considered significant when p<0.05. All the experiments were independently replicated three times.

Acknowledgements

This study was funded by grants from the National Natural Science Foundation of China U21A20368 (LY), 82101000 (HW), and 82201045 (FY), and by the Young Elite Scientist Sponsorship Program by China Association for Science and Technology 2022QNRC001 (FY). The iron probe, TPE-o-Py, was kindly gifted by Prof. Youhong Tang (Flinders University, Australia) and Prof. Benzhong Tang (the Hong Kong University of Science and Technology, China).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Fanyuan Yu, Email: fanyuan_yu@outlook.com.

Ling Ye, Email: yeling@scu.edu.cn.

Carlos Isales, Augusta University, United States.

Carlos Isales, Augusta University, United States.

Funding Information

This paper was supported by the following grants:

  • National Natural Science Foundation of China U21A20368 to Ling Ye.

  • National Natural Science Foundation of China 82101000 to Haisheng Wang.

  • National Natural Science Foundation of China 82201045 to Fanyuan Yu.

  • China Association for Science and Technology 2022QNRC001 to Fanyuan Yu.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Resources, Data curation, Software, Formal analysis, Funding acquisition, Validation, Investigation, Methodology, Writing - original draft, Writing - review and editing.

Conceptualization, Resources, Software, Formal analysis, Investigation, Methodology, Writing - original draft.

Resources, Data curation, Validation, Methodology, Writing - review and editing.

Writing - review and editing.

Conceptualization, Resources, Data curation, Software, Supervision, Funding acquisition, Validation, Investigation, Methodology, Project administration, Writing - review and editing.

Conceptualization, Data curation, Supervision, Funding acquisition, Validation, Project administration, Writing - review and editing.

Ethics

This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animal work was done according to the National Institutes of Health guidebook and approved by the Committee on the Ethics of Animal Experiments of Sichuan University (WCHSIRB-D-2021-12544). All surgery was performed under sodium pentobarbital anesthesia, and every effort was made to minimize suffering.

Additional files

MDAR checklist

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file; Source Data files have been provided for all the figures.

References

  1. Bedoui S, Herold MJ, Strasser A. Emerging connectivity of programmed cell death pathways and its physiological implications. Nature Reviews. Molecular Cell Biology. 2020;21:678–695. doi: 10.1038/s41580-020-0270-8. [DOI] [PubMed] [Google Scholar]
  2. Bonadonna M, Altamura S, Tybl E, Palais G, Qatato M, Polycarpou-Schwarz M, Schneider M, Kalk C, Rüdiger W, Ertl A, Anstee N, Bogeska R, Helm D, Milsom MD, Galy B. Iron regulatory protein (IRP)-mediated iron homeostasis is critical for neutrophil development and differentiation in the bone marrow. Science Advances. 2022;8:eabq4469. doi: 10.1126/sciadv.abq4469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Borchert A, Wang CC, Ufer C, Schiebel H, Savaskan NE, Kuhn H. The role of phospholipid hydroperoxide glutathione peroxidase isoforms in murine embryogenesis. The Journal of Biological Chemistry. 2006;281:19655–19664. doi: 10.1074/jbc.M601195200. [DOI] [PubMed] [Google Scholar]
  4. Bowers M, Liang T, Gonzalez-Bohorquez D, Zocher S, Jaeger BN, Kovacs WJ, Röhrl C, Cramb KML, Winterer J, Kruse M, Dimitrieva S, Overall RW, Wegleiter T, Najmabadi H, Semenkovich CF, Kempermann G, Földy C, Jessberger S. FASN-dependent lipid metabolism links neurogenic stem/progenitor cell activity to learning and memory deficits. Cell Stem Cell. 2020;27:98–109. doi: 10.1016/j.stem.2020.04.002. [DOI] [PubMed] [Google Scholar]
  5. Ding H, Chen S, Pan X, Dai X, Pan G, Li Z, Mai X, Tian Y, Zhang S, Liu B, Cao G, Yao Z, Yao X, Gao L, Yang L, Chen X, Sun J, Chen H, Han M, Yin Y, Xu G, Li H, Wu W, Chen Z, Lin J, Xiang L, Hu J, Lu Y, Zhu X, Xie L. Transferrin receptor 1 ablation in satellite cells impedes skeletal muscle regeneration through activation of ferroptosis. Journal of Cachexia, Sarcopenia and Muscle. 2021;12:746–768. doi: 10.1002/jcsm.12700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dunglas C, Septier D, Carreau JP, Goldberg M. Developmentally regulated changes in phospholipid composition in murine molar tooth. The Histochemical Journal. 1999;31:535–540. doi: 10.1023/a:1003892023686. [DOI] [PubMed] [Google Scholar]
  7. Feng X, Li Y, He X, Liu H, Zhao Z, Kwok RTK, Elsegood MRJ, Lam JWY, Tang BZ. A substitution‐dependent light‐up fluorescence probe for selectively detecting Fe 3+ ions and its cell imaging application. Advanced Functional Materials. 2018;28:1802833. doi: 10.1002/adfm.201802833. [DOI] [Google Scholar]
  8. Fuchs Y, Steller H. Programmed cell death in animal development and disease. Cell. 2011;147:742–758. doi: 10.1016/j.cell.2011.10.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, Alnemri ES, Altucci L, Amelio I, Andrews DW, Annicchiarico-Petruzzelli M, Antonov AV, Arama E, Baehrecke EH, Barlev NA, Bazan NG, Bernassola F, Bertrand MJM, Bianchi K, Blagosklonny MV, Blomgren K, Borner C, Boya P, Brenner C, Campanella M, Candi E, Carmona-Gutierrez D, Cecconi F, Chan FK-M, Chandel NS, Cheng EH, Chipuk JE, Cidlowski JA, Ciechanover A, Cohen GM, Conrad M, Cubillos-Ruiz JR, Czabotar PE, D’Angiolella V, Dawson TM, Dawson VL, De Laurenzi V, De Maria R, Debatin K-M, DeBerardinis RJ, Deshmukh M, Di Daniele N, Di Virgilio F, Dixit VM, Dixon SJ, Duckett CS, Dynlacht BD, El-Deiry WS, Elrod JW, Fimia GM, Fulda S, García-Sáez AJ, Garg AD, Garrido C, Gavathiotis E, Golstein P, Gottlieb E, Green DR, Greene LA, Gronemeyer H, Gross A, Hajnoczky G, Hardwick JM, Harris IS, Hengartner MO, Hetz C, Ichijo H, Jäättelä M, Joseph B, Jost PJ, Juin PP, Kaiser WJ, Karin M, Kaufmann T, Kepp O, Kimchi A, Kitsis RN, Klionsky DJ, Knight RA, Kumar S, Lee SW, Lemasters JJ, Levine B, Linkermann A, Lipton SA, Lockshin RA, López-Otín C, Lowe SW, Luedde T, Lugli E, MacFarlane M, Madeo F, Malewicz M, Malorni W, Manic G, Marine J-C, Martin SJ, Martinou J-C, Medema JP, Mehlen P, Meier P, Melino S, Miao EA, Molkentin JD, Moll UM, Muñoz-Pinedo C, Nagata S, Nuñez G, Oberst A, Oren M, Overholtzer M, Pagano M, Panaretakis T, Pasparakis M, Penninger JM, Pereira DM, Pervaiz S, Peter ME, Piacentini M, Pinton P, Prehn JHM, Puthalakath H, Rabinovich GA, Rehm M, Rizzuto R, Rodrigues CMP, Rubinsztein DC, Rudel T, Ryan KM, Sayan E, Scorrano L, Shao F, Shi Y, Silke J, Simon H-U, Sistigu A, Stockwell BR, Strasser A, Szabadkai G, Tait SWG, Tang D, Tavernarakis N, Thorburn A, Tsujimoto Y, Turk B, Vanden Berghe T, Vandenabeele P, Vander Heiden MG, Villunger A, Virgin HW, Vousden KH, Vucic D, Wagner EF, Walczak H, Wallach D, Wang Y, Wells JA, Wood W, Yuan J, Zakeri Z, Zhivotovsky B, Zitvogel L, Melino G, Kroemer G. Molecular mechanisms of cell death: recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death and Differentiation. 2018;25:486–541. doi: 10.1038/s41418-017-0012-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gao M, Monian P, Pan Q, Zhang W, Xiang J, Jiang X. Ferroptosis is an autophagic cell death process. Cell Research. 2016;26:1021–1032. doi: 10.1038/cr.2016.95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ghose P, Shaham S. Cell death in animal development. Development. 2020;147:dev191882. doi: 10.1242/dev.191882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Goldberg M, Septier D, Lécolle S, Vermelin L, Bissila-Mapahou P, Carreau JP, Gritli A, Bloch-Zupan A. Lipids in predentine and dentine. Connective Tissue Research. 1995;33:105–114. doi: 10.3109/03008209509016989. [DOI] [PubMed] [Google Scholar]
  13. He L, Zhou J, Chen M, Lin C-S, Kim SG, Zhou Y, Xiang L, Xie M, Bai H, Yao H, Shi C, Coelho PG, Bromage TG, Hu B, Tovar N, Witek L, Wu J, Chen K, Gu W, Zheng J, Sheu T-J, Zhong J, Wen J, Niu Y, Cheng B, Gong Q, Owens DM, Stanislauskas M, Pei J, Chotkowski G, Wang S, Yang G, Zegarelli DJ, Shi X, Finkel M, Zhang W, Li J, Cheng J, Tarnow DP, Zhou X, Wang Z, Jiang X, Romanov A, Rowe DW, Wang S, Ye L, Ling J, Mao J. Parenchymal and stromal tissue regeneration of tooth organ by pivotal signals reinstated in decellularized matrix. Nature Materials. 2019;18:627–637. doi: 10.1038/s41563-019-0368-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jiang N, Xiang L, He L, Yang G, Zheng J, Wang C, Zhang Y, Wang S, Zhou Y, Sheu T-J, Wu J, Chen K, Coelho PG, Tovar NM, Kim SH, Chen M, Zhou Y-H, Mao JJ. Exosomes mediate epithelium-mesenchyme crosstalk in organ development. ACS Nano. 2017;11:7736–7746. doi: 10.1021/acsnano.7b01087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jiang B, Xu F, Li L, Chen W, Hong S, Chen R. The inhibition of glycosaminoglycan incorporation influences the cell proliferation and cytodifferentiation in cultured embryonic mouse molars. Journal of Molecular Histology. 2019;50:11–19. doi: 10.1007/s10735-018-9803-2. [DOI] [PubMed] [Google Scholar]
  16. Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nature Reviews. Molecular Cell Biology. 2021;22:266–282. doi: 10.1038/s41580-020-00324-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li P, Jiang M, Li K, Li H, Zhou Y, Xiao X, Xu Y, Krishfield S, Lipsky PE, Tsokos GC, Zhang X. Glutathione peroxidase 4-regulated neutrophil ferroptosis induces systemic autoimmunity. Nature Immunology. 2021;22:1107–1117. doi: 10.1038/s41590-021-00993-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lindsten T, Ross AJ, King A, Zong WX, Rathmell JC, Shiels HA, Ulrich E, Waymire KG, Mahar P, Frauwirth K, Chen Y, Wei M, Eng VM, Adelman DM, Simon MC, Ma A, Golden JA, Evan G, Korsmeyer SJ, MacGregor GR, Thompson CB. The combined functions of proapoptotic Bcl-2 family members bak and bax are essential for normal development of multiple tissues. Molecular Cell. 2000;6:1389–1399. doi: 10.1016/s1097-2765(00)00136-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liu F, Chu EY, Watt B, Zhang Y, Gallant NM, Andl T, Yang SH, Lu M-M, Piccolo S, Schmidt-Ullrich R, Taketo MM, Morrisey EE, Atit R, Dlugosz AA, Millar SE. Wnt/beta-catenin signaling directs multiple stages of tooth morphogenesis. Developmental Biology. 2008;313:210–224. doi: 10.1016/j.ydbio.2007.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Miotto G, Rossetto M, Di Paolo ML, Orian L, Venerando R, Roveri A, Vučković A-M, Bosello Travain V, Zaccarin M, Zennaro L, Maiorino M, Toppo S, Ursini F, Cozza G. Insight into the mechanism of ferroptosis inhibition by ferrostatin-1. Redox Biology. 2020;28:101328. doi: 10.1016/j.redox.2019.101328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Nakao K, Morita R, Saji Y, Ishida K, Tomita Y, Ogawa M, Saitoh M, Tomooka Y, Tsuji T. The development of a bioengineered organ germ method. Nature Methods. 2007;4:227–230. doi: 10.1038/nmeth1012. [DOI] [PubMed] [Google Scholar]
  22. Opferman JT, Korsmeyer SJ. Apoptosis in the development and maintenance of the immune system. Nature Immunology. 2003;4:410–415. doi: 10.1038/ni0503-410. [DOI] [PubMed] [Google Scholar]
  23. Puri S, Li R, Ruszaj D, Tati S, Edgerton M. Iron binding modulates candidacidal properties of salivary histatin 5. Journal of Dental Research. 2015;94:201–208. doi: 10.1177/0022034514556709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ratner S. The iron content of teeth of normal and anemic rats. Journal of Dental Research. 1935;15:89–92. doi: 10.1177/00220345350150020601. [DOI] [Google Scholar]
  25. Reynaud K, Driancourt MA. Oocyte attrition. Molecular and Cellular Endocrinology. 2000;163:101–108. doi: 10.1016/s0303-7207(99)00246-4. [DOI] [PubMed] [Google Scholar]
  26. Rosebury T. Presence of iron in enamel keratin. Journal of Dental Research. 1934;14:269–272. doi: 10.1177/00220345340140040301. [DOI] [Google Scholar]
  27. Shigemura N, Kiyoshima T, Sakai T, Matsuo K, Momoi T, Yamaza H, Kobayashi I, Wada H, Akamine A, Sakai H. Localization of activated caspase-3-positive and apoptotic cells in the developing tooth germ of the mouse lower first molar. The Histochemical Journal. 2001;33:253–258. doi: 10.1023/a:1017900305661. [DOI] [PubMed] [Google Scholar]
  28. Singh R, Letai A, Sarosiek K. Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nature Reviews. Molecular Cell Biology. 2019;20:175–193. doi: 10.1038/s41580-018-0089-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Stockwell BR, Friedmann Angeli JP, Bayir H, Bush AI, Conrad M, Dixon SJ, Fulda S, Gascón S, Hatzios SK, Kagan VE, Noel K, Jiang X, Linkermann A, Murphy ME, Overholtzer M, Oyagi A, Pagnussat GC, Park J, Ran Q, Rosenfeld CS, Salnikow K, Tang D, Torti FM, Torti SV, Toyokuni S, Woerpel KA, Zhang DD. Ferroptosis: A regulated cell death nexus linking metabolism, redox biology, and disease. Cell. 2017;171:273–285. doi: 10.1016/j.cell.2017.09.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Stockwell BR. Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell. 2022;185:2401–2421. doi: 10.1016/j.cell.2022.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Suga S, Taki Y, Ogawa M. Iron in the enameloid of perciform fish. Journal of Dental Research. 1992;71:1316–1325. doi: 10.1177/00220345920710060901. [DOI] [PubMed] [Google Scholar]
  32. Ueta T, Inoue T, Furukawa T, Tamaki Y, Nakagawa Y, Imai H, Yanagi Y. Glutathione peroxidase 4 is required for maturation of photoreceptor cells. The Journal of Biological Chemistry. 2012;287:7675–7682. doi: 10.1074/jbc.M111.335174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang S, Li W, Zhang P, Wang Z, Ma X, Liu C, Vasilev K, Zhang L, Zhou X, Liu L, Hayball J, Dong S, Li Y, Gao Y, Cheng L, Zhao Y. Mechanical overloading induces GPX4-regulated chondrocyte ferroptosis in osteoarthritis via Piezo1 channel facilitated calcium influx. Journal of Advanced Research. 2022;41:63–75. doi: 10.1016/j.jare.2022.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wirth EK, Conrad M, Winterer J, Wozny C, Carlson BA, Roth S, Schmitz D, Bornkamm GW, Coppola V, Tessarollo L, Schomburg L, Köhrle J, Hatfield DL, Schweizer U. Neuronal selenoprotein expression is required for interneuron development and prevents seizures and neurodegeneration. FASEB Journal. 2010;24:844–852. doi: 10.1096/fj.09-143974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wu X, Hu J, Li G, Li Y, Li Y, Zhang J, Wang F, Li A, Hu L, Fan Z, Lü S, Ding G, Zhang C, Wang J, Long M, Wang S. Biomechanical stress regulates mammalian tooth replacement via the integrin β1-RUNX2-Wnt pathway. The EMBO Journal. 2020;39:e102374. doi: 10.15252/embj.2019102374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, Cheah JH, Clemons PA, Shamji AF, Clish CB, Brown LM, Girotti AW, Cornish VW, Schreiber SL, Stockwell BR. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156:317–331. doi: 10.1016/j.cell.2013.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yant LJ, Ran Q, Rao L, Van Remmen H, Shibatani T, Belter JG, Motta L, Richardson A, Prolla TA. The selenoprotein GPX4 is essential for mouse development and protects from radiation and oxidative damage insults. Free Radical Biology & Medicine. 2003;34:496–502. doi: 10.1016/s0891-5849(02)01360-6. [DOI] [PubMed] [Google Scholar]
  38. Yoshida T, Kumashiro Y, Iwata T, Ishihara J, Umemoto T, Shiratsuchi Y, Kawashima N, Sugiyama T, Yamato M, Okano T. Requirement of integrin β3 for iron transportation during enamel formation. Journal of Dental Research. 2012;91:1154–1159. doi: 10.1177/0022034512462722. [DOI] [PubMed] [Google Scholar]
  39. Yuan J, Najafov A, Py BF. Roles of caspases in necrotic cell death. Cell. 2016;167:1693–1704. doi: 10.1016/j.cell.2016.11.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zhang YD, Chen Z, Song YQ, Liu C, Chen YP. Making a tooth: growth factors, transcription factors, and stem cells. Cell Research. 2005;15:301–316. doi: 10.1038/sj.cr.7290299. [DOI] [PubMed] [Google Scholar]
  41. Zhao J, Jia Y, Mahmut D, Deik AA, Jeanfavre S, Clish CB, Sankaran VG. Human hematopoietic stem cell vulnerability to ferroptosis. Cell. 2023;186:732–747. doi: 10.1016/j.cell.2023.01.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zheng H, Jiang L, Tsuduki T, Conrad M, Toyokuni S. Embryonal erythropoiesis and aging exploit ferroptosis. Redox Biology. 2021;48:102175. doi: 10.1016/j.redox.2021.102175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zou Y, Schreiber SL. Progress in understanding ferroptosis and challenges in its targeting for therapeutic benefit. Cell Chemical Biology. 2020;27:463–471. doi: 10.1016/j.chembiol.2020.03.015. [DOI] [PMC free article] [PubMed] [Google Scholar]

eLife assessment

Carlos Isales 1

This important study time elegantly demonstrates that ferroptotic stress may play critical roles in regulating tooth germ development. The evidence presented is compelling, based on an explant model and providing novel mechanistic insights into tooth development.

Reviewer #1 (Public Review):

Anonymous

Cell death plays a critical role on regulating organogenesis. During tooth morphogenesis, apoptosis of embryonic dental tissue plays critical roles on regulating tooth germ development. The current study focused on ferroptosis, another way of cell death which has rarely been investigated in tooth development, and showed it may also play an important role on regulating the tooth dimension. The topic is novel and interesting, but the experimental design has some flaws which compromised the study.

The entire study was based on ex vivo tooth germ explant culture. I hope the authors can continue working on this direction with more convincing transgenic models.

Reviewer #2 (Public Review):

Anonymous

The present study by Ye et al. characterizes some of the major effects of ferroptotic stress on tooth morphogenesis.

The strengths of this study are its innovative nature and the beautiful histology. Mechanistic data are convincing Overall, the study is well done.

Reviewer #3 (Public Review):

Anonymous

This is an interesting work reporting ferroptosis that is involved in the tooth morphogenesis. The authors showed that Gpx4, the core anti-lipid peroxidation enzyme in ferroptosis, is upregulated in tooth development using ex vivo culture system.

eLife. 2023 Nov 22;12:RP88745. doi: 10.7554/eLife.88745.3.sa4

Author Response

Haisheng Wang 1, Xiaofeng Wang 2, Liuyan Huang 3, Chenglin Wang 4, Fanyuan Yu 5, Ling Ye 6

The following is the authors’ response to the original reviews.

Public Reviews:

Reviewer #1 (Public Review):

Cell death plays a critical role on regulating organogenesis. During tooth morphogenesis, apoptosis of embryonic dental tissue plays critical roles on regulating tooth germ development. The current study focused on ferroptosis, another way of cell death which has rarely been investigated in tooth development, and showed it may also play an important role on regulating the tooth dimension. The topic is novel and interesting, but the experimental design has many flaws which significantly compromised the study.

1. The entire study was based on ex vivo tooth germ explant culture. Mandibular tooth germs of E15.5 (bell stage) were isolated for ex vivo culture. Most tooth germ explant culture experiments were actually using tooth germ of much earlier stages (E11.5-E13.5) for organ culture. After E16.5, both the large size and initially formed enamel/dentin could prevent nutrition from penetrating inside. Also, using tooth germ of earlier stage will help identify impact of ferroptosis upon early tooth development.

1. Due to limited penetration, the ex vivo culture in the study lasted for no more than 5 days. I would recommend the authors to perform kidney capsule transplantation as an alternative approach, which can support tooth germ development much longer even into root formation.

1. The major justification of using tooth germ ex vivo culture as the model in the study was to "conduct high-throughput analysis". However, the study could hardly be qualified as a high-throughput analysis. I would recommend the authors perform RNA sequencing for comparing tooth germs before/after erastin treatment. Such experiments won't take too much time or resource.

We are grateful for the insightful feedback on our ex vivo tooth germ culture model. We initially chose the E15.5 tooth germ over earlier stages due to peak Gpx4 expression and iron accumulation during molar development, which occurs between E15.5 and E17.5 (Figure 1A & 1B). This period may be the most sensitive to ferroptotic stress during tooth development. Our experiments also demonstrated that the tooth germ displays robust growth after seven days of ex vivo cultivation (Figure supplement 1B).

Kidney capsule transplantation is indeed an ideal method for ex vivo tooth germ culture. However, in our studies, we used erastin – a classic ferroptosis inducer – which exhibits instability in vivo, thereby constraining our investigation using kidney capsule transplantation.

Our results about Gpx4 expression in the tooth germ during development (Figure 1A) showed a spatiotemporal pattern. This pattern suggests that bulk RNA sequencing of the tooth germ might not yield accurate revelations about changes in ferroptosis-related genes. We are presently using transgenic mice to further study the impact of excessive in vivo ferroptotic stress on tooth development. In these experiments, we intend to conduct single-cell RNA sequencing to explore detailed alterations in the tooth germ.

1. Although the study mostly used molars as the model, the in vivo iron concentration was only demonstrated on incisors, but not molars (Figure 1).

We have updated Figure 1B to include images of molars, which illustrate the accumulation of iron during molar development. The iron concentration peaks at E17.5, then decreases at PN0. Interestingly, unlike Gpx4 expression, iron accumulation rebounds at PN3. To gain a more accurate understanding, further in vivo studies utilizing transgenic mice are required.

1. Phenotype analysis in Figure 2 is too superficial. Only dimensional information was provided. Cusps number, cusps distribution pattern and rooth/furcation formation were not evaluated. Differentiation of ameloblast/odontoblast was not evaluated. The proliferation rate in the dental epithelium/mesenchyme was not analyzed.

The cusps number/distribution pattern are not influenced by erastin treatment in recent model (Figure 2A & 2C). Recent ex vivo culture model of tooth germ is unable to investigate the possible function of ferroptotic stress in rooth/furcation formation since it mainly initiates from PN4 to PN7. The proliferation and differentiation of dental epithelium/mesenchyme will be analyzed using transgenic mice in vivo.

1. Low magnification images should be included in Figure 3 to display the entire tooth germs.

The emission spectrum of recent utilized iron probe will extend due to increasing concentration of iron. This property makes the counter staining of tissue samples unavailable. The structure of the ex vivo cultured tooth germ could only be recognized in high magnification. The calculation could represent the entire alternation.

1. In Figure 4, does ferroptotic inhibitor eliminate the iron accumulation in the tooth germ? How about the expression level of several target genes shown in Figure 3?

In Fig 5, Fer-1 reduced the iron accumulation in tooth germ. Different inhibitors suppressed ferroptosis via different ways, Lip-1 mainly inhibits lipid peroxidation, DFO is an iron chelator which reduces the labile iron pool, Fer-1 is reported to both inhibit lipid peroxidation and reduce the labile iron pool, their functions to the accumulation of iron might be varied. The core risk factors of ferroptosis are lipid peroxidation and iron accumulation, thus in Fig 5, we analyzed the expression of 4HNE and the accumulation of iron to illustrated the suppression o ferroptosis instead of detecting several regulatory genes.

1. The manuscript has many typos and grammar mistakes. All "submandibular" should be simply "mandibular". "eastin" should be "erastin" (line 92). "partly" should be "partially" (line 611).

We addressed all the gramma and typo errors.

Reviewer #2 (Recommendations for The Authors):

This is a very well done study. However, writing is absolutely substandard. The authors should check and review extensively for improvements to the use of English. This is not just about language but also about style of the paper and presentation. As written, the abstract is not concise at all, and the overall logic of the study is not well presented. Currently, the abstract reads like another introduction.

We improved our presentation.

Reviewer #3 (Recommendations for The Authors):

This is an interesting work reporting ferroptosis that is involved in the tooth morphogenesis. The authors showed that Gpx4, the core anti-lipid peroxidation enzyme in ferroptosis, is upregulated in tooth development using ex vivo culture system. They convincingly demonstrated that ferroptosis, but apoptosis, was present in tooth morphogenesis. The findings are interesting and novel. The work represents one of the earliest works studying Ferroptosis in tooth morphogenesis. There are several minor concerns.

1. The abstract is too long and should be shortened.

We modified the abstract to make it concise.

1. Can the Gpx4 quantitatively be measured by qRT-PCR?

1. How is Gpx4 regulated during development? If unknown, the authors should discuss it at least

1. Are there any tooth developmental defects associated with ferroptosis? If there is one, the authors should discuss it.

Our research on Gpx4 expression in the tooth germ during development (Figure 1A) highlights a specific spatiotemporal pattern. This pattern suggests that bulk RNA sequencing of the tooth germ may not provide accurate insight into changes in ferroptosis-related genes.

The developmental role of Gpx4 had been studied even before the ferroptosis was formally described (before 2012). In situ hybridization indicated expression of Gpx4 in all developing germ layers during gastrulation and in the somite stage in the developing central nervous system and in the heart, which made Gpx4 (-/-) mice die embryonically in utero by midgestation (E7.5) and are associated with a lack of normal structural compartmentalization. Specific deletion of Gpx4 during developmental process were found to participate in the maturation and survival of cerebral and photoreceptor cell. Recent years, more ferroptosis related function of Gpx4 were discovered in neutrophil and chondrocyte of adult mice, in which specific deletion will lead to ferroptosis-induced organ dysregulation and degeneration.

At present, no systematic study has been conducted on ferroptosis or ferroptotic stress in relation to tooth developmental defects. However, as early as the 1930s, pioneering dental biologists had already identified the presence of iron in the teeth of various animals. They also found that some enamel defects in mice were related to abnormal iron metabolism. Lipid metabolism and lipid peroxidation, which are other key risk factors of ferroptosis, were also described in the initial stages of dental biology research.

We are currently generating transgenic mice with dental epithelium/mesenchymal specific deletions of Gpx4. This will allow us to further investigate the developmental defects related to ferroptosis and ferroptotic stress.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Source data for the integrated optical density of glutathione peroxidase 4 (Gpx4) in epithelia, mesenchyme, and total area of tooth in Figure 1A.
    elife-88745-fig1-data1.xlsx (9.2KB, xlsx)
    Figure 2—figure supplement 1—source data 1. Source data for the bar graphs in Figure 2—figure supplement 1.
    elife-88745-fig2-figsupp1-data1.xlsx (11KB, xlsx)
    Figure 3—source data 1. Source data for the calculation of the mitochondrial area in Figure 3C.
    elife-88745-fig3-data1.xlsx (10.2KB, xlsx)
    Figure 3—source data 2. Source data for the gene expression of Gpx4, Slc7a11, and Ptgs2 in Figure 3D.
    elife-88745-fig3-data2.xlsx (9KB, xlsx)
    Figure 4—source data 1. Source data for the bar graphs in Figure 4C.
    elife-88745-fig4-data1.xlsx (8.8KB, xlsx)
    Figure 4—figure supplement 1—source data 1. Source data for the bar graphs in Figure 4—figure supplement 1.
    elife-88745-fig4-figsupp1-data1.xlsx (10.8KB, xlsx)
    Figure 5—source data 1. Source data for the calculation of the mitochondrial area in Figure 5C.
    elife-88745-fig5-data1.xlsx (10.2KB, xlsx)
    Figure 5—figure supplement 1—source data 1. Source data for the bar graphs in Figure 5—figure supplement 1.
    elife-88745-fig5-figsupp1-data1.xlsx (10.2KB, xlsx)
    MDAR checklist
    elife-88745-mdarchecklist1.pdf (327.5KB, pdf)

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting file; Source Data files have been provided for all the figures.

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES