The Basic/Helix-Loop-Helix Transcription Factor Family Gene RcbHLH112 Is a Susceptibility Gene in Gray Mould Resistance of Rose (Rosa Chinensis)

Abstract

The basic/helix–loop–helix (bHLH) family is a major family of transcription factors in plants. Although it has been reported that bHLH plays a defensive role against pathogen infection in plants, there is no comprehensive study on the bHLH-related defence response in rose (Rosa sp.). In this study, a genome-wide analysis of bHLH family genes (RcbHLHs) in rose was carried out, including their phylogenetic relationships, gene structure, chromosome localization and collinearity analysis. Via phylogenetic analysis, a total of 121 RcbHLH genes in the rose genome were divided into 21 sub-groups. These RcbHLHs are unevenly distributed in all 7 chromosomes of rose. The occurrence of gene duplication events indicates that whole-genome duplication and segmental duplication may play a key role in gene duplication. Ratios of non-synonymous to synonymous mutation frequency (Ka/Ks) analysis showed that the replicated RcbHLH genes mainly underwent purification selection, and their functional differentiation was limited. Gene expression analysis showed that 46 RcbHLHs were differentially expressed in rose petals upon B. cinerea infection. It is speculated that these RcbHLHs are candidate genes that regulate the response of rose plants to B. cinerea infection. Virus-induced gene silencing (VIGS) confirmed that RcbHLH112 in rose is a susceptibility factor for infection with B. cinerea. This study provides useful information for further study of the functions of the rose bHLH gene family.

1. Introduction

Transcription factors have been extensively studied in plant growth, development, metabolism and stress response due to their important roles in transcriptional regulation [1]. Transcription factors usually consist of at least DNA-binding domains, transcriptional regulatory domains, oligomerisation sites and nuclear localisation signals [2]. The bHLH gene family is one of the most important transcription factor families in plants. Since the discovery of basic/helix–loop–helix (bHLH) motifs [3] with the ability to bind DNA, members of the bHLH protein superfamily have been found to have more and more functions in the basic physiology and development of animals and plants [4,5,6,7,8]. The bHLH domain consists of about 60 amino acids and has two regions with different functions, i.e., the basic domain and the HLH domain. The basic domain is located at the N-terminus of the bHLH domain and acts as a DNA-binding motif. It consists of about 15 amino acids, usually including 6 basic residues. The HLH region contains two amphiphilic alpha helices and a variable-length linker. Two amphiphilic alpha helices of bHLH proteins can interact to form homodimers or heterodimers [9,10]. Some bHLH proteins have been shown to bind to sequences containing a common core element called the E-box (5′-CANNTG-3′). In addition, nucleotides flanking the core elements may also play a role in binding specificity [11].

bHLH transcription factors are involved in the regulation of various plant processes, including growth, development and response to biotic and abiotic stresses. The function of bHLHs in disease resistance has been characterized in Arabidopsis and many other crops. For example, the wheat bHLH transcription factor gene TabHLH060 increases the susceptibility of transgenic Arabidopsis to Pseudomonas aeruginosa [12]. In tomato, SlybHLH131 increases resistance to yellow leaf curl virus by controlling cell death [13]. Overexpression of jasmonate-responsive OsbHLH034 in rice results in the induction of bacterial blight resistance via an increase in lignin biosynthesis [14]. In addition, bHLHs are also associated with abiotic stress in plants. For example, MdbHLH130 is the drought response bHLH protein in apple that confers drought tolerance in transgenic tobacco [15]. Overexpression of a bHLH gene from Tamarix hispida in Arabidopsis can improve salt and drought tolerance by increasing osmotic potential and reducing the accumulation of reactive oxygen species [16]. In Arabidopsis, bHLH122 is important for drought and osmotic stress resistance and repressing ABA catabolism [17].

Recent research has shown that plant bHLHs can act as a susceptibility gene, negatively regulating plant disease resistance. Zhang and co-authors found that loss of function of the bHLH transcription factor Nrd1 in tomato enhances resistance to Pseudomonas syringae. The mutant plants showed increased immunity due to the suppression of a defence gene, Agp1, by Nrd1. This enhanced immunity is independent of the activation of other immunity-associated genes, indicating that Nrd1 plays a specific role in regulating Agp1 expression and susceptibility to Pseudomonas syringae in tomato [18].

Roses (Rosa sp.) are commercially the most important ornamental plant, generating tens of billions of dollars in value each year [19]. Grey mould disease of roses caused by Botrytis cinerea causes huge losses. There are no reports on the involvement of bHLH transcription factors in rose grey mould resistance. To better understand the involvement of the bHLH genes in rose resistance against B. cinerea, we performed a genome-wide analysis of the bHLH family in rose. We further performed RNA-Seq analysis and showed that a large number of genes encoding bHLH transcription factors were significantly upregulated upon B. cinerea infection, implying that they were involved in the resistance of rose to B. cinerea [20]. Importantly, virus-induced gene silencing (VIGS) further confirmed that RcbHLH112 plays an important role in resistance to B. cinerea as a susceptibility gene.

2. Results

2.1. Identification of RcbHLH Genes in Rose

In the process of identifying bHLH family genes in the rose genome, we used the bHLH Hidden Markov Model (HMM) file (PF00010) to perform a Hmmsearch search in the rose genome database, and a total of 136 candidate RcbHLH proteins were obtained. MEME (https://meme-suite.org/meme/) (accessed on 11 July 2022) and Pfam database comparison further confirmed that the extracted protein domain was consistent with the characteristics of the family, and finally 121 RcbHLH gene members were identified in the rose genome, as these 121 protein sequences had a domain profile consistent with a typical bHLH transcription factor. All RcbHLH family genes can be mapped to chromosomes and named RcbHLH1 to RcbHLH121 according to their order on chromosomes (Figure 1).

Figure 1.

Chromosome localization of rose bHLH family members. The physical distribution of each RcbHLH gene is listed on the seven chromosomes of Rose chinensis.

There is a significant difference in the protein size of these RcbHLHs. Among the 121 RcbHLHs, RcbHLH25 has the longest amino acid sequence with 1275 amino acids, while the shortest RcbHLH85 has only 151 amino acids. The average length of RcbHLH protein is 385 aa. The details of all RcbHLH genes are listed in Table 1.

Table 1.

Members of the RcbHLH gene family as predicted in R. chinensis genome sequence.

Gene	Accession Number 1	Chr. 2	Position 3	Intron	Extron	CDS (bp)	Amino Acids	Clade
RcbHLH1	RchiOBHm_Chr1g0314891	1	2,173,916	7	8	1296	432	Ⅸ
RcbHLH2	RchiOBHm_Chr1g0321521	1	9,045,543	1	2	708	236	Ⅰb
RcbHLH3	RchiOBHm_Chr1g0337011	1	28,673,606	2	3	1371	457	Ⅱ
RcbHLH4	RchiOBHm_Chr1g0348781	1	41,770,117	5	6	1404	468	Ⅶ
RcbHLH5	RchiOBHm_Chr1g0355211	1	47,903,940	7	8	1944	648	Ⅲ(d+e+f)
RcbHLH6	RchiOBHm_Chr1g0360001	1	51,822,366	1	2	1851	617	Ⅲ(d+e+f)
RcbHLH7	RchiOBHm_Chr1g0360811	1	52,697,497	0	1	1464	488	Ⅲ(d+e+f)
RcbHLH8	RchiOBHm_Chr1g0361191	1	53,198,215	3	4	1254	418	Ⅰa
RcbHLH9	RchiOBHm_Chr1g0368211	1	58,410,232	1	2	708	236	Ⅰb
RcbHLH10	RchiOBHm_Chr1g0370561	1	60,070,116	1	2	795	265	Ⅴb
RcbHLH11	RchiOBHm_Chr1g0376001	1	63,269,742	1	2	918	306	Ⅰb
RcbHLH12	RchiOBHm_Chr1g0376011	1	63,276,165	1	2	570	190	Ⅰb
RcbHLH13	RchiOBHm_Chr1g0376061	1	63,317,042	1	2	711	237	Ⅰb
RcbHLH14	RchiOBHm_Chr1g0380101	1	65,866,341	2	3	1098	366	Ⅰa
RcbHLH15	RchiOBHm_Chr2g0085911	2	1,182,817	6	7	1263	421	Ⅺ
RcbHLH16	RchiOBHm_Chr2g0091241	2	4,891,265	6	7	1158	386	Ⅹ
RcbHLH17	RchiOBHm_Chr2g0093571	2	6,833,754	6	7	1743	581	Ⅳd
RcbHLH18	RchiOBHm_Chr2g0096091	2	8,997,567	6	7	1293	431	Ⅺ
RcbHLH19	RchiOBHm_Chr2g0099391	2	11,611,832	4	5	954	318	Ⅳb
RcbHLH20	RchiOBHm_Chr2g0105811	2	17,067,752	0	1	753	251	Ⅷ(a+b+c)
RcbHLH21	RchiOBHm_Chr2g0105931	2	17,187,821	7	8	1128	376	Ⅶ
RcbHLH22	RchiOBHm_Chr2g0109611	2	20,986,271	3	4	1056	352	Ⅳa
RcbHLH23	RchiOBHm_Chr2g0109621	2	21,006,834	4	5	1062	354	Ⅳa
RcbHLH24	RchiOBHm_Chr2g0109941	2	21,287,305	3	4	1101	367	Ⅲ(a+b+c)
RcbHLH25	RchiOBHm_Chr2g0111201	2	22,786,895	2	3	3825	1275	Orphan
RcbHLH26	RchiOBHm_Chr2g0111351	2	22,988,391	1	2	624	208	Ⅴb
RcbHLH27	RchiOBHm_Chr2g0112221	2	24,091,959	2	3	996	332	Ⅰa
RcbHLH28	RchiOBHm_Chr2g0120331	2	33,053,648	0	1	849	283	Ⅷ(a+b+c)
RcbHLH29	RchiOBHm_Chr2g0126861	2	41,432,994	2	3	678	226	Ⅰb
RcbHLH30	RchiOBHm_Chr2g0139261	2	56,883,003	8	9	1026	342	Ⅹ
RcbHLH31	RchiOBHm_Chr2g0141851	2	59,398,516	0	1	1308	436	Ⅷ(a+b+c)
RcbHLH32	RchiOBHm_Chr2g0152511	2	69,890,195	8	9	1617	539	Ⅶ
RcbHLH33	RchiOBHm_Chr2g0160481	2	76,321,485	0	1	912	304	Ⅷ(a+b+c)
RcbHLH34	RchiOBHm_Chr2g0176421	2	88,244,910	3	4	1503	501	Ⅲ(a+b+c)
RcbHLH35	RchiOBHm_Chr3g0451111	3	2,350,386	6	7	999	333	Ⅺ
RcbHLH36	RchiOBHm_Chr3g0454211	3	4,346,874	2	3	1020	340	Ⅰa
RcbHLH37	RchiOBHm_Chr3g0457291	3	6,478,569	1	2	591	197	ⅩⅥ
RcbHLH38	RchiOBHm_Chr3g0458701	3	7,313,238	8	9	2184	728	Ⅶ
RcbHLH39	RchiOBHm_Chr3g0462431	3	10,114,223	0	1	768	256	Ⅷ(a+b+c)
RcbHLH40	RchiOBHm_Chr3g0465361	3	12,152,414	9	10	2079	693	ⅩⅢ
RcbHLH41	RchiOBHm_Chr3g0480621	3	26,445,394	5	6	1032	344	Ⅸ
RcbHLH42	RchiOBHm_Chr3g0480751	3	26,579,491	6	7	1077	359	Ⅻ
RcbHLH43	RchiOBHm_Chr3g0493491	3	40,682,138	4	5	891	297	Ⅷ(a+b+c)
RcbHLH44	RchiOBHm_Chr4g0390311	4	5,608,794	2	3	792	264	Ⅳd
RcbHLH45	RchiOBHm_Chr4g0392401	4	7,811,073	3	4	678	226	Ⅳa
RcbHLH46	RchiOBHm_Chr4g0399211	4	16,381,854	4	5	735	245	Ⅲ(a+b+c)
RcbHLH47	RchiOBHm_Chr4g0403251	4	22,342,021	5	6	465	155	Ⅻ
RcbHLH48	RchiOBHm_Chr4g0405961	4	26,941,409	5	6	501	167	Ⅹ
RcbHLH49	RchiOBHm_Chr4g0409001	4	32,037,594	5	6	1302	434	Ⅸ
RcbHLH50	RchiOBHm_Chr4g0412071	4	35,820,711	7	8	1662	554	Ⅻ
RcbHLH51	RchiOBHm_Chr4g0415421	4	40,124,051	4	5	1341	447	Ⅰa
RcbHLH52	RchiOBHm_Chr4g0418301	4	43,688,763	2	3	609	203	Ⅰa
RcbHLH53	RchiOBHm_Chr4g0425781	4	51,377,284	0	1	681	227	ⅩⅥ
RcbHLH54	RchiOBHm_Chr4g0429161	4	53,995,807	6	7	558	186	Ⅻ
RcbHLH55	RchiOBHm_Chr4g0434901	4	58,544,648	5	6	720	240	Ⅻ
RcbHLH56	RchiOBHm_Chr4g0435901	4	59,312,260	3	4	1062	354	Ⅴb
RcbHLH57	RchiOBHm_Chr4g0437041	4	60,257,934	8	9	1647	549	Ⅻ
RcbHLH58	RchiOBHm_Chr4g0437281	4	60,431,122	6	7	1008	336	Ⅴa
RcbHLH59	RchiOBHm_Chr4g0443741	4	64,773,328	7	8	1464	488	Ⅲ(a+b+c)
RcbHLH60	RchiOBHm_Chr4g0445091	4	65,659,106	5	6	825	275	Ⅻ
RcbHLH61	RchiOBHm_Chr4g0445691	4	66,107,770	6	7	1578	526	Ⅹ
RcbHLH62	RchiOBHm_Chr5g0004471	5	2,901,732	4	5	747	249	Ⅳa
RcbHLH63	RchiOBHm_Chr5g0004791	5	3,144,460	3	4	816	272	Ⅲ(a+b+c)
RcbHLH64	RchiOBHm_Chr5g0004831	5	3,190,712	7	8	1329	443	Ⅹ
RcbHLH65	RchiOBHm_Chr5g0008581	5	5,519,637	3	4	573	191	Ⅰb
RcbHLH66	RchiOBHm_Chr5g0008601	5	5,547,115	2	3	495	165	Ⅰb
RcbHLH67	RchiOBHm_Chr5g0010631	5	7,014,429	1	2	789	263	Ⅴb
RcbHLH68	RchiOBHm_Chr5g0013411	5	9,054,888	0	1	741	247	ⅩⅣ
RcbHLH69	RchiOBHm_Chr5g0018101	5	12,626,832	1	2	861	287	Ⅷ(a+b+c)
RcbHLH70	RchiOBHm_Chr5g0024601	5	18,681,604	1	2	711	237	Ⅷ(a+b+c)
RcbHLH71	RchiOBHm_Chr5g0025741	5	19,690,297	3	4	633	211	Ⅲ(a+b+c)
RcbHLH72	RchiOBHm_Chr5g0036871	5	31,168,132	6	7	1356	452	Ⅹ
RcbHLH73	RchiOBHm_Chr5g0037201	5	31,555,063	4	5	699	233	Ⅳa
RcbHLH74	RchiOBHm_Chr5g0048491	5	45,475,282	9	10	2886	962	ⅩⅢ
RcbHLH75	RchiOBHm_Chr5g0053301	5	55,574,872	1	2	792	264	Ⅴb
RcbHLH76	RchiOBHm_Chr5g0056871	5	60,661,176	3	4	987	329	Ⅲ(a+b+c)
RcbHLH77	RchiOBHm_Chr5g0056881	5	60,670,256	3	4	1101	367	Ⅲ(a+b+c)
RcbHLH78	RchiOBHm_Chr5g0077341	5	83,273,897	6	7	1314	438	Ⅸ
RcbHLH79	RchiOBHm_Chr6g0245181	6	1,110,505	5	6	1020	340	Ⅳb
RcbHLH80	RchiOBHm_Chr6g0246251	6	1,988,321	2	3	975	325	Ⅳa
RcbHLH81	RchiOBHm_Chr6g0253641	6	8,755,304	4	5	1017	339	Ⅷ(a+b+c)
RcbHLH82	RchiOBHm_Chr6g0254731	6	9,664,169	4	5	855	285	Ⅹ
RcbHLH83	RchiOBHm_Chr6g0257881	6	13,317,333	2	3	1095	365	ⅩⅣ
RcbHLH84	RchiOBHm_Chr6g0264701	6	20,040,197	7	8	1272	424	Ⅻ
RcbHLH85	RchiOBHm_Chr6g0268091	6	24,936,757	1	2	453	151	Ⅲ(d+e+f)
RcbHLH86	RchiOBHm_Chr6g0270891	6	28,916,670	2	3	732	244	Ⅰb
RcbHLH87	RchiOBHm_Chr6g0271001	6	29,045,898	2	3	2796	932	Orphan
RcbHLH88	RchiOBHm_Chr6g0278441	6	41,562,004	8	9	1653	551	Ⅲ(a+b+c)
RcbHLH89	RchiOBHm_Chr6g0278471	6	41,578,713	7	8	1890	630	Ⅲ(a+b+c)
RcbHLH90	RchiOBHm_Chr6g0283511	6	46,738,527	6	7	1650	550	Ⅻ
RcbHLH91	RchiOBHm_Chr6g0285491	6	48,833,566	7	8	1533	511	Ⅶ
RcbHLH92	RchiOBHm_Chr6g0288541	6	51,800,989	10	11	2190	730	ⅩⅢ
RcbHLH93	RchiOBHm_Chr6g0288981	6	52,186,951	1	2	1434	478	Ⅲ(d+e+f)
RcbHLH94	RchiOBHm_Chr6g0289601	6	52,628,904	5	6	882	294	Ⅺ
RcbHLH95	RchiOBHm_Chr6g0291161	6	54,342,571	5	6	2109	703	Ⅲ(d+e+f)
RcbHLH96	RchiOBHm_Chr6g0301601	6	61,956,169	6	7	1434	478	Ⅹ
RcbHLH97	RchiOBHm_Chr6g0308101	6	66,214,825	0	1	750	250	Ⅷ(a+b+c)
RcbHLH98	RchiOBHm_Chr6g0308241	6	66,322,449	1	2	633	211	ⅩⅣ
RcbHLH99	RchiOBHm_Chr6g0308251	6	66,326,408	5	6	1002	334	Ⅶ
RcbHLH100	RchiOBHm_Chr6g0309431	6	67,137,708	3	4	1137	379	Ⅷ(a+b+c)
RcbHLH101	RchiOBHm_Chr6g0310101	6	67,513,823	8	9	1293	431	Ⅻ
RcbHLH102	RchiOBHm_Chr7g0180121	7	2,158,763	5	6	816	272	Ⅻ
RcbHLH103	RchiOBHm_Chr7g0181001	7	2,715,710	4	5	750	250	Ⅳb
RcbHLH104	RchiOBHm_Chr7g0182341	7	3,630,748	4	5	1092	364	Ⅶ
RcbHLH105	RchiOBHm_Chr7g0183781	7	4,545,994	11	12	1701	567	Ⅴa
RcbHLH106	RchiOBHm_Chr7g0185551	7	5,672,706	5	6	855	285	Ⅻ
RcbHLH107	RchiOBHm_Chr7g0186541	7	6,438,416	9	10	2337	779	ⅩⅢ
RcbHLH108	RchiOBHm_Chr7g0187141	7	6,933,397	1	2	1407	469	Ⅲ(d+e+f)
RcbHLH109	RchiOBHm_Chr7g0187261	7	7,027,943	1	2	1350	450	Ⅲ(d+e+f)
RcbHLH110	RchiOBHm_Chr7g0188921	7	8,298,561	3	4	1593	531	Ⅲ(a+b+c)
RcbHLH111	RchiOBHm_Chr7g0189021	7	8,415,832	7	8	1041	347	Ⅻ
RcbHLH112	RchiOBHm_Chr7g0193761	7	12,029,125	2	3	573	191	Ⅰb
RcbHLH113	RchiOBHm_Chr7g0197531	7	15,472,708	7	8	1920	640	Ⅲ(d+e+f)
RcbHLH114	RchiOBHm_Chr7g0199961	7	17,925,106	1	2	765	255	Ⅰb
RcbHLH115	RchiOBHm_Chr7g0209751	7	27,192,104	0	1	2082	694	Ⅲ(d+e+f)
RcbHLH116	RchiOBHm_Chr7g0210101	7	27,730,558	2	3	963	321	Ⅰa
RcbHLH117	RchiOBHm_Chr7g0212241	7	29,570,891	1	2	1392	464	Ⅲ(d+e+f)
RcbHLH118	RchiOBHm_Chr7g0227911	7	51,177,367	4	5	672	224	Ⅸ
RcbHLH119	RchiOBHm_Chr7g0233161	7	57,581,440	3	4	1068	356	Ⅲ(a+b+c)
RcbHLH120	RchiOBHm_Chr7g0236841	7	61,576,445	1	2	645	215	Ⅴb
RcbHLH121	RchiOBHm_Chr7g0237511	7	62,551,696	1	2	1083	361	ⅩⅢ

¹ Available at https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/ (accessed on 5 July 2022 ). ² Chromosome. ³ Starting position (b).

2.2. Chromosomal Locations, Whole-Genome Duplication and Microsynteny

The 121 RcbHLH genes identified are unevenly distributed across 7 rose chromosomes (Figure 1). Chromosome 6 has the most RcbHLH genes with 23. There are 20 RcbHLH genes on chromosomes 2 and 7. Chromosome 3 has the fewest RcbHLH genes, only 9. Meanwhile, 12.37% and 13.22% of RcbHLH genes are located in the upper and middle parts of chromosomes 2 and 7, respectively; 9. 92% of the RcbHLH genes are located in the upper and middle parts of chromosome 5; 9.09% and 10.74% of the genes are distributed in the middle and lower parts of chromosomes 1 and 4, respectively; and 19.01% of the RcbHLH genes are distributed on chromosome 6.

Tandem and segmental duplication play an important role in the expansion of gene families and the generation of new gene functions. On further examination of the repetitive events, we found that there were 16 gene pairs in this family, all of which were whole-genome duplication (WGD) or segmental duplication, while there were gene pairs on different chromosomes, indicating that these genes were paralogous genes. The microsynteny of these RcbHLH genes is shown in Figure 2.

Figure 2.

Microsyntenic analyses of the rose bHLH transcription factors in the Rose chinensis genome. Circular visualization of rose bHLH transcription factors is mapped onto different chromosomes using Circos [21]. The red lines indicate rose bHLH genes with a syntenic relationship. The grey lines represent all syntenic blocks in the genome of Rose chinensis.

To investigate the selective constraints between duplicated RcbHLH genes, the ratios of non-synonymous mutation frequency (Ka) to synonymous mutation frequency (Ks) of 16 gene pairs were calculated (Table 2). In general, Ka/Ks > 1 is consistent with positive selection, whereas Ka/Ks < 1 indicates purifying selection. The Ka/Ks ratio of all 16 repetitive gene pairs is less than 1 (Table 2), indicating limited functionally divergent purifying selection during the evolutionary history of the repetitive RcbHLH genes.

Table 2.

Duplication analysis of the RcbHLH gene family.

Sequence 1	Sequence 2	Ka	Ks	Ka/Ks	Effective Len	Average S-Sites	Average N-Sites
RcbHLH7	RcbHLH109	0.443081	NaN	NaN	1275	291.6667	983.3333
RcbHLH11	RcbHLH114	0.462303	NaN	NaN	597	133.8333	463.1667
RcbHLH20	RcbHLH97	0.328431	2.687639	0.1222	636	140	496
RcbHLH21	RcbHLH99	0.48712	1.774278	0.274545	885	202.0833	682.9167
RcbHLH24	RcbHLH119	0.287838	1.620301	0.177645	1032	222.1667	809.8333
RcbHLH25	RcbHLH87	0.457511	2.840734	0.161054	2733	555.5833	2177.417
RcbHLH26	RcbHLH120	0.59898	1.798421	0.333059	555	133.8333	421.1667
RcbHLH29	RcbHLH65	0.455457	4.125944	0.110389	537	122.5	414.5
RcbHLH34	RcbHLH110	0.370849	2.185043	0.169722	1443	325.9167	1117.083
RcbHLH37	RcbHLH53	0.392481	1.639823	0.239344	588	153.5833	434.4167
RcbHLH54	RcbHLH111	0.438746	NaN	NaN	552	122.75	429.25
RcbHLH55	RcbHLH106	0.435383	1.727525	0.252027	681	142.3333	538.6667
RcbHLH58	RcbHLH105	0.367022	2.17115	0.169045	981	223	758
RcbHLH60	RcbHLH102	0.205017	1.25652	0.163163	753	174.1667	578.8333
RcbHLH62	RcbHLH73	0.230957	1.156031	0.199784	693	159.3333	533.6667
RcbHLH64	RcbHLH72	0.369998	1.720924	0.215	1137	258.75	878.25

2.3. Phylogenetic and Exon-Intron Structural Analysis of Rose bHLH Genes

We used the neighbour-joining method (NJ) method to reconstruct the phylogeny of all RcbHLH genes and constructed a phylogenetic tree. The results of the follow-up analysis of the exon–intron structure are consistent with those of the phylogenetic analysis (Figure 3). Most genes clustered in the same group have similar genetic structures, especially in terms of the number of introns, such as RcbHLH10, RcbHLH26 and RcbHLH120. However, there were some exceptions. For example, RcbHLH58 and RcbHLH105 contain different numbers of introns. In addition, their intron length is very variable, ranging from tens to thousands of nucleotides. These results indicate that there is a highly conservative structure in the RcbHLH subfamily and that there is sequence diversity between different RcbHLH groups.

Figure 3.

Phylogenetic analyses, DNA structures and protein motifs of the bHLH gene family in rose. Complete alignments of all rose bHLH proteins were used to construct a phylogenetic tree using the neighbour-joining method. The left represents gene structures. The green boxes, yellow boxes and grey lines in the exon–intron structure diagram represent UTRs, exons and introns, respectively. The right represents protein motifs in the bHLH members. The colourful boxes delineate different motifs (unit: aa). The scale on the bottom is provided as a reference.

In addition, there is increasing evidence that bHLH transcription factors play a key role in disease resistance in various plant species (Table 3). To assess the evolutionary relationship between RcbHLHs and AtbHLHs genes, we constructed a composite phylogenetic tree (Figure 4). According to The Arabidopsis Information Resources (TAIR) (http://www.arabidopsis.org/) (accessed on 11 July 2022), there are 158 AtbHLH genes in Arabidopsis. These members can be divided into 21 different groups. The results confirmed the previously proposed classification of the bHLH family. The subfamily VIII (a+b+c) contains 31 proteins, and the subfamily IVb contains 3 proteins. The bootstrap values of some branches in the phylogenetic tree are low, which may be due to the short bHLH domain and relatively little information other than highly conserved information.

Table 3.

Plant bHLH family genes involved in disease resistance.

Gene Name	Gene ID	Species	Pathogens	References
SlybHLH131	Solyc06g051550.2.1	Solanum lycopersicum	Tomato yellow leaf curl virus	[13]
FAMA	AT3G24140	Arabidopsis thaliana	Botrytis cinerea	[22]
AtMYC2	At1g32640	Arabidopsis thaliana	Botrytis cinerea	[23]
AtbHLH13	At1g01260	Arabidopsis thaliana	Botrytis cinerea	[24]
OsbHLH6	Os04g23550	Oryza sativa	Magnaporthe oryzae	[25]
OsbHLH034	Os02g49480	Oryza sativa	Xanthomonas oryzae pv. oryzae	[14]

Figure 4.

Phylogenetic analyses of the rose bHLH transcription factors. Composite phylogenetic tree of rose and Arabidopsis bHLH transcription factors. The bootstrap values are indicated on the nodes of the branches.

2.4. Expression of RcbHLH Genes in Response to B. cinerea Infection

A growing body of evidence from different plant species indicates that plant bHLH transcription factors play an important role in pathogen response. To investigate the role of bHLH genes in B. cinerea resistance in rose, we analysed transcriptome data from rose petals inoculated with the pathogen at 30 and 48 hpi. The 30 hpi time point represents the early response to infection, whereas the 48 hpi time point corresponds to the late response (Table 4). The log₂Ratio transformed expression profiles were obtained from the RNA-seq dataset [20]. A total of 21 RcbHLH genes (RcbHLH17, RcbHLH21, RcbHLH29, RcbHLH34, RcbHLH40, RcbHLH44, RcbHLH46, RcbHLH59, RcbHLH62, RcbHLH67, RcbHLH72, RcbHLH75, RcbHLH80, RcbHLH90, RcbHLH99, RcbHLH101, RcbHLH106, RcbHLH108, RcbHLH111, RcbHLH112 and RcbHLH115) were upregulated, suggesting that they may be the key regulators of B. cinerea infection and influence the disease resistance of rose. To further verify the expression profile of RNA-seq, the expression of 4 RcbHLHs was analysed by RT-qPCR. The results of the RT-qPCR analysis were consistent with those of the transcriptome analysis (Figure 5).

Table 4.

Expression patterns of RcbHLH genes under infection of B. cinerea.

Gene 2	Accession Number	Group	log2Ratio 30 hpi	log2Ratio 48 hpi
RcbHLH4	RchiOBHm_Chr1g0348781	Ⅶ	−1.02302	−1.36247
RcbHLH8	RchiOBHm_Chr1g0361191	Ⅰa	−1.05954	−1.91491
RcbHLH16	RchiOBHm_Chr2g0091241	Ⅹ	0	−1.13271
RcbHLH17	RchiOBHm_Chr2g0093571	Ⅳd	3.07535	4.92649
RcbHLH21	RchiOBHm_Chr2g0105931	Ⅶ	0	1.03517
RcbHLH29 *	RchiOBHm_Chr2g0126861	Ⅰb	0	6.04668
RcbHLH32	RchiOBHm_Chr2g0152511	Ⅶ	0	−16.01
RcbHLH34	RchiOBHm_Chr2g0176421	Ⅲ(a+b+c)	1.07031	1.74663
RcbHLH37	RchiOBHm_Chr3g0457291	ⅩⅥ	−1.36188	--
RcbHLH39	RchiOBHm_Chr3g0462431	Ⅷ(a+b+c)	−1.48345	--
RcbHLH40	RchiOBHm_Chr3g0465361	ⅩⅢ	1.40229	2.20545
RcbHLH42	RchiOBHm_Chr3g0480751	Ⅻ	0	−1.48859
RcbHLH44	RchiOBHm_Chr4g0390311	Ⅳd	2.8578	4.76511
RcbHLH46	RchiOBHm_Chr4g0399211	Ⅲ(a+b+c)	1.25346	3.44205
RcbHLH50	RchiOBHm_Chr4g0412071	Ⅻ	−1.46896	−1.77088
RcbHLH53	RchiOBHm_Chr4g0425781	ⅩⅥ	0	−1.61078
RcbHLH55	RchiOBHm_Chr4g0434901	Ⅻ	0	−2.09156
RcbHLH57	RchiOBHm_Chr4g0437041	Ⅻ	1.04454	--
RcbHLH59	RchiOBHm_Chr4g0443741	Ⅲ(a+b+c)	0	1.92286
RcbHLH60 *	RchiOBHm_Chr4g0445091	Ⅻ	−1.22975	−4.12905
RcbHLH62	RchiOBHm_Chr5g0004471	Ⅳa	0	2.03271
RcbHLH67	RchiOBHm_Chr5g0010631	Ⅴb	1.17478	1.30658
RcbHLH72	RchiOBHm_Chr5g0036871	Ⅹ	0	2.48493
RcbHLH75	RchiOBHm_Chr5g0053301	Ⅴb	−2.3709	−1.67965
RcbHLH78	RchiOBHm_Chr5g0077341	Ⅸ	−1.05564	−1.12357
RcbHLH80 *	RchiOBHm_Chr6g0246251	Ⅳa	−3.29702	−2.05486
RcbHLH84	RchiOBHm_Chr6g0264701	Ⅻ	0	−1.21958
RcbHLH90	RchiOBHm_Chr6g0283511	Ⅻ	1.64315	2.09937
RcbHLH91	RchiOBHm_Chr6g0285491	Ⅶ	0	−1.17746
RcbHLH92	RchiOBHm_Chr6g0288541	ⅩⅢ	0	−1.37089
RcbHLH94	RchiOBHm_Chr6g0289601	Ⅺ	0	−1.06842
RcbHLH99	RchiOBHm_Chr6g0308251	Ⅶ	1.31529	2.89317
RcbHLH101	RchiOBHm_Chr6g0310101	Ⅻ	0	1.23509
RcbHLH102	RchiOBHm_Chr7g0180121	Ⅻ	0	−1.80483
RcbHLH104	RchiOBHm_Chr7g0182341	Ⅶ	0	−1.28473
RcbHLH105	RchiOBHm_Chr7g0183781	Ⅴa	−1.38441	--
RcbHLH106	RchiOBHm_Chr7g0185551	Ⅻ	0	1.81513
RcbHLH108	RchiOBHm_Chr7g0187141	Ⅲ(d+e+f)	0	2.74536
RcbHLH109	RchiOBHm_Chr7g0187261	Ⅲ(d+e+f)	−3.56492	--
RcbHLH110	RchiOBHm_Chr7g0188921	Ⅲ(a+b+c)	0	−1.77728
RcbHLH111	RchiOBHm_Chr7g0189021	Ⅻ	1.34134	2.0827
RcbHLH112 *	RchiOBHm_Chr7g0193761	Ⅰb	1.22723	4.82187
RcbHLH115	RchiOBHm_Chr7g0209751	Ⅲ(d+e+f)	0	1.34433
RcbHLH116	RchiOBHm_Chr7g0210101	Ⅰa	0	−3.38838
RcbHLH118	RchiOBHm_Chr7g0227911	Ⅸ	0	−1.0994
RcbHLH121	RchiOBHm_Chr7g0237511	ⅩⅢ	0	−1.02865

The log2 transformed expression profiles were obtained from the RNA-seq dataset [20]. ² RcbHLHs upregulated are shown in bold. The genes validated by qPCR were marked with asterisks.

Figure 5.

Validation of RNA-Seq results using qRT-PCR. RhUbi was used as an internal control. Expression profile data of four RcbHLH genes at 30 hpi and 48 hpi after B. cinerea inoculation were obtained using qRT-PCR. Values are the means of three replicates ± SD. The primers used are listed in Table 5.

2.5. RcbHLH112 Is a Susceptibility Gene to B. cinerea in Rose

To further investigate the potential role of B. cinerea-induced RcbHLH genes in pathogen resistance, we used VIGS to knock down the expression of RcbHLH112 in rose petals. The reason for selecting RcbHLH112 for this VIGS study was that RcbHLH112 is one of the most upregulated RcbHLHs after B. cinerea infection (Table 4). To silence RcbHLH112 in rose petals, we cloned the 256 bp fragment of RcbHLH112 into the tobacco rattle virus (TRV2) vector to generate TRV-RcbHLH112. Agrobacterium tumefaciens carrying TRV-RcbHLH112 and TRV1 were co-infiltrated into rose petals to produce rose petals with RcbHLH112 silencing. The infiltrated rose petals were then inoculated with B. cinerea. Compared with the control petals (TRV-GFP) inoculated with TRV with a GFP sequence, petals inoculated with TRV-RcbHLH112 showed attenuation of disease symptoms, with a significant reduction in the size of the lesion (Figure 6A,B). In addition, we used RT-qPCR to verify the silencing efficiency of VIGS (Figure 6C). These results show that RcbHLH112 is a susceptibility factor for rose resistance against B. cinerea and that its silencing increases resistance to B. cinerea in rose.

Figure 6.

Functional analysis of rose bHLH transcription factor gene RcbHLH112. (A) Compromised B. cinerea resistance upon silencing of RcbHLH112 at 60 hpi post inoculation. A recombinant tobacco rattle virus (TRV) targeting RcbHLH112 (TRV-RcbHLH112) was used for the gene silencing, and a TRV with GFP sequence (TRV-GFP) was used as the control. (B) Quantification of B. cinerea disease lesions on TRV-RcbHLH112- and TRV-GFP-inoculated rose petal discs. The graph shows the lesion size from three biological replicates (n = 48) with the standard deviation. (C) Expression of RcbHLH112 relative to that in the control at 6 days post silencing, before the infection with B. cinerea (0 hpi). All statistical analyses were performed using Student’s t-test; *** p < 0.001.

3. Discussion

The bHLH genes play important roles in plant growth, development and defence. In this study, we comprehensively analysed the RcbHLH family, including phylogeny, gene structure, chromosome localization, gene duplication events, sequence characteristics and expression profile analysis. We demonstrated that RcbHLH112 is involved in the regulation of resistance to B. cinerea in rose.

It was found that the number of RcbHLH genes in rose (121) was lower than that in Arabidopsis (158), rice (167), potato (124) and maize (208) [26,27,28], indicating that the bHLH gene has expanded to different degrees in different plants. Gene replication plays a very important role in gene family expansion. In this study, 16 replication events were identified in 56 RcbHLHs, all of which involved segmental duplication. The Ka/Ks ratio of the 16 RcbHLH repeats indicates that the RcbHLH gene family is under purifying selection, suggesting a highly conserved evolution. The phylogenetic relationship of bHLH between rose and Arabidopsis showed that most evolutionary branches contained different numbers of AtbHLH and RcbHLH proteins, indicating that the two species showed conservative evolution. These results suggest that the species-specific bHLH gene was lost in rose or gained in the Arabidopsis phylogeny after divergence from the most recent common ancestor.

The role of RcbHLH in B. cinerea resistance is still unclear. In this study, we constructed a phylogenetic tree of known resistance-related bHLHs and found that the bHLHs involved in disease resistance were distributed in groups Ia, Ib, IVb, IVc and Ⅲ(d+e+f). According to the expression in response to B. cinerea infection, we identified 21 RcbHLHs that could be involved in B. cinerea resistance in rose petals. Interestingly, most of the RcbHLH genes induced by B. cinerea are associated with segmental duplication events. The RcbHLH112 belonging to Ib was on the same evolutionary branch as the B. cinerea resistance-related bHLH found in many different species and was significantly induced by B. cinerea at 30 hpi and 48 hpi. Therefore, RcbHLH112 should be considered as an important candidate gene involved in the regulation of disease resistance in rose. The results of VIGS in rose petals showed that silencing of RcbHLH112 improved resistance to B. cinerea, indicating that it is a susceptibility factor of rose in B. cinerea infection process.

4. Materials and Methods

4.1. Identification and Characteristics of the bHLH Genes in Rose Genome

The complete genome data were downloaded from the Rosa chinensis ‘Old Blush’ genome website https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/ (accessed on 5 July 2022) for local alignment and analysis. To identify the non-redundant bHLH genes in the rose genome, first, the common protein sequence of the bHLH Hidden Markov Model (HMM) (PF00010) was downloaded from the Pfam website (http://pfam.xfam.org) (accessed on 11 July 2022). Then, using the HMM profile as a query, the rose genome was searched using the hmmblast function and all sequences were identified as containing bHLH domains with an E-value of <1 × 10⁻³ in rose. Finally, the protein and DNA sequences of the above rose bHLH members were extracted using the TBTools tool, and all candidate RcbHLHs were verified using the functional structure identified by MEME (https://meme-suite.org/meme/) (accessed on 11 July 2022) and the Pfam database to determine the final family members.

4.2. Mapping bHLH Genes on Rose Chromosomes

The physical locations of 121 genes were extracted from the genomic gff3 annotation file of rose. Mapchart 2.2 software was used to visualise the distribution of bHLH genes on 7 rose chromosomes [29].

4.3. Phylogenetic Analyses and Structure Analysis

A total of 158 Arabidopsis bHLH protein sequences were collected from TAIR (http://www.arabidopsis.org/) (accessed on 11 July 2022). The bHLH protein sequences of Arabidopsis thaliana and rose were compared using ClustalW. The bHLH sequence alignments were used for phylogenetic analysis. The phylogenetic tree was constructed using MEGA6 software, calculating the advance distance via p-distance, estimating the amino acid substitution at each site, performing 1000 bootstrap sampling steps and constructing the phylogenetic tree via the NJ method [30]. The gene structure map and functional structure map of RcbHLH were completed using TBtools [31].

4.4. Collinearity Analyses and Calculation of Ratios of Non-Synonymous (Ka) to Synonymous (Ks) Nucleotide Substitution

We used TBtools to analyse the collinearity of bHLH members and calculate the ratio of Ka/Ks [32].

4.5. Expression of RcbHLHs in Response to B. cinerea

The RNA-Seq data of rose petals infected with B. cinerea can be obtained from the National Center for Biotechnology Information (NCBI) database, accession number PRJNA414570. Clean sequencing reads were mapped to the rose reference genome. Reads per kb per million reads (RPKM) were used to obtain gene expression level. The gene expression level of RcbHLH was calculated as reads per kb per million reads. Differential expression analysis based on Log2 fold change was analysed using DEseq2. To verify the results of RNA-Seq, quantitative PCR (qPCR) was used to analyse the expression of 4 RcbHLH genes. Therefore, total RNA was extracted from rose petals 30 and 48 h after inoculation using the hot borate method [33]. First-strand cDNA was synthesised using HiScript II Q Select RT SuperMix (Vazyme) in 20 μL reaction volume, and 1 μg DNase-treated RNA was used. SYBR Green Master Mix (Takara, Dalian, China) was used for the qPCR reaction, and detection was performed on a StepOnePlus real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). RcUBI2 was used as an internal control. Expression was analysed via the delta–delta–CT method. All primers used for qPCR are listed in Table 5.

Table 5.

List of primers used in this study.

Gene Name	Accession Number	Primer Sequence (5′-3′)	Amplicon Length	Ta	Tm	Amplification Efficiency
RcbHLH29	RchiOBHm_Chr2g0126861	F: GGTTCCACCCTAGAGGTTGTT	110 bp	60 °C	81.69	2.005
		R: CTGCACGGACTAGGTGAAGT
RcbHLH60	RchiOBHm_Chr4g0445091	F: CGATGAGTTTGGACCACCGA	116 bp	60 °C	84.1	1.972
		R: CCTCAGCTTTGGCCTCAAGA
RcbHLH80	RchiOBHm_Chr6g0246251	F: ACACAAACCAAGTGGGGGTT	102 bp	60 °C	85.27	1.968
		R: GTTCCCTGACTGGCCTTCAA
RcbHLH112	RchiOBHm_Chr7g0193761	F: CGATCTTGCAGCCTCCTACA	120 bp	60 °C	82.43	2.024
		R: CAACCTTGATCCGACCACCA
RcUBI2	RchiOBHm_Chr1g0359561	F: GCCCTGGTGCGTTCCCAACTG	82 bp	60 °C	82.43	2.024
		R: CCTGCGTGTCTGTCCGCATTG

Ta: amplification temperature; Tm: melting temperature.

4.6. VIGS and B. cinerea Inoculation Assays

To generate the TRV-RcbHLH112 constructor, the 256 bp fragment of RcbHLH112 was amplified using a pair of primers, RcbHLH112-F(5’-GGGGGACAAGTTTGTACAAAAAAGCAGGCTTCTGAGGAAGAAGGAGCCGAAG-3’) and RcbHLH112-R(5’-GGGGGACCACTTTGTACAAGAAAGCTGGGTCCTCAGCTTAGCCTTGTGGAGT-3’).

The VIGS process involved taking individual petals from the outermost whorls of the rose at the second stage of flowering. A 15 mm disc was then cut from the centre of each petal. Agrobacterium tumefaciens cultures containing constructs expressing TRV1 and TRV2 were mixed 1:1 and infiltrated into the petal disc under vacuum [34]. On day 6 after infection, the petal disc was inoculated with B. cinerea. A minimum of 48 petal discs were used for genes, and VIGS was repeated at least three times. After inoculation with B. cinerea, Student’s t-test was performed to determine the significance of lesion size.

5. Conclusions

In this study, a genome-wide analysis of the RcbHLH family genes was performed, including phylogenetic relationship, collinearity and expression analysis. A total of 121 non-redundant bHLH family members were identified. These RcbHLH family genes were classified into 21 groups based on phylogeny and conserved domains. Expression analysis showed that the transcriptional regulation of some RcbHLH family genes was induced by B. cinerea infection in rose petals. Furthermore, plant bHLHs involved in disease resistance tended to cluster on the same branch of the phylogenetic tree. Based on these analyses, we used VIGS to further demonstrate that RcbHLH112 is a susceptibility factor of rose in B. cinerea infection process. The information provided by these results can promote further functional analysis of the RcbHLH gene in rose.

Abbreviations

hpi	hours post inoculation;
bHLH	basic/helix–loop–helix;
Ka/Ks	Ratios of non-synonymous to synonymous mutation frequencies;
ABA	abscisic acid;
VIGS	virus-induced gene silencing;
HMM	Hidden Markov Model;
WGD	whole-genome duplication;
Ka	non-synonymous mutation frequency;
Ks	synonymous mutation frequency;
NJ	neighbour-joining method;
TAIR	The Arabidopsis Information Resources;
TRV2	tobacco rattle virus;
NCBI	National Center for Biotechnology Information;
RPKM	reads per kb per million reads.

Author Contributions

C.D., X.H. and Z.Z. conceived and designed the experiments. C.D., J.G., S.Z., D.S. and Z.Z. analysed the data and wrote the paper. X.H., S.Z. and N.J. performed the experiments. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable. Our research did not involve any human or animal subjects, material or data. The plant materials used in this study were provided by the China Agricultural University and are freely available for research purposes, following institutional, national and international guidelines.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analysed during the current study has been included within supplemental data. The plant materials are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Statement

This study was supported by the Special Project for Science and Technology Cooperation and Exchange of Shanxi Province (Grant No. 202204041101017) to Chao Ding and Zhao Zhang. The funders played no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.