Protocol for CRISPR-Cas9-mediated genome editing to study spermatogenesis in Caenorhabditis elegans

Summary

Gene silencing by P-element-induced wimpy testis-interacting RNAs is a mechanism to maintain genome integrity in germ cells. Here, we present a protocol for knockin or knockout editing of male germline genome mediated by CRISPR-Cas9 technology in Caenorhabditis elegans. We describe steps for constructing edited plasmids, microinjecting worms with these plasmids, and screening edited worms. We then detail procedures for dissecting released sperm and their observation with fluorescence microscopy. Engineered worms provide a model for studying hermaphrodite/male fertility or protein localization in vivo.

For complete details on the use and execution of this protocol, please refer to Wang et al. (2021).¹

Graphical abstract

Highlights

• •Microinjection of gonad of C. elegans and gene editing of gametes using CRISPR-Cas9
• •Obtain a transgenic strain that expresses the GFP by insertion of GFP into the genome
• •Screening of edited worm by rol-6 expression-induced C. elegans “roller” phenotype
• •Fusion expression of GFP::NKB-2 can indicate spermatogenesis

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Gene silencing by P-element-induced wimpy testis-interacting RNAs is a mechanism to maintain genome integrity in germ cells. Here, we present a protocol for knockin or knockout editing of male germline genome mediated by CRISPR-Cas9 technology in Caenorhabditis elegans. We describe steps for constructing edited plasmids, microinjecting worms with these plasmids, and screening edited worms. We then detail procedures for dissecting released sperm and their observation with fluorescence microscopy. Engineered worms provide a model for studying hermaphrodite/male fertility or protein localization in vivo.

Before you begin

Caenorhabditis elegans strains were maintained on nematode growth medium (NGM) seeded with OP50 Escherichia coli and grown in a 20°C incubator, where otherwise noted.² All strains used in the experiments were derived from C. elegans wild isolate, strain N2.

Institutional permissions

Experiments with the nematode Caenorhabditis elegans do not require permission from institutions such as Animal Care and Use Committees.

Worm culture

Timing: 2 days

• 1.Caenorhabditis elegans wild-type Bristol N2 laying eggs are cultured on nematode growth medium (NGM) plates seeded with OP50 Escherichia coli cells and maintained at 20°C. Make sure to sustain healthy conditions for worms without starvation or contaminant by the other microorganisms.

Design of sgRNAs and PCR screening of progeny

Timing: 0.5 days

This section gives a detailed description of designing sgRNAs for CRISPR-Cas9-based DNA breaks in C. elegans genome and PCR primer pairs for screening of progeny as or knock-out or GFP knock-in animal.

• 2.Search for the target gene on WormBase (http://www.wormbase.org) and download the unspliced coding transcript.

Note: If there are more than one isoform for one gene, you can choose the first common exon motif to design sgRNA.

• 3.
  Design sgRNAs targeting the gene of interest using CRISPR design tools from Zhang lab’s website (http://www.zlab.bio/resources). We choose E-CRISP for the following experiments (http://www.e-crisp.org/E-CRISP/designcrispr.html).

  • a.
    Select organism as Caenorhabditis elegans, copy the gene sequence of the selected target region into the box, and then click “start sgRNA search”.
  • b.
    Choose sgRNAs with the highest score. The tool is designed to calculate the probability of off-target which is reported with score numbers.
  • c.
    Blast the sgRNA in WormBase to avoid other targets appearing in an unexpected location.
• 4.Select a plasmid that enables CRISPR-Cas9-mediated gene editing from website (http://www.addgene.org/crispr).

Note: We choose plasmid pDD162 (Addgene, #47549), which carries Cas9 sequence and U6 promoter sequence required for sgRNA transcription that can be modified to cleave any Cas9 target site in the C. elegans genome³

• 5.Design primer pairs for inserting the target sgRNA sequence into pDD162 by PCR method.

Note: The forward primer is 5′-N17GTTTTAGAGCTAGAAATAGC-3′, and the reverse primer is 5′-N17CAAGACATCTCGCAATAGGA-3′. N17 in the forward primer represents the 17-nucleotide sgRNA sequence at the 5′ N-terminus of the primer, and the N17 in the reverse primer represents the reverse complement of nucleotides 3-19 in the target sequence. This ensures that there are 15 base pairs of overlap between the N-terminal and C-terminal of the PCR product (Figure 1).

• 6.Design primer pairs flanking the sgRNA target site for PCR screening.

Figure 1.

Insertion of target sequence into pDD162 for gene editing

Design of template plasmid construction and PCR pairs for screening

Timing: 0.5 days

For knock-in gene editing, a template plasmid for homologous recombination is additionally needed. When CRISPR-Cas9-based DNA breaks occur in the genome, genetic repair begins to work, possibly using the provided DNA template. The sgRNA recognition sequence in the template plasmid needs to be substituted with a synonymous coding sequence to avoid cleavage by the Cas9 enzyme.

• 7.Design primer pairs for insertion of native template DNA into plasmid backbone, substitution of sgRNA target sequence in the template plasmid with synonymous coding sequences, and insertion of knock-in DNA fragment into template DNA.

Note: DNA fragments are inserted into plasmids by homologous recombination. Homologous recombination requires template DNA and the desired plasmid backbone with 20 bp of overlapping sequence on each side of the junction site (Figure 2). A 20 bp overlap with the plasmid backbone is introduced by primer synthesis, and the template DNA with homologous arms is synthesized by PCR. The DNA substitutions in the plasmid are performed by PCR amplification of plasmid DNA using primers with 15–20 bp overlap containing the base sequences after synonymous substitutions. The substitution template requires a ∼2 Kb fragment consisting of two fragments of ∼1 Kb on each side of the sgRNA recognition target in the genome (Figure 3). In the construction a plasmid for introducing a fluorescent protein gene, the base sequence of the fluorescent protein can be inserted after the ATG start codon of the target gene, such that the fusion-expressed fluorescent protein can be at the 5′ N-terminus of the target protein. Or the base sequence of the fluorescent protein can be inserted before the termination codon of the target gene, such that the fusion-expressed fluorescent protein can be located at the 3′ C-terminus of the target protein. A linker sequence is inserted at the site between the target gene and fluorescent protein for maintaining proper protein structure.

• 8.Design primer pairs flanking the sgRNA target site and locating in the knock-in fragment separately for PCR screening of the first and second generation of progeny of micro-injected worms to avoid false positive.

Figure 2.

Insertion of template DNA into backbone plasmid by homologous with synonymous sequence

Figure 3.

Substitution of sgRNA target sequence in the template plasmid recombination

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Experimental models: Organisms/strains
C. elegans: strain N2	Caenorhabditis Genetics Center (CGC)	RRID: WB-STRAIN:N2
C. elegans: strain gfp::nkb-2	Long Miao Lab	LMW467
Recombinant DNA
Plasmid peft-3::Cas9 + Empty sgRNA	Guangshuo Ou Lab	pDD162; Addgene plasmid # 47549
Plasmid contains rol-6 (su1006)	Guangshuo Ou Lab	pRF4
Oligonucleotides
Plasmid Cas9 sgRNA construct for nkb-2 mutant: AGACCCAACACGGCTTTTCG	This paper	N/A
nkb-2 sgRNA target for GFP knockin using CRISPR-Cas9: TTGTTGCGAATCATCACGAG	This paper	N/A
Primer for nkb-2 homology arms for GFP knockin using CRISPR-Cas9 forward: 5′-TGGCAGCGTATGGAGTA-3′	This paper	N/A
Primer for nkb-2 homology arms for GFP knockin using CRISPR-Cas9 reverse: 5′-GAACCAAACAAGAGCAATGG-3′	This paper	N/A
Linker between gfp and nkb-2: TGCCCGG GGGATCGGTGGAGCTCCACCGGTGGC GGCCGCTCTAGAACT	This paper	N/A
Plasmid contains gfp::nkb-2 homologous repair template	This paper	N/A
Software and algorithms
ImageJ	NIH	RRID: SCR_003070
FLUOVIEW FV1200 Viewer	Olympus	https://www.olympus-lifescience.com/en/
CRISPR design	website	http://www.zlab.bio/resources

Materials and equipment

2 L of NGM solid medium

Reagent	Final concentration	Amount
Peptone	N/A	5 g
Agar	N/A	40 g
NaCl	N/A	5 g
KPO4	25 mM	50 mL; 1 M
CaCl2	20 mM	40 mL; 1 M
MgSO4	1 mM	2 mL; 1 M
Cholesterol/ethanol mixture	5 μg/mL	2 mL; 5 mg/mL
ddH2O	N/A	1906 mL
Total	N/A	2 L

Store at 4°C for up to 1 month

1 L of LB solid medium

Reagent	Final concentration	Amount
NaCl	N/A	5 g
Tryptone	N/A	10 g
Yeast Extract	N/A	5 g
Agar	N/A	15 g
ddH2O	N/A	1 L
Total	N/A	1 L

Store at 4°C for up to 1 month

1 L of M9 buffer

Reagent	Final concentration	Amount
NaCl	N/A	5 g
KH2PO4	N/A	3 g
Na2HPO4	N/A	6 g
MgSO4	1 mM	1 mL; 1 M
ddH2O	N/A	1 L
Total	N/A	1 L

Stored at -20°C for up to 6 months

1 mL of lysis buffer

Reagent	Final concentration	Amount
KCl	50 mM	3.7276 mg
pH 8.2 Tris	10 mM	10 μL; 1 M
MgCl2	2.5 mM	238.0275 μg
NP-40	0.45%	4.5 μL
Tween-20	0.45%	4.5 μL
DNA free gelatin	0.01%	0.1 μL
ddH2O	N/A	1 mL
Total	N/A	1 mL

Stored at −20°C for up to 6 months

100 μL of proteinase K worm lysis buffer

Reagent	Final concentration	Amount
Proteinase K	1 mg/mL	5 μL; 20 mg/mL
Lysis buffer	N/A	95 μL
Total	N/A	100 μL

Stored at −20°C for up to 6 months

1 mL of PH 7.8 SM buffer

Reagent	Final concentration	Amount
HEPES	50 mM	11.9151 mg
NaCl	50 mM	2.922 mg
KCl	25 mM	1.8638 mg
MgSO4	1 mM	120.366 μg
CaCl2	5 mM	554.9 μg
Polyvinylpyrrolidone	10 mg/mL	10 mg
ddH2O	N/A	1 mL
Total	N/A	1 mL

Stored at −20°C for up to 6 months.

Step-by-step method details

Cloning of sgRNAs into pDD162

Timing: 1 week

The pDD162 vector contains Cas9 gene sequence. Therefore, cloning sgRNAs into pDD162 makes it possible to express sgRNA and Cas9 in the same cell.

• 1.PCR-amplify the pDD162 using high-fidelity DNA polymerase and primer pairs for insertion of target sequence.

Note: Reducing the number of PCR cycles and increasing the annealing temperature will be beneficial for high fidelity PCR.

• 2.We digested the PCR product with DpnI at 37°C for 2 h to remove the circular template plasmid.

Component	Volume (μL)
Restriction endonuclease DpnI	1
CutSmart buffer	2
DNA products	15
Double distilled water	2

• 3.
  The digested products are transformed into DH5α competent cells.

  • a.
    Add 5 μL of digested products into 50 μL of DH5α competent cells for transformation.
  • b.
    The heat shock treatment follows the protocol from Thermo Fisher Scientific product manuals (catalog number: EC0112).
  • c.
    Spread the transformed cells on LB plate containing 100 μg/mL ampicillin and incubate at 37°C for 12 h.
  • d.
    Pick 2–3 bacteria colonies into 5 mL of LB medium containing 100 μg/mL ampicillin separately and incubate at 37°C and 200 × g for 12 h.
  • e.
    Isolate plasmids from the incubation bacteria culture using a plasmid mini-preparation kit.
• 4.Analysis of successful insertion of sgRNA into pDD162.

The clones containing target sequence are identified by Sanger sequencing.

• 5.
  Isolation and purification of plasmids.

  Note: The purpose of this step is to remove endotoxin and increase the amount of plasmid DNA, which is beneficial for effective DNA transformation of worms.

  • a.
    Incubate 15 mL LB medium containing 100 μg/mL ampicillin and 30 μL bacteria culture identified containing target sequence at 37°C for 12 h.
  • b.
    The incubated bacteria culture is collected into 3 centrifugal tubes. The plasmids are isolated by plasmid mini-preparation kit.
  • c.
    The isolated plasmids are combined into 1 centrifugal tube and purified by quick PCR purification kit to remove endotoxin and increase the amount of plasmid DNA.
• 6.The concentrations of purified plasmids are determined and the plasmids are stored at −20°C for the following injection.

Cloning template DNA into plasmid backbone

Timing: 2 weeks

The template DNA cloned from worm genomic DNA is inserted into plasmid backbone. After substitution with synonymous coding sequence in sgRNA target sequence in the plasmid, the DNA sequence required for knock-in is inserted into the template DNA at the determined site.

• 7.
  Preparation of genomic DNA isolated from C. elegans worm for cloning template DNA.

  • a.
    Add 5 μL 20 mg/mL proteinase K into 95 μL worm lysis buffer.
  • b.
    Pick 5–10 worms into 20 μL lysis buffer containing proteinase K.
  • c.
    Store at -80°C for 30 min then incubate at 65°C for 1 h.
  • d.
    Inactive of proteinase K at 95°C for 15 min.
  • e.
    Store at −80°C for further PCR.
• 8.The template DNA and the plasmid backbone are amplified using high-fidelity DNA polymerase and primer pairs.

Note: Reducing the number of PCR cycles and increasing the annealing temperature will be beneficial for high fidelity PCR. Reducing the concentration of plasmid backbone (1–5 ng) in PCR system for amplifying plasmid backbone is beneficial for efficiently avoiding the false positive in the following homologous recombination.

• 9.Load the PCR products on the agarose gel and extract by agarose gel DNA extraction kit.
• 10.Test the extracted template and plasmid backbone DNA for their concentration and ligated by using homologous recombination kit for 30 min at 37°C.

Component	Volume (μL)
Enzyme	1
Buffer	2
Template DNA	2–4
Plasmid backbone	2–4
ddH2O	add to 10

• 11.The homologous recombined products are transformed to DH5α competent cells (as described in step 3). Analysis of successful insertion of template DNA into the plasmid backbone is determined by Sanger sequencing.
• 12.The identified template plasmid is further amplified using high-fidelity DNA polymerase and primer pairs for substitution with synonymous coding sequence in sgRNA target sequence.
• 13.The PCR product in Step 12 is digested with DpnI and transformed into DH5α competent cells (as described in step 2-3). Analysis of successful substitution by Sanger sequencing.
• 14.The DNA sequence required for knock-in is inserted into the template DNA by homologous recombination and identified by Sanger sequencing (as described in steps 8–11).
• 15.The template plasmids are isolated and purified (as described in step 5).
• 16.The purified template plasmids are determined for their DNA concentration and stored at −20°C for the following microinjection.

Transformation of worms by microinjection

Timing: 1–2 days

Microinjection is an effective method for creating transgenic animals, for RNAi of selected genes, and for introducing various types of molecules directly into cells. For microinjection of C. elegans, the easiest approach is to inject DNA into the distal arm of the gonad.^4,5 The distal germline of C. elegans contains a central core of cytoplasm that is shared by many germ cell nuclei. Therefore, DNA injected here can be delivered to many progeny. This approach usually leads to the formation of large extrachromosomal DNA arrays.⁴ Microinjection directly into oocyte nuclei can induce chromosomal integration of transgenes, but this technique is relatively difficult to do.⁶ Contrary to common perceptions, worm microinjection is not hard to learn and does not require the most expensive equipment. The microinjection method described below is geared towards generating transgenic worms, but it can be readily adapted for injecting a variety of molecules at different sites.⁷

• 17.Choose one type of selectable markers for identification of effective transformation.

Note: There are different kinds of selectable markers, such as phenotype-associated genes or fluorescent protein genes, which are often used in genetic engineering to isolate worms with effective DNA transformation. Here we used popular marker plasmid pRF4 containing rol-6 (su1006) which confers a dominant “roller” phenotype,⁸ where worms corkscrew around in circles. This phenotype is easy to be identified with a simple dissecting microscope. Fluorescent markers require a dissecting microscope equipped with fluorescent optics.

• 18.Single healthy L4 worms ready for microinjection from the plate and culture them at 20°C for about 10 h.

Note: Young adult worm is suitable for microinjection because of soft skin benefit of injection and appropriate stage of germline development in which worm just initiates the switch to oogenesis after producing about 300 sperm.

• 19.Preparation of injection pads made of 50 × 22 mm coverslip covered with a drop of 2% hot agarose and air dry for 12 h.

CRITICAL: Pad can be used for several rounds of injection if the first coverslip is covered with several drops and added to the second coverslip.

• 20.
  Preparation of needle-loading pipettes and microinjection needles.

  • a.
    Needle-loading pipettes are made of 10 μL stand standard glass capillary pipettes. Heat the pipette over flame then quickly pull it out and break to generate two needle-loading pipettes.
  • b.
    Borosilicate glass capillaries (1.0 mm OD, 0.75 mm ID) with a fine internal glass filament are used to make microinjection needles by needle puller.

Note: Microinjection needle made by needle puller contains a closed tip. It is necessary to break open the tip by gently tapping the needle across a glass slide. An appropriate size of the open-ended tip is important for successful microinjection.

• 21.
  DNA transformation by microinjection.

  • a.
    The DNA mixture containing Cas9-sgRNA plasmid, pRF4 marker plasmid and template plasmid (used for knock-in) is centrifuged for removing impurities.

    Note: The DNA concentration of each plasmid is ensured to be 50 ng/μL in the mixture.

  • b.
    Fill a needle-loading pipette.

    CRITICAL: Fill a needle-loading pipette by capillary action with ≥ 1 μL of DNA injection mix.

• 22.
  Adhesive fixation of worms.

  • a.
    Select the worm and place it on an agarose coverslip containing oil droplets.
  • b.
    Use the viscosity of the agarose to fix the whole worm.
  • c.
    Gently flick the worm to display the gonads using the eyelash picker.

We picked the worm and placed it on an agarose coverslip containing oil droplets, using the viscosity of the agarose to fix the whole worm, and the eyelash picker was used to gently flick the worm to display the gonads.

CRITICAL: The worms used for microinjection are preferably younger adult hermaphrodites, a stage in which the gonads are clearly visible and the cuticle on the surface of the worm is thin and soft, which makes it easy to prick the needle.

• 23.
  Microinjection of worms.

  • a.
    Adjust the position of the worm to ensure that the gonad forms an angle of 30°–50° with the tip of the needle.
  • b.
    Gently push the tip of the needle into the nematode’s gonad.
  • c.
    Step on the air pump to squeeze out the plasmid droplets to observe the spread of the droplets in the gonad.
  • d.
    Quickly remove the needle after injection.

Note: In order to ensure the survival rate, each gonad is injected only once.

• 24.Resuscitation of worms.

Dropped a drop of M9 buffer onto the worms, and then gently picked them out from the agarose slide with an eyelash picker and transferred to a new NGM plate. Then 3 μL of M9 buffer was added dropwise to remove oil from the worms and waited for the worms to crawl out of the droplet to restore their vitality. After 5–6 h, the microinjected worms were transferred to new NGM plate to lay eggs, and their progeny can be screened and genotyped.

Screening and identification of edited worms

Timing: 2 weeks

• 25.Edited worms were identified by PCR.

Note: The microinjected worms were cultured in an incubator at 20°C for 2 days to produce a sufficient number of offspring. Then, 8 or more hermaphrodite offspring of the roller phenotype were randomly picked and transferred to new individual plates and cultured for 3 days. The progeny hermaphroditic nematodes were picked out to prepare a PCR template, and a single nematode PCR was performed. According to the PCR results, 8 L4 hermaphroditic larvae were picked from the positive progeny and transferred to a new separate plate, and a round of PCR was performed after the offspring were produced to identify homozygotes (Figure 4).

• 26.The positive PCR amplification products are sequenced to obtain the edited gene sequence.

PCR cycling conditions

Steps	Temperature	Time	Cycles
Initial Denaturation	98°C	30 s	1
Denaturation	98°C	10 s	25–35 cycles
Annealing	55°C	20 s
Extension	72°C	2 min
Final extension	72°C	5 min	1
Hold	4°C	30 min

• 27.Tracking spermatogenesis by GFP::NKB-2 signaling in hermaphrodites.

Note: In the L4 stage, the development of the gonads of hermaphrodite nematodes enters the spermatogenesis stage, and spermatocytes are marked by GFP::NKB-2. When the worms develop into the young adult stage, sperm differentiation has ended. Spermatocytes and spermatids labeled with GFP::NKB-2 distribute in or near spermatheca followed by the oocytes, which could be easily recognized under DIC and/or by GFP::NKB-2 under a confocal microscope (Figure 5).

Figure 4.

Screening method for GFP sequence knockin C. elegans genome

Figure 5.

GFP::NKB-2 protein traces the process from spermatogenesis to sperm maturation

Scale bar: 20 μm.

Dissection of worm gonads to release sperm

Timing: 3 days

• 28.Pick the transgenic male worms in the L4 stage with the tagged sequence inserted in the sperm-specific expression gene (e.g., nkb-2), transfer them to a new NGM culture plate, and culture for 3 days. Add 3 μL of M9 or SM buffer dropwise on the coverslip, and pick worms into the droplet. Take two dissecting needles, clamp the worm body with the needle tip at one-third of the tail of the worm body and cut it open, and the sperm are squeezed out from the gonad under the pressure in the cavity. Cover the slide and let it stand at 20°C for 5 min before imaging.

Note: Dissecting needles were used without scratching other parts of the nematode as much as possible to maintain the pressure in the nematode body cavity. After the dissection, remove the nematode corpse from the sperm.

Microscopic imaging of transgenic labeled sperm

Timing: 0.5 days

• 29.The sperm were dissected out on a coverslip, which was then covered with a slide and left at 20°C for 5 min to be used for imaging. And the localization and distribution of tagged proteins were observed by fluorescence imaging.

CRITICAL: After closing the coverslip, make sure there is enough buffer in the slide chamber to keep the sperm in buffer during imaging.

Expected outcomes

The template plasmid for homologous recombination was required for the construction of the gfp::nkb-2 worm strain in addition to the pDD162 plasmid containing the sgRNA sequence. Plasmid pPD95.75 serves as a donor for the gfp sequence as well as the plasmid backbone.⁹ sgRNA target sequences were selected near the ATG start codon of the nkb-2 gene. The 1 kb upstream and downstream sequences of the sgRNA target sequence were amplified using nematode genomic DNA as a template, and then ligated into pPD95.75 with the gfp sequence removed by homologous recombination. The gfp sequences were then PCR-amplified and ligated into a plasmid containing 2 kb of homologous sequence, with the ligation site located at the 5′ N-terminus of the ATG start codon of the nkb-2 gene. A linker sequence was introduced at the 3′ N-terminus of the gfp sequence by PCR (5’-TGCCCGGGGGGATCGGTGGAGCTCCACCGGTGGCGGCCGCTCTAGAACT-3′).¹⁰ The sgRNA target sequence in the plasmid needs to be replaced with a different DNA sequence encoding the same amino acid to prevent Cas9 from cutting the template plasmid while cutting the genomic DNA. The constructed template plasmid, pDD162 plasmid containing the target sequence, and pRF4 plasmid containing the dominant roller marker were injected into the gonads of hermaphroditic nematodes that had just entered the adult stage, and the concentration of the plasmids was 50 ng/μL. Through two rounds of PCR identification on two generations of offspring, we identified a homozygous transgenic nematode GFP::NKB-2. Fluorescence imaging showed that NKB-2 protein was localized on the plasma membrane of spermatocytes and sperm, and the GFP tag expressed by the protein fusion could well indicate the whole process of spermatogenesis, including spermatocytes, haploid spermatids, and meiotic spermatocytes (Figure 6).

Figure 6.

Sperm dissected from a GFP::NKB-2 transgenic worm

The GFP::NKB-2 protein is specifically localized to the plasma membrane of sperm, which is beneficial to track and study spermatogenesis. Scale bar: 5 μm.

Limitations

This protocol describes how to use the CRISPR-Cas9 method to insert fluorescent tag into nematode genome by homologous recombination to track the localization and distribution of target protein in vivo. The application of this method is subject to the following prerequisites. First, whether the fluorescent tag sequence is inserted in the 5′ or 3′ of the target gene, it will not affect the function of the target protein and ensure the integrity of its functional domain. Second, the target protein should be highly and specifically expressed in vivo, so that the signal of the fluorescent tag can be easily captured. In addition, the start codon or stop codon region of the target gene must have a recognition site for the sgRNA sequence. Furthermore, for genes with multiple isoforms, when designing sgRNA, it is necessary to consider choosing a common exon motif to design sgRNA.

Troubleshooting

Problem 1

The tag sequence cannot be inserted before the stop codon of the nkb-2 gene (As described in step 7).

Potential solution

NKB-2 protein is the beta subunit of the sodium/potassium exchange ATPase complex. It is mainly involved in cellular metal ion homeostasis and monoatomic cation transmembrane transport. Our previous study showed that nkb-2 is specifically distributed in the plasma membrane of spermatids.¹ When sperm cells receive activation signals and start to activate, the cell grows spike-like pseudopods and initiates the establishment of polarity, which facilitates spermatozoa to obtain motility. nkb-2 mutation leads to an increase of the concentration of sodium ions in the sperm, enhancement of the membrane potential, aberrant polymerization of the major sperm proteins, and a great reduction in the motility of activated spermatozoa, resulting in nematode sterility. When we inserted the gfp sequence before the stop codon of the nkb-2 gene, expression of the GFP cannot be observed, but also the gfp::nkb-2 strain causes a reduction in nematode fertility and affects the function of NKB-2, which is due to the insertion of GFP interfering with the functional domain at the 3′ C-terminus of NKB-2 protein. However, after insertion the gfp sequence into the start codon 5 of the nkb-2 gene, the fluorescent signal of gfp::nkb-2 can be observed without affecting the fertility of C. elegans.

Problem 2

The edited strains screened by the rol-6 induced roller phenotype will affect the functional analysis of the target gene (As described in step 17).

Potential solution

In this protocol, we use the marker plasmid pRF4 containing rol-6 (su1006), which induces a dominant "roller" phenotype in C. elegans, in which worms display helical coiling behavior. This phenotype is easily identified with a simple dissecting microscope to screen for gene-edited strains. However, this "roller" phenotype will affect the crawling and development of the nematode. Therefore, in order to avoid the interference of the marker plasmid, pPD162 plasmid and template on the edited strain, we need to screen out the gene-edited offspring with normal movement from the hermaphrodites with "roller" behavior, and then conduct in-depth research on the function of this target gene.

Problem 3

A strain with "roller" phenotype is not necessarily an edited strain (As described in step 17).

Potential solution

Since the pRF4 plasmid expressing the rol-6 protein and the pDD162 plasmid providing the sgRNA sequence are not the same plasmid, these plasmids may not work simultaneously in one cell when microinjected into hermaphrodite gonads. In our experience, there are fewer sgRNA-edited worms expressing the ROL-6 protein with "roller" behavior, but almost all sgRNA-edited worms have a roller phenotype.

Problem 4

When PCR identifies gfp knock-in worms, knock-out worms are most likely identified (As described in step 25).

Potential solution

For knockout gene editing, Cas9 enzyme creates a break site, does not need to repair the template, and the self-repair of the damaged DNA randomly repairs, thereby introducing a new mutant sequence, which is easier than knock-in gene editing.

Problem 5

After obtaining the gfp knock in worm strain, it is first necessary to detect whether the fertility of the transgenic nematode is affected (As described in step 26).

Potential solution

A single nematode was picked to a separate culture plate at the L4 stage, and then transferred to a new culture plate every day until no more eggs were laid. The fertilized eggs produced were counted after hatching to obtain the total number of offspring of each nematode. Based on the number of offspring produced, we can determine whether GFP knock in affects the fertility of nematodes.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Long Miao (lmiao@bnu.edu.cn).

Materials availability

This study did not generate new unique resources and reagents.

Data and code availability

This study did not generate data or code.