Skip to main content

This is a preprint.

It has not yet been peer reviewed by a journal.

The National Library of Medicine is running a pilot to include preprints that result from research funded by NIH in PMC and PubMed.

bioRxiv logoLink to bioRxiv
[Preprint]. 2024 Feb 8:2023.11.20.567833. Originally published 2023 Nov 21. [Version 2] doi: 10.1101/2023.11.20.567833

Hammerhead-type FXR agonists induce an eRNA FincoR that ameliorates nonalcoholic steatohepatitis in mice

Jinjing Chen a,#, Ruoyu Wang b,#, Feng Xiong b, Hao Sun a, Byron Kemper a, Wenbo Li b,*, Jongsook Kim Kemper a,*
PMCID: PMC10690184  PMID: 38045226

Abstract

The nuclear receptor, Farnesoid X Receptor (FXR/NR1H4), is increasingly recognized as a promising drug target for metabolic diseases, including nonalcoholic steatohepatitis (NASH). Protein coding genes regulated by FXR are well known, but whether FXR also acts through regulation of long non-coding RNAs (lncRNAs), which vastly outnumber protein-coding genes, remains unknown. Utilizing RNA-seq and GRO-seq analyses in mouse liver, we found that FXR activation affects the expression of many RNA transcripts from chromatin regions bearing enhancer features. Among these we discovered a previously unannotated liver-enriched enhancer-derived lncRNA (eRNA), termed FincoR. We show that FincoR is specifically induced by the hammerhead-type FXR agonists, including GW4064 and tropifexor. CRISPR/Cas9-mediated liver-specific knockdown of FincoR in dietary NASH mice reduced the beneficial effects of tropifexor, an FXR agonist currently in clinical trials for NASH and primary biliary cholangitis (PBC), indicating that that amelioration of liver fibrosis and inflammation in NASH treatment by tropifexor is mediated in part by FincoR. Overall, our findings highlight that pharmacological activation of FXR by hammerhead-type agonists induces a novel eRNA, FincoR, contributing to the amelioration of NASH in mice. FincoR may represent a new drug target for addressing metabolic disorders, including NASH.

Keywords: FXR, nuclear receptor, lncRNA, enhancer, enhancer RNA, tropifexor, hepatic inflammation, NASH, NAFLD, RNA-seq, Gro-seq

Introduction

Nonalcoholic fatty liver disease (NAFLD) is the most common chronic liver disease and a leading cause of liver transplants and liver-related death (Friedman et al., 2018). NAFLD begins with simple steatosis but may further progress to a severe form, non-alcoholic steatohepatitis (NASH), and later, fatal cirrhosis and liver cancer (Friedman et al., 2018). Despite its striking global increase and clinical importance, there is no approved drug for NASH. The urgent need for development of therapeutic agents for NASH has greatly increased research interest in the nuclear receptor, Farnesoid X Receptor (FXR, NR1H4) (Evans & Mangelsdorf, 2014).

FXR is activated by its physiological ligands, bile acids (BAs), and regulates expression of genes involved in BA, lipid, and glucose metabolism and hepatic autophagy, which maintain metabolite levels and metabolic homeostasis (Calkin & Tontonoz, 2012; Kliewer & Mangelsdorf, 2015; Lee et al., 2006; Lee et al., 2014; Seok et al., 2014). Ligand-activated FXR also protects against hepatic inflammation and liver injury (Jung et al., 2020; Wang et al., 2008). The action of FXR, similar to other nuclear receptors, is achieved primarily by its binding to chromatin loci to regulate the transcription of target genes (Calkin & Tontonoz, 2012; Lee et al., 2006; Lee et al., 2012; Thomas et al., 2010). Consistent with its crucial physiological functions, FXR is increasingly recognized as a promising drug target, particularly for liver diseases, such as NASH and primary biliary cholangitis (PBC) (Abenavoli et al., 2018; Ali et al., 2015; Downes et al., 2003; Kremoser, 2021). For example, semi-synthetic or non-steroidal synthetic agonists of FXR, including obeticholic acid (OCA) and hammerhead-type agonists, such as tropifexor and cilofexor, are currently in clinical trials for NASH and PBC patients (Abenavoli et al., 2018; Kremoser, 2021; Sanyal et al., 2023; Tully et al., 2017). However, how pharmacological activation of FXR mediates such beneficial therapeutic effects is poorly understood.

Non-protein-coding RNAs (ncRNAs) are one of the fascinating discoveries of modern biology (Cech & Steitz, 2014). While a significant portion of the genome was initially thought to be “junk DNA”, it has been established that many non-coding regions give rise to functional non-coding RNAs (Cech & Steitz, 2014). Of these ncRNAs, long non-coding RNAs (lncRNAs) are a group of transcripts longer than 200 nucleotides and play important roles in diverse biological processes (Lam et al., 2014; Li et al., 2016; Mattick et al., 2023; Sartorelli & Lauberth, 2020; Statello et al., 2021). A group of lncRNAs are produced from genomic regions bearing epigenetic features of enhancers (Hon et al., 2017; Mattick et al., 2023). This is consistent with the idea that many transcriptional enhancers actively transcribe noncoding RNAs that are referred to as eRNAs (>85k in humans and >57k in mice) (Hirabayashi et al., 2019), some of which are functionally important for enhancer functions (Lai & Shiekhattar, 2014; Li et al., 2016; Sartorelli & Lauberth, 2020). A majority of eRNAs have not yet been annotated in current lncRNA databases, such as GENCODE. Exploring eRNA landscapes and functions in diverse biology and disease states will facilitate our understanding of both lncRNAs and enhancers (Li et al., 2016; Mattick et al., 2023). Indeed, the landscape of eRNAs in mouse liver has been minimally explored (Fang et al., 2014), and has not been well-studied in response to specific nuclear receptor activation, such as by FXR. Moreover, functional roles of eRNAs in vivo in intact organisms is understudied.

FXR was shown to regulate expression of small non-coding microRNA (miR) genes, for example miR-34a and miR-802 (Lee et al., 2010; Seok et al., 2021), but it has not been reported whether FXR achieves its function through regulating lncRNAs, which far outnumber miRs. Because FXR directly regulates expression of its target genes (Lee et al., 2012; Thomas et al., 2010), we examined if FXR regulates enhancer-derived lncRNAs (eRNAs), and if such transcripts participate in its physiological or pharmacological functions. By utilizing RNA-seq and GRO-seq analyses of livers from mice treated with FXR ligands, we identified a set of FXR-regulated eRNAs. Among these, we focused on a highly induced and abundantly expressed eRNA that we referred to as FXR-induced non-coding RNA (FincoR) for functional studies. FincoR is highly enriched in mouse liver and is induced specifically by hammerhead-type FXR agonists, including GW4064 and tropifexor. In vivo studies utilizing CRISPR/Cas9-mediated liver-specific knockdown of FincoR in dietary NASH mice indicated that FincoR is critically involved in mediating the beneficial pharmacological effects of tropifexor in reducing liver fibrosis and inflammation.

Results

Activation of FXR by GW4064 induces a novel eRNA, FincoR, in mouse liver

To identify enhancer-derived lncRNAs (eRNAs) potentially regulated by FXR, we first obtained a list of putative enhancers in mouse liver based on ENCODE H3K27ac ChIP-Seq data (ENCFF001KMI, see methods). Then, we performed ribo-depleted total RNA-seq in the livers from mice treated with a specific FXR agonist, GW4064, to identify transcripts produced from these enhancer regions (see Supplementary Table S1). To avoid confounding issues of RNA signals from genes, we specifically focused on intergenic enhancer regions (+/− 3kb from H3K27ac peak center) that harbor discernible RNA-Seq signals (RPKM > 1).

This genomic analysis resulted in identification of 190 high-confidence eRNAs in mouse liver. Among these, 14 eRNAs were upregulated and 5 were downregulated by GW4064 treatment (FDR < 0.05, Log2 FC > 1, Figure 1A) (see Supplementary Table S2). FXR-regulated eRNAs were produced adjacent to many genes with important roles in liver metabolism and disease, for example, Hes1 (Figure 1-figure supplement 1A, B). One of the most robustly induced eRNAs was FXR-induced non-coding RNA (FincoR), an unannotated novel transcript located on chromosome 19 (Figure 1A, B, C). Reverse transcription qPCR (RT-qPCR) confirmed that treatment with GW4064 substantially induced expression of FincoR, more than 10-fold in mouse liver, which is similar to induction of Shp, a well-known FXR target gene (Figure 1D) (Claudel et al., 2005; Evans & Mangelsdorf, 2014; Goodwin et al., 2000). Induction of FincoR by GW4064 was transient, peaked within 1 h and then declined gradually, a pattern similar to that of Shp (Figure 1-figure supplement 1C). Expression of genes adjacent to FincoR, including Gcnt1, Rfk, Pcsk5 and Prune2, did not change after acute 1 h FXR activation as shown by RNA-seq (Figure 1C), and confirmed for Gcnt1 by time course qPCR (Figure 1-figure supplement 1C).

Figure 1. Activation of FXR by GW4064 induces FincoR, a novel eRNA, in mouse liver.

Figure 1.

(A) Volcano plot from RNA-Seq showing significantly induced eRNAs (FincoR is highlighed) in the livers of C57BL/6 male mice treated with GW4064 (i.p. injection, 30 mg/kg, 1 h) or vehicle. The x axis denotes log2 fold change (GW4064/Veh) of eRNAs and the y axis denotes −log10 FDR of eRNAs. (B) A Bar plot showing the reads per million (RPMs) of up regulated eRNAs by GW4064 treatment. (C) IGV genome browser track showing RNA-seq signals from vehicle or GW4064 treated samples around the FincoR locus and its neighboring regions. A zoom-in view of FincoR is shown below. Veh, vehicle; GW, GW4064; pos, positive strand; neg, negative strand; Refseq, reference sequence. (D) RT-qPCR data showing GW4064 induction of FincoR eRNA and Shp mRNA in the liver (n=4/group). Data are presented as mean ± SEM. Statistical significance was determined by the two-way ANOVA Sidak’s multiple comparisons test with **p < 0.01 and ***p < 0.001.

We also found that the short-time GW4064 treatment resulted in 590 up-regulated genes and 500 down-regulated genes (FDR < 0.05) (Figure 1-figure supplement 2A). GO enrichment analysis of these differentially expressed genes (DEGs) revealed their roles in the regulation of triglyceride, fatty acid, and cholesterol metabolism (Figure 1-figure supplement 2B), which is consistent with known roles of FXR in these physiological processes (Claudel et al., 2005).

Ligand-activated FXR directly activates transcription of eRNAs, including FincoR

We sought to examine, 1) if these eRNAs were directly activated by FXR, and 2) if the activation takes place transcriptionally using FXR liver-specific knockout (FXR-LKO) mice that were treated with GW4064 to determine if FXR was required for induction of eRNAs by GW4064. FXR-LKO mice were generated from FXR floxed mice (FXR-flox) (Figure 2-figure supplement 1A) and transcription of eRNAs was detected by global run-on sequencing (GRO-seq), a widely used method to detect nascent RNA transcription, including eRNAs (Lam et al., 2014; Li et al., 2016; Sartorelli & Lauberth, 2020). GRO-seq showed that FXR-induced eRNAs were activated transcriptionally by GW4064 in FXR-flox mice, but such induction was abolished in FXR-LKO mice (Figure 2A). In particular, FincoR is robustly induced in the GRO-Seq analysis and its induction is dependent on hepatic FXR (Figure 2B). RT-qPCR confirmed the FXR-dependent expression of FincoR, similar to that of Shp (Figure 2-figure supplement 1B).

Figure 2. Ligand-activated FXR directly activates transcription of eRNAs including FincoR in the liver.

Figure 2.

(A) Left: experimental outline. FXR-Flox and LKO male mice were fasted overnight and treated with vehicle or GW4064, and livers were collected 1 h later with nuclei isolated for Gro-seq (n=2/group). Right: a boxplot shows the Gro-Seq signals for GW4064 up-regulated eRNAs in different conditions. RPKM: reads per kbp per million. (B) IGV genome browser track showing RNA-seq, Gro-seq and ChIP-seq signals in the FincoR locus. An arrow at the bottom points to the main enhancer FXR ChIP-seq peak that overlaps the start site of FincoR. (C) ChIP assays were performed in the same liver samples described in Fig. 1A to detect FXR, RXRα, and BRD4 occupancy at the FXR binding peak region close to the transcription start site of FincoR (black arrow in Fig.2B). (D) HepG2 cells were transfected with luciferase reporter expressing wild type FXRE or mutant FXRE (see materials and methods) for 24 h before treatment with GW4064 for an additional 6 h. Relative luciferase activities are shown. (C-D) Data are presented as mean ± SEM. Statistical significance was determined by the Student’s t test with *p < 0.05 and ***p < 0.001.

We next examined if FXR binds to the enhancers that produce the identified eRNAs by analyzing published mouse liver ChIP-Seq data for FXR (Supplementary Table S3) (Lee et al., 2012; Thomas et al., 2010). FXR binding was strongly enriched at the enhancers associated with FXR-induced eRNAs as were the enhancer marks H3K27ac and H3K4me1 (Figure 2-figure supplement 1C). The binding of FXR and the presence of histone marks at the FincoR enhancer region determined by ChIP-seq as compared with nascent transcripts detected by Gro-seq is shown in Figure 2B. These analyses support the conclusion that activation of FXR transcriptionally induces this series of eRNAs via chromatin binding at these enhancers, including FincoR.

We validated FXR binding at the enhancer region that produces FincoR using mouse liver ChIP (Figure 2C). We also examined binding of a well-known DNA binding partner of FXR, Retinoid x Receptor alpha (RXRα/NR2B1) (Evans & Mangelsdorf, 2014; Zheng et al., 2018), and bromodomain-containing protein 4 (BRD4), an acetylated histone reader protein that often binds at active enhancers (Chen et al., 2016; Li et al., 2016; Rahnamoun et al., 2018; Sartorelli & Lauberth, 2020) and is a transcriptional coactivator of FXR (Jung et al., 2020). GW4064 treatment resulted in substantial increases in recruitment of both FXR and RXRα to the enhancer region close to the transcription start site of FincoR (arrow shown below in Figure 2B), whereas binding was not detected at a control region (Figure 2C). We also found that BRD4 occupancy was increased at this enhancer region after GW4064 treatment (Figure 2C). These results indicate that GW4064 activation of FXR leads to increased occupancy of the FXR/RXRα heterodimer and BRD4 to the enhancer region to upregulate FincoR eRNA in the liver.

We identified an inverted repeat1 (IR1) motif that is known to bind FXR (Calkin & Tontonoz, 2012; Lee et al., 2006) within the major FXR binding peak near the start site of FincoR (arrow shown below in Figure 2B), which we also refer to as FXRE (Figure 2B, C). We examined the functionality of this IR1 motif for mediating transcriptional activation by GW4064 using reporter assays (Figure 2D). We cloned the region containing the IR1 motif into the pGL4.23 luciferase reporter and generated a mutated IR1 motif construct as a comparison (Figure 2D). After transfection into human hepatic HepG2 cells, GW4064 treatment significantly elevated the luciferase activity of the reporter with the wild type IR1 motif, but not with the mutated IR1 motif (Figure 2D). Together, these results suggest that GW4064-activated FXR directly upregulates FincoR expression.

FincoR is a liver-specific nucleus-enriched eRNA

Because enhancers and eRNAs generally act in a tissue-specific manner (Li et al., 2016; Sartorelli & Lauberth, 2020), we examined the tissue-specific expression of FincoR in mice. Strikingly, FincoR is highly expressed in the liver and it is expressed at extremely low levels in most other tissues, except for a detectable, but still fairly low, level in the lung (Figure 3A). GW4064 treatment resulted in induction of FincoR specifically in the liver (Figure 3A). The level of FincoR detected in primary mouse hepatocytes (PMHs) isolated from GW4064-treated mouse liver was similar to that in the liver tissue from the same mouse, suggesting that the majority of FincoR is present in hepatocytes (Figure 3B).

Figure 3. FincoR is a liver-specific nucleus-enriched eRNA.

Figure 3.

(A) Expression levels of FincoR in various tissues after GW4064 treatment. Data from C57BL/6 male mice fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1 h (n=2/group). (B) C57BL/6 male mice were fasted overnight and injected i.p. with vehicle or GW4064 (30 mg/kg) for 1 h. One small piece of liver was snap-frozen for later RNA isolation and the remaining part was used for immediate primary hepatocyte isolation. Then, RNAs were extracted from liver or primary hepatocytes and FincoR expression was measured (n=3/group). (C) Agarose gel electrophoresis of PCR products generated in 5′ (left) and 3′ (right) RACE of FincoR in liver samples. Primer locations are shown. RACE, rapid amplification of cDNA ends. GSP: gene specific primer. (D) A schematic diagram showing location of FincoR relative to nearby genes in the mice genome. (E) PhyloCSF analysis of the coding potential of FincoR. (F) In vitro translation of FincoR using the Promega Transcend Non-Radioactive Translation Detection Systems. Luciferase is used as a control for coding RNA. (G) qPCR analysis of FincoR, 36b4 in Poly(A)+ and Poly(A)− RNA fractions from GW4064 treated mouse liver. (H) FincoR identified in the subcellular fractions using cellular fractionation assays. Primary hepatocytes were isolated from GW4064 or DMSO treated mice and the cytoplasm and nucleus fractions of these hepatocytes were separated and both fractions were subjected to RNA extraction and qPCR.

By using the 5’ and 3’ rapid amplification of cDNA ends (RACE), we identified one transcript of FincoR that is of approximately 3.7 kb in length (Figure 3C). However, based on RNA-seq, the length of FincoR is over 10 kb (Figure 1C), suggesting there are likely additional multiple RNA isoforms that we were not able to identify by RACE. We next analyzed the coding potential of FincoR utilizing a comparative genomic program, PhyloCSF. While adjacent genes Gcnt1 and Prune2 (Figure 3D, E) were correctly predicted to encode proteins, FincoR did not contain a potential protein-coding open reading frame (Figure 3E). Consistent with this bioinformatic prediction, a vector expressing FincoR failed to produce any proteins in an in vitro transcription/translation assay (Figure 3F) confirming that the FincoR transcript is a noncoding RNA. FincoR transcripts were enriched by binding to oligo-dT beads, suggesting that FincoR is 3’ polyadenylated (Figure 3G). Further, FincoR was detected in the nuclear compartment and GW4064 treatment increased the nuclear abundance of FincoR (Figure 3H), consistent with its potential transcriptional regulatory function. Together, these results from molecular biochemical characterization studies reveal that FincoR is a liver-enriched nuclear polyadenylated eRNA.

FincoR is induced specifically by the hammerhead-type synthetic FXR agonists

To determine whether induction of the FXR-induced FincoR is ligand-specific, we examined the effects of several hammerhead-type synthetic FXR agonists, including GW4064, cilofexor, and tropifexor; a semi-synthetic agonist, OCA; and a non-hammerhead-type gut-specific agonist, fexaramine (Figure 4A) (Downes et al., 2003; Fang et al., 2015). Remarkably, treatment with each of the hammerhead type agonists for 1 h resulted in a robust induction of FincoR (Figure 4B), whereas FincoR levels were unchanged after treatment with OCA or fexaramine for 1 h (Figure 4B). Treatment with OCA for 4 h or even one-week treatment with OCA failed to induce hepatic FincoR in mice, while expression of Shp was significantly induced (Figure 4C, D). Acute feeding with a diet supplemented with 0.5% cholic acid (CA), a primary BA, for 6 h also failed to induce FincoR expression (Figure 4E). Collectively, these results demonstrate that FincoR is induced specifically by hammerhead-type FXR agonists.

Figure 4. FincoR is induced by the hammerhead class of non-steroidal FXR agonists, including GW4064 and tropifexor.

Figure 4.

(A) The chemical structures of the FXR agonists including the hammerhead class of synthetic FXR agonists, non-hammerhead-type synthetic agonists, semi-synthetic BA and natural BA. BA: bile acid. (B) qPCR data showing FincoR expression levels in C57BL/6 mice liver respectively treated with GW4064 (30 mg/kg), Cilofexor (30 mg/kg), Tropifexor (0.5 mg/kg), Fexaramine (100 mg/kg), or OCA (20 mg/kg) for 1 h (n=3~4/group). (C) FincoR expression levels in C57BL/6 mice liver treated with OCA (20 mg/kg) or Fexaramine (100 mg/kg) for 4 hrs (n=3/group). (D) Expression of FincoR in C57BL/6 mice liver after daily treatment with OCA (20 mg/kg) for 7 days (n=5/group). Shp gene mRNA was measured as a positive control. (E) Expression of FincoR in C57BL/6 mice fed with 0.5% cholic acid (CA) diet for 6 hrs (n=3~4/group). In panels B-E, all mice underwent over-night fasting. (B-E) Data are presented as mean ± SEM. Statistical significance was determined by the Student’s t test with *p < 0.05, **p < 0.01 and ***p < 0.001.

Generation of CRISPR/Cas9-mediated FincoR liver-specific knockdown mice

To explore the functional role of hepatic FincoR, we utilized the CRISPR/Cas9 technique to generate FincoR liver-specific knockdown (FincoR-LKD) mice (Figure 5-figure supplement 1A, B). Adenoviral-mediated sgRNA expression in Cas9 mice resulted in downregulation of FincoR specifically in the liver by about 60%, but not in other tissues (Figure 5B). As FXR is a key regulator of bile acid, cholesterol, lipid, and glucose metabolism and FincoR is specifically regulated by FXR, FincoR may have a role in the metabolic process in physiology and disease. We examined liver triglyceride, cholesterol, bile acid, glycogen and serum non-esterified fatty acids (NEFA) but FincoR downregulation did not result in any significant changes under physiological conditions (Figure 5C).

Figure 5. Generation of CRISPR/Cas9-mediated FincoR liver-specific knockdown mice.

Figure 5.

(A) Experimental scheme: male Cas9 mice were infected with adenovirus expressing sgRNA for FincoR or a control for 1 week. Then the liver and serum were collected from these mice after 4~5 hrs of fasting. (B) The expression of FincoR in the liver was measured by qPCR (n=4/group). (C) Hepatic triglyceride, cholesterol, bile acid, glycogen and serum NEFA were measured (n=5~7/group) (D) Male Cas9 mice were infected with adenovirus expressing sgRNA for FincoR or control for 1 week. Then these mice were fasted overnight and treated with GW4064 for 3 h before tissue collection. RNA-seq profiles of expression of hepatic FincoR and the adjacent genes were shown (n=2/group). (E) Genome-wide changes in mRNA expression shown in a volcano plot. The numbers refer to the number of genes up- or down-regulated by 2-fold or more with an adjusted p-value < 0.01. (F) Gene ontology analysis of biological pathways using DAVID Tools for genes downregulated after FincoR knockdown. (B) Data are presented as mean ± SEM. Statistical significance was determined by the Student’s t test with ***p < 0.001.

To explore the molecular signatures and pathways affected by FincoR, we examined global gene expression by RNA-seq analysis in mouse liver after FincoR knock-down (Figure 5D). While FincoR was markedly downregulated, the neighboring genes, such as Gcnt1, Rfk, Pcsk5 and Prune2, were largely unchanged (Figure 5D; Figure 5-figure supplement 1C). The RNA-seq analysis revealed 18 up-regulated genes and 53 downregulated genes in FincoR-LKD liver (Supplementary Table S4; Figure 5E). GO analysis of those downregulated genes indicated that these genes were enriched in pathways involved in fatty acid oxidation, organelle organization and metabolic process (Figure 5F). Among the down-regulated genes, Ppp1r3g, which has a role in controlling glycogen synthesis, and Igfbp2, which functions in insulin resistance, were markedly reduced (Supplementary Table S4; Figure 5-figure supplement 1D, E). Among the up-regulated genes, expression was substantially increased for Eda2r, which is a member of the tumor necrosis factor receptor superfamily and is involved in inflammation, the immune response, and development (Figure 5-figure supplement 1F). Fndc1, which is involved in fibronectin matrix remodeling, was also suppressed by FincoR (and thus upregulated upon its KO, Figure 5-figure supplement 1G). These studies suggest that FincoR has a role in modulating metabolic homeostasis by regulating genes involved in metabolism and inflammation.

Amelioration of hepatic steatosis mediated by tropifexor is independent of FincoR in diet-induced NASH mice

Tropifexor, also known as LJN452, is a highly potent hammerhead type FXR agonist that is currently under clinical trials for NASH and PBC patients (Kremoser, 2021; Sanyal et al., 2023; Tully et al., 2017). Because FincoR is induced specifically by the hammerhead class of FXR agonist (Figure 4) and has a potential role in the regulation of metabolism and inflammation (Figure 5), we hypothesized that FincoR may play a role in tropifexor-mediated beneficial effects on reducing NASH pathologies in mice.

We utilized a mouse model that had been fed the Amylin Liver NASH-promoting (AMLN) diet (Hernandez et al., 2019; Sun et al., 2022; Zhao et al., 2018), and examined the potential impact of liver-specific downregulation of FincoR on tropifexor’s effects on NASH pathology. Cas9 mice fed the AMLN diet for 12 weeks were injected via tail veins with adenovirus expressing control sgRNA or FincoR sgRNA, respectively, and then treated daily with tropifexor (0.3 mg/kg) for 12 days (Figure 6A). In these mice, as a technical validation of RNA induction and knockdown, FincoR levels were significantly increased by FXR agonist tropifexor, and the increase was blocked by adenovirus expressing sgRNA for FincoR (Figure 6B).

Figure 6. In diet-induced NASH mice, tropifexor-mediated beneficial effects on reducing hepatic steatosis are largely independent of FincoR.

Figure 6.

(A-E) Male Cas9 mice were fed a NASH diet for 12 weeks. The mice were randomly assigned to 3 groups and infected with adenovirus expressing sgRNA for FincoR or control. Three days later, the mice were treated with tropifexor (0.3 mg/kg) or vehicle for 12 days. The mice were administered tropifexor or vehicle and fasted for 4 h before tissues were collected. (A) Experimental scheme. (B) Hepatic FincoR expression was measured (n=6~7/group). (C) Oil Red O staining of liver sections. Scale bar (50 μm). Image analyses were done using Image J and the areas of stained field were quantified (n=5/group) (D) Hepatic TG, hepatic cholesterol, gallbladder BA and hepatic BA levels were measured (n=6~7/group). (E) mRNA levels in the liver of the indicated genes involved in bile acid regulation and lipid regulation (n=6~7/group). (B, D and E) Data are presented as mean ± SEM. Statistical significance was determined by the one-way ANOVA (Sidak’s multiple comparisons test) with *p < 0.05, **p < 0.01 and ***p < 0.001. Ad, adenovirus; H & E, hematoxylin and eosin; TG, triglyceride; Veh, vehicle; ns, not significant.

We then examined the effect of tropifexor treatment and FincoR downregulation on hepatic steatosis in these mice. Tropifexor treatment markedly reduced neutral lipids determined by Oil Red O staining of liver sections (Figure 6C) and liver TG levels (Figure 6D), and these beneficial effects on reducing fatty liver were not altered by FincoR downregulation. Also, FincoR downregulation had little effect on liver cholesterol and gallbladder BA levels, although gallbladder BA levels were reduced by tropifexor (Figure 6D).

Consistent with the phenotypes, hepatic expression of key genes involved in BA synthesis was dramatically reduced by tropifexor treatment (i.e., Cyp7a1 and Cyp8b1), which is consistent with decreased gallbladder BA levels mediated by this agonist (Figure 6E). Similarly, tropifexor also lowered lipid synthesis genes (Srebp1c, Lpin1, Scd1), consistent with decreased liver TG levels. However, downregulation of FincoR did not result in changes in mRNA levels of these genes (Figure 6E). These results indicate that tropifexor-mediated beneficial effects on reducing hepatic steatosis are independent of FincoR.

FincoR facilitates alleviation of liver inflammation by tropifexor in diet-induced NASH

Tropifexor ameliorated fibrotic NASH pathologies in preclinical studies (Hernandez et al., 2019; Tully et al., 2017) and has recently concluded phase 2 clinical trials for NASH patients (Sanyal et al., 2023). We, therefore, further examined the effects of FincoR downregulation on altering other NASH pathologies, including hepatocellular apoptosis, liver fibrosis and inflammation.

In the same AMLN diet-fed mice as described above (Figure 6), analyses of liver sections revealed that tropifexor treatment reduced hepatocyte swelling/ballooning (H&E staining), decreased numbers of apoptotic cells (TUNEL staining), alleviated fibrosis (Sirius red staining), and lowered infiltration of macrophages (F4/80 staining) (Figure 7A). Remarkably, these tropifexor-mediated beneficial effects on NASH pathologies were all markedly diminished by FincoR downregulation (Figure 7A). This was consistently found in various liver lobes and two representative pictures from two different lobes are shown (Figure 7A). In control experiments, FincoR downregulation in vehicle-treated mice did not result in marked changes in NASH pathologies (Figure 7-figure supplement 1). These results demonstrate that FincoR is required for tropifexor-mediated beneficial effects on reducing NASH pathologies, specifically reducing hepatic inflammation, fibrosis and hepatocyte apoptosis. Consistent with these results, serum ALT and AST levels, indicators of liver damage, were significantly elevated after FincoR downregulation (Figure 7B). Protein levels of key inflammatory markers, IL1β and CCL2, in liver extracts were also elevated after FincoR downregulation (Figure 7C).

Figure 7. In diet-induced NASH mice, tropifexor-mediated beneficial effects on reducing liver fibrosis and inflammation are diminished by FincoR downregulation.

Figure 7.

(A) Representative images from H & E, F4/80, Sirius Red and TUNEL staining of liver sections from the same cohort of mice described in Figure 6. Scale bar (50 μm). Image analyses were done using Image J and the area of collagen staining, TUNEL and F4/80 levels were quantified (n=5/group). (B) Serum ALT and AST levels were measured (n=5/group). (C) IL-1β and CCL2 levels in the liver tissues were determined by ELISA (n=5/group). (D) mRNA levels in the liver of the indicated genes involved in inflammation, fibrosis and cell death (n=5/group). (E) Model: FincoR is a liver-enriched eRNA that is induced specifically by hammerhead-type FXR agonists (top). In diet-induced NASH mice, FincoR is required for tropifexor-mediated beneficial effects on reducing hepatic inflammation, fibrosis, and cell death with the mechanisms to be determined (bottom). (A-D) Data are presented as mean ± SEM. Statistical significance was determined by the one-way ANOVA (Sidak’s multiple comparisons test) with *p < 0.05, **p < 0.01 and ***p < 0.001.

Consistent with the phenotypes from histological analyses, hepatic expression of fibrosis and inflammation was altered by FincoR knockdown. For example, tropifexor treatment reduced mRNA levels of several genes that promote fibrosis (Col1a1, Col1a2, Acta2) and hepatic inflammation (Eda2r, Ifng, Ccl3), whereas these reductions were largely reversed by FincoR downregulation (Figure 7D). We also detected increased expression of inflammatory genes (Ccl2, Ccr2, Lcn2) and an extracellular matrix remodeling gene (Fndc1) in liver with FincoR knockdown (Figure 7D). Tropifexor treatment suppresses hepatic apoptosis by reducing pro-apoptotic genes (Ctsb, Ctss) and upregulating anti-apoptotic genes such as Bcl2 (Warren et al., 2019). Importantly, these effects were significantly reversed by FincoR downregulation (Figure 7D).

Collectively, these results demonstrate that in diet-induced NASH mice, pharmacological activation of FXR by tropifexor reduced fibrosis, apoptosis, and inflammation, which was dependent, at least in part, on the induction of FincoR.

FincoR expression is increased in chronic liver disease with hepatic inflammation and liver injury

To determine whether expression of FincoR is altered in chronic liver disease, we utilized mouse models of NAFLD/NASH and cholestatic liver injury. Hepatic FincoR levels were significantly increased in mice fed with a high fat diet (HFD) for 12 weeks (Supplementary Figure S1A) and in mice fed a HFD with high fructose (HFHF) in drinking water for 12 weeks (Supplementary Figure S1B). Elevated hepatic FincoR levels were also observed in mice treated with α-naphthylisothiocyanate (ANIT), a chemical inducer of liver cholestasis (Jung et al., 2020; Kim et al., 2016) (Supplementary Figure S1C), and in mice with bile duct ligation (BDL), a surgical method to induce cholestatic liver injury (Supplementary Figure S1D).

The sequence of FincoR is moderately conserved between mice and humans as displayed in the UCSC genome browser (Supplementary Figure S1E). Annotation in the NCBI genome data viewer of the human sequence region with similarity to mouse FincoR revealed an functionally uncharacterized human lncRNA, XR_007061585.1, in this region (Supplementary Figure S1F). However, whether this sequence (or an as yet to be identified lncRNA) is functional or not has not been determined. To explore the potential changes or role of lncRNA XR_007061585.1 in human liver pathological conditions, we measured hepatic levels of the transcripts in PBC and NAFLD patients. Compared to normal individuals, hepatic lncRNA XR_007061585.1 levels were elevated in patients with PBC or NAFLD, but not in severe NASH-fibrosis patients (Supplementary Figure S1G, H). These results demonstrate that hepatic levels of a potential human analog of FincoR are elevated in NAFLD and PBC patients, as FincoR is in mouse models of chronic liver disease with hepatic inflammation and liver injury. However, whether human lncRNA XR_007061585.1 is analogous to mouse FincoR in terms of functions and mechanisms, and whether elevated XR_007061585.1 levels may have a role in the disease progression or may be an adaptive response to liver injury remains to be determined.

Discussion

FXR maintains metabolic homeostasis by transcriptional regulation of genes. Direct regulation of protein-coding genes by FXR, including Shp, is well characterized. In this study we show that FXR also mediates its functions by induction of lncRNA genes, which vastly outnumber protein-coding genes. We further show that pharmacological activation of FXR by hammerhead-type agonists induces a liver-specific enhancer-derived lncRNA, which we named FincoR, that contributes to reduction of NASH pathologies in mice.

FincoR is specifically induced by the hammerhead class of FXR agonists, such as GW4064, cilofexor, and tropifexor. GW4064 is the mother compound of these isoxazole-type hammerhead ligands but is not an ideal therapeutic agent because of its poor water solubility and pharmacokinetics (Abel et al., 2010). In contrast, tropifexor and cilofexor have better pharmacokinetics and are generally well-tolerated in clinical trials for NASH and PBC patients (Abenavoli et al., 2018; Kremoser, 2021; Sanyal et al., 2023; Tully et al., 2017), but the underlying mechanisms for their beneficial effects are poorly understood. Intriguingly, a recent study showed that the gene signature regulated by tropifexor-activated FXR appears to be broader than that of OCA, partly because the tropifexor backbone allows a more favorable interaction of FXR with coactivators or epigenomic modulators (Hernandez et al., 2019). Further, tropifexor was shown to regulate distinct sets of genes in experimental NASH as compared to other FXR agonists, particularly genes involved in fibrosis, inflammation, and oxidative stress (Hernandez et al., 2019). Utilizing CRISPR/Cas9-mediated liver-specific knockdown of FincoR in diet-induced NASH mice, we demonstrate that beneficial effects on reducing liver fibrosis, inflammation, and apoptosis mediated by tropifexor were largely dependent on FincoR (Model, Figure 7E).

While this study focused on regulation of FincoR by pharmacological activation of FXR, physiological and pathological regulations of FincoR appear to be complex. Although FincoR can be induced by the hammerhead class of FXR agonists, it was not induced by the endogenous FXR ligand, cholic acid. This implies that FincoR may not contribute to the physiological functions of FXR. In an effort to investigate the potential role of FincoR in the pathological conditions, we observed that FincoR levels were elevated in mouse models of cholestasis and NASH as well as in human PBC and NAFLD patients, where BA metabolism is dysregulated. Since different BAs can activate or repress the gene-regulating function of FXR (Wahlstrom et al., 2016), altered BA composition in these pathological conditions may contribute to induction of FincoR. Further, binding peaks for multiple nuclear receptors, FXR, LXR, PPARα, RXRα, and HNF-4α, were detected in the FincoR locus so that regulation of FincoR likely involves the combinatorial regulation by multiple nuclear receptors (Supplementary Figure S2). Interestingly, occupancy of the nuclear receptor PPARα at the enhancer region was increased in fasted mice (Supplementary Figure S3). It will be interesting to investigate whether and how FincoR is differently regulated by these nuclear receptors in response to physiological and pathological cues.

The roles of regulatory RNAs in liver function and diseases and their potentials as therapeutic targets are increasingly being appreciated (Brocker et al., 2020; Li et al., 2021; Sallam et al., 2016; Zhao et al., 2018). For example, a critical role for an oxysterol nuclear receptor LXR-induced lncRNA, LeXis, in feedback modulation of cholesterol biosynthesis has been shown (Sallam et al., 2016). Recently, the role of a lncRNA, Pair, in liver phenylalanine metabolism has been demonstrated (Li et al., 2021). Enhancer RNAs are a less characterized class of lncRNAs and are highly associated with enhancer functions in gene regulation (Li et al., 2016). Numerous studies have revealed transcriptional roles for eRNAs in various cellular processes (Lai & Shiekhattar, 2014; Lam et al., 2014; Li et al., 2016; Sartorelli & Lauberth, 2020) but most previous eRNA studies have used cultured cells (Hsieh et al., 2014; Li et al., 2013), with only a few in vivo studies in mouse models (Mirtschink et al., 2019; Tang et al., 2023). In our current study, through integrative analysis of transcriptome and histone mark ChIP-Seq, we identified a group of FXR-regulated eRNAs, including the highly induced FincoR. Our current work characterized the role of FincoR in gene regulation and in mediating beneficial pharmacological effects of tropifexor in NASH, representing important progress in understanding the roles of eRNAs in vivo. Future work is warranted to elucidate the exact mechanisms by which FincoR facilitates action of FXR agonists to alleviate inflammation, fibrosis and apoptosis.

RNA inside the cells usually associates with different RNA-binding proteins (RBPs) (Gerstberger et al., 2014). We identified potential binding proteins of FincoR using the ATtRACT database (Giudice et al., 2016). The top four candidates for FincoR binding are KHDRBS1, RBM38, YBX2 and YBX3 (Supplemental Table S5). KHDRBS1 and RBM38 have been reported to have important roles in RNA processing (Bielli et al., 2011; Zou et al., 2021). YBX2 and YBX3 belong to the Y-box (YBX) protein family, which have been linked to diverse forms of RNA metabolism and many other processes, including cell proliferation, DNA repair, stress responses, development, and inflammation (Kleene, 2018). Whether these predicted RBPs interact with FincoR and how they contribute to phenotypes should be investigated in future experimentation to understand the mechanisms involved in FincoR-regulated hepatocyte function.

There is limitation of some of our approaches that cannot fully dissect the underlying mechanisms of FincoR. Currently, the function of eRNA loci can be attributed to a functional eRNA transcript, or binding of transcription factors to this region, or the transcription process itself, or some combination of these effects (Li et al., 2016; Sartorelli & Lauberth, 2020). In our studies to decrease expression of FincoR, the region containing the FXR binding site was deleted (Figure 5-figure supplement 1A, right panel). While the expression of FincoR transcripts was significantly reduced, we cannot rule out whether decreased binding of FXR or decreased transcription contribute to the observed changes in phenotype. To directly investigate the function of FincoR transcripts, downregulation of the transcript with antisense oligonucleotides together with overexpression of FincoR in the liver will be required in future experiments.

FXR is increasingly recognized as an important therapeutic target for enterohepatic diseases, but the development of clinically applicable and more targeted FXR-based therapy is still challenging. In this study, we provided the first characterization of an eRNA, FincoR, induced by pharmacological activation of FXR and show that FincoR has a beneficial role in reducing liver fibrosis and inflammation in dietary NASH mice. Complete understanding of the function and mechanisms of FincoR may provide novel insights for the development of desirable therapy for NASH and other chronic liver diseases.

Materials and Methods

Animal experiments

All animal studies were performed according to procedures approved by the Institutional Animal Care & Use Committee at the University of Illinois at Urbana-Champaign and were in accordance with National Institutes of Health guidelines. Mice were maintained in 12/12 h light/dark cycles and fed standard rodent chow. FXR-LKO mice were generated by breeding FXR floxed mice with Albumin-Cre mice (The Jackson Lab). FincoR-LKD mice were generated as previously reported (Zhao et al., 2018). Briefly, Cas9 transgenic mice (JAX #024858) were injected via the tail vein with adenoviruses (approximately 5×108 PFU) expressing two sgRNAs targeting FincoR (sgRNA1: GGGTTAAGAGCTGTAGGCTG and sgRNA2: ACTTCTATGTCCAACAACCG). The sequences of sgRNAs were designed using a CRISPR design tool (http://crispr.mit.edu/).

Mice were given a single dose of vehicle or 30 mg/kg GW4064 (in corn oil, Tocris Bioscience, #2473) after overnight fasting. Mice were treated with 0.5 mg/kg tropifexor (in corn oil, MedChem Express, HY-107418), 30 mg/kg cilofexor (in corn oil, MedChemExpress, HY-109083), 100 mg/kg fexaramine (in 0.5% methylcellulose, MedChem Express, HY-10912), and 20 mg/kg OCA (in 0.5% methylcellulose, MedChem Express, HY-12222) as indicated. C57BL6 mice were fed with a chow diet containing 0.5% CA for 6 h (Jung et al., 2020).

To induce cholestasis, mice were treated by gavage with 75 mg/kg α-naphthyl isothiocyanate (ANIT) for 48 hours as previously reported (Jung et al., 2020; Kim et al., 2016; Kim et al., 2020). Cholestasis was also induced by bile duct ligation or sham operation in mice for 24 hours or 72 hours (Li et al., 2018).

To induce dietary obesity, mice were fed a high-fat diet (TD88137; Harlan Teklad) or a high-fat diet with 25% fructose in water (high fat/high fructose) for 12 weeks (Seok et al., 2021).

To investigate the effect of liver-specific downregulation of FincoR on NASH, male Cas9 mice were fed the AMLN diet (Research Diets, D09100310, 40 kcal% fat, 2% cholesterol, 20 kcal% fructose) for 12 weeks and then, were injected with adenovirus expressing control sgRNA or sgRNA targeting FincoR. Administration of tropifexor was started 3 days later and given at 0.3 mg/kg dissolved in corn oil.

RNA-Seq

C57BL/6 mice were fasted overnight and i.p. injected with vehicle or GW4064 (30 mg/kg) for 1 h, and livers were collected (n = 4 mice for either vehicle or treated group). Total RNA from each liver was extracted by RNeasy kit (Qiagen), and two randomly selected mice liver RNAs were pooled for RNA-seq (two RNA-seq reactions from 4 mice livers for either vehicle or treated group). RNA-seq was performed as previously described (Byun et al., 2018; Byun et al., 2020; Seok et al., 2018). Ribosomal RNA was removed with the Ribozero HMR Gold kit (Illumina). The sequencing library was generated following methods described below.

Construction of strand-specific RNAseq libraries

Construction of the RNAseq libraries and sequencing on the Illumina NovaSeq 6000 were performed at the Roy J. Carver Biotechnology Center at the University of Illinois at Urbana-Champaign. After DNase digestion, purified total RNAs were analyzed on a Fragment Analyzer (Agilent) to evaluate RNA integrity. The total RNAs were converted into individually barcoded polyadenylated mRNAseq libraries with the Kapa HyperPrep mRNA kit (Roche). Libraries were barcoded with Unique Dual Indexes (UDI’s) which have been developed to prevent index switching. The adaptor-ligated double-stranded cDNAs were amplified by PCR for 8 cycles with the Kapa HiFi polymerase (Roche). The final libraries were quantitated with Qubit (Thermo Fisher) and the average cDNA fragment sizes were determined on a Fragment Analyzer. The libraries were diluted to 10 nM and further quantitated by qPCR on a CFX Connect Real-Time qPCR system (Bio-Rad) for accurate pooling of barcoded libraries and maximization of number of clusters in the flowcell.

Sequencing of libraries in the NovaSeq

The barcoded RNAseq libraries were loaded on one SP lane on a NovaSeq 6000 for cluster formation and sequencing. The libraries were sequenced from one end of the fragments for a total of 100 bp. The fastq read files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina, San Diego, CA). The quality of the demultiplexed fastq files was evaluated with the FastQC software, which generates reports with the quality scores, base composition, k-mer, GC and N contents, sequence duplication levels and overrepresented sequences.

GRO-seq

To harvest the nuclei from mouse liver cells, the liver was harvested at indicated time and washed with a cold swelling buffer (10 mM Tris-HCl, pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 2 U/ml Superase-In). The nuclei were prepared by Dounce homogenization in cold swelling buffer and filtered using a cell strainer (100 μm, BD Biosciences). Nuclei were collected by centrifugation at 400 × g for 10 min, then resuspended in the lysis buffer (swelling buffer with 10% glycerol and 1% IGEPAL) and incubated on ice for 5 min. Nuclei were washed twice with the lysis buffer and resuspended at a concentration of 108 nuclei/ml in the freezing buffer (50 mM Tris-HCl, pH 8.3, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA). We then followed our previous method (Li et al., 2013; Oh et al., 2021) to conduct nuclear run-on and GRO-Seq library preparation. Briefly, the nuclei in freezing buffer were subjected to the nuclear run-on reaction by mixing with an equal volume of run-on buffer (10 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 1 mM dithiothreitol (DTT), 300 mM KCl, 20 units of Superase-In, 1% sarkosyl, 500 μM ATP, GTP, Br-UTP and 2 μM CTP) for 5 min at 30 °C. The BrU-labeled run-on RNAs were extracted by TRIzol and purified by anti-BrdU agarose beads (Santa Cruz Biotech, sc-32323 AC). The run-on RNAs were then subjected to end repair by T4 PNK, poly-adenylation, and then to cDNA first strand synthesis by a custom primer (oNTI223) that allows circularization of the cDNA. This cDNA then was re-linearized by Ape1 (NEB), size selected by TBE gel electrophoresis and the products of the desired size were excised (~320–350 bp) for final library prep and sequencing. GRO-Seq samples were run on a NextSeq 500 sequencer from Illumina with a single-end 80 nt model.

Histological analyses

For histology, tissues were dissected and immediately fixed in 10% formalin overnight and processed for paraffin embedding and H&E staining. Paraffin-embedded liver sections were incubated with F4/80 antibody, and antibody was detected using a peroxidase-based method (Abcam, ab64238). Liver collagen was detected by Sirius Red staining (Abcam, ab246832) and apoptosis was detected by TUNEL staining (Millipore, S7100). For Oil Red O staining, liver tissue was frozen in OCT compound (Sakura Finetek, 4583), sectioned, and stained. Liver sections were imaged with a NanoZoomer Scanner (Hamamatsu) and quantification was done using NIH ImageJ.

Metabolic analyses

Hepatic levels of TG (Sigma, MAK266), cholesterol (Sigma, MAK043), glycogen (Biovision, K646–100), total BA levels (Diazyme, DZ042A), serum NEFA (Sigma, MAK044), serum ALT (Sigma, MAK052) and serum AST (Sigma, MAK055) were determined according to the manufacturer’s instructions. Mouse liver IL-1β (R&D systems, MLB00C) and CCL2 (R&D systems, DY479–05) were detected by commercially available ELISA kit.

Liver samples of PBC and NAFLD patients.

Liver specimens from normal organ donors, and patients with PBC or NAFLD were obtained from the Liver Tissue Procurement and Distribution System. The samples were unidentifiable, and thus, ethical approval was not required. Hepatic XR_007061585.1 levels were measured by qPCR.

Mouse liver ChIP

Liver ChIP assay was performed as described previously (Jung et al., 2020; Seok et al., 2018). Briefly, chromatin extracts were prepared from FXR floxed and FXR-LKO mouse livers after treatment of the mice with GW4064 which was followed by preclearing and immunoprecipitation using control IgG or FXR antibody (Novus Biologicals, NBP2–16550; Santa Cruz, sc-25309), RXRα antibody (Proteintech, catalog no. 21218-1-AP), or BRD4 antibody (Bethyl Laboratories, catalog #A301–985A50). Enrichment in chromatin precipitates of gene sequences was measured by qRCR using primers listed (Supplementary Table S6).

Primary mouse hepatocytes and HepG2 cells

Primary hepatocytes were isolated from C57BL/6 mice by collagenase (Worthington Biochemical Corporation, LS004188) perfusion and maintained in William’s E Medium with primary hepatocyte maintenance supplements (Gibco #CM4000) in six-well plates as described previously (Jung et al., 2020; Kim et al., 2015). HepG2 cells were maintained in DMEM supplemented with 10% fetal bovine serum at 37°C and 5% CO2.

Luciferase reporter assay

The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well) and RXRα (5 ng/well) in combination with reporters containing the wild type FXRE or mutated FXRE (200 ng/well) (Supplementary Table S6). β-galactosidase plasmid (200 ng/well) was also transfected as an internal control. Cells were treated with GW4064 or DMSO after transient transfection. Six hours later, the cells were harvested. All reporter assays were repeated at least three times in triplicates.

RACE

5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions. The resulting PCR products were separated by electrophoresis in agarose gels and cloned into the pRACE vector provided by the kit. The transcription start sites and end sites of FincoR were determined by sequencing. The gene-specific primers used for 5’- and 3’-RACE are listed in Supplementary Table S6.

In vitro transcription and translation (TNT)

Expression plasmids for luciferase and FincoR were mixed with a Coupled Reticulocyte Lysate System (Promega). After incubating at 30°C for 60 min, translated products were separated on 4–20% gradient SDS polyacrylamide gels and transferred to PVDF membranes. Chemiluminescent detection of in vitro translated protein was performed following the manufacturer’s protocol (Promega).

RT-qPCR

Total RNA was extracted using the RNeasy Mini Kit (Qiagen, 74104) and 2 μg of RNA was reverse transcribed and mRNA expression was normalized relative to that of 36B4. The qPCR primers are shown in Supplementary Table S6.

Subcellular fractionation

Using a Cytoplasmic and Nuclear RNA Purification Kit (Norgen, Thorold, ON, Canada), the cytoplasm and nucleus fractions from primary hepatocytes isolated from livers of mice treated with GW4064 or DMSO were separated, and both fractions were subjected to RNA extraction and qRT-PCR.

Immunoblotting analysis

Total liver lysates were prepared as described before (Sun et al., 2022). Antibodies for immunoblotting for β-ACTIN (#4970) were purchased from Cell Signaling Technology. Antibodies for immunoblotting for FXR (sc-25309) were purchased from Santa Cruz.

FincoR polyadenylation study

Total RNA was prepared using the RNeasy mini prep kit (Qiagen). Poly(A)+ and poly(A)− RNA was separated using a Dynabeads mRNA Purification Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. Briefly, total RNA was incubated with the Dynabeads/binding buffer suspension at room temperature for 5 min and the reaction tubes were placed on a magnet until solution was clear. The supernatant containing poly(A)− RNA was saved. The beads with poly(A)+ RNA were washed three times with washing buffer provided by the kit. RNA was extracted from the supernatant and beads respectively using Trizol. qPCR was performed to analyze levels of FincoR and 36b4 in the poly(A)+ and poly(A)− RNA fractions.

Genomics Analysis

RNA-Seq and GRO-Seq reads were mapped to the mouse reference genome mm10 with STAR aligner (Dobin et al., 2013). Transcript quantifications were done with the HOMER tool set (Heinz et al., 2010) and enhancer RNAs were identified based on H3K27ac ChIP-Seq in mouse liver. Briefly, intergenic H3K27ac ChIP-Seq peaks were selected as putative enhancer regions in mouse liver. Then +/− 3kb regions around putative enhancers with RNA-Seq signal (>1 RPKM) were considered as putative eRNAs in mouse livers. Overlapped eRNAs regions were merged, and redundant ones were removed. In addition, any +/− 3kb extended eRNAs regions that overlapped with protein-coding genes were further removed to avoid transcriptional readthrough from genes. We used DESeq2 (Love et al., 2014) to identify significantly regulated eRNAs with a cutoff of (FDR < 0.05, Log2FC > 1). Public ChIP-Seq datasets were obtained from ENCODE or GEO (Supplementary Table S3).

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9. Statistical differences were evaluated using the two-tailed unpaired Student’s t-test for comparisons between two groups, or ANOVA and appropriate post hoc analyses for comparisons of more than two groups. Statistical methods and corresponding p values for data shown in each panel are indicated in figure legends.

Supplementary Material

Supplement 1

Acknowledgments

We thank Deepa Prakashini Govindasamy Rajagopal for the help with tissue genotyping. We thank Tiangang Li at University of Oklahoma for providing bile-duct ligated mouse liver samples, and Kristina Schoonjans at Ecole Polytech, Switzerland, for providing FXR floxed mice. We also thank the Liver Tissue Cell Distribution System, University of Minnesota (NIH Contract # HHSN276201200017C), for providing liver specimens of NAFLD and PBC patients and individuals without liver disease. This study was supported by an American Diabetes Association Postdoctoral Fellowship to J.C. (1-19-PDF-117), and by a John and Rebekah Harper Fellowship to R.W. W.L. is a Cancer Prevention and Research Institute of Texas (CPRIT) Scholar (RR160083). This work is supported by funding from NIH (K22CA204468 and R01GM136922), and Welch Foundation (AU-2000-20220331) to W.L., and grants from the NIH (R01 DK062777 and R01 DK095842) to J.K.K.

Data availability

RNA-seq and Gro-seq data were deposited in GEO under the following accession numbers GSE 221986.

References

  1. Abel U., Schluter T., Schulz A., Hambruch E., Steeneck C., Hornberger M., Hoffmann T., Perovic-Ottstadt S., Kinzel O., Burnet M., Deuschle U., & Kremoser C. (2010). Synthesis and pharmacological validation of a novel series of non-steroidal FXR agonists. Bioorg Med Chem Lett, 20(16), 4911–4917. 10.1016/j.bmcl.2010.06.084 [DOI] [PubMed] [Google Scholar]
  2. Abenavoli L., Falalyeyeva T., Boccuto L., Tsyryuk O., & Kobyliak N. (2018). Obeticholic Acid: A New Era in the Treatment of Nonalcoholic Fatty Liver Disease. Pharmaceuticals (Basel), 11(4). 10.3390/ph11040104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ali A. H., Carey E. J., & Lindor K. D. (2015). Recent advances in the development of farnesoid X receptor agonists. Ann Transl Med, 3(1), 5. 10.3978/j.issn.2305-5839.2014.12.06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bielli P., Busa R., Paronetto M. P., & Sette C. (2011). The RNA-binding protein Sam68 is a multifunctional player in human cancer. Endocr Relat Cancer, 18(4), R91–R102. 10.1530/ERC-11-0041 [DOI] [PubMed] [Google Scholar]
  5. Brocker C. N., Kim D., Melia T., Karri K., Velenosi T. J., Takahashi S., Aibara D., Bonzo J. A., Levi M., Waxman D. J., & Gonzalez F. J. (2020). Long non-coding RNA Gm15441 attenuates hepatic inflammasome activation in response to PPARA agonism and fasting. Nat Commun, 11(1), 5847. 10.1038/s41467-020-19554-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Byun S., Kim D. H., Ryerson D., Kim Y. C., Sun H., Kong B., Yau P., Guo G., Xu H. E., Kemper B., & Kemper J. K. (2018). Postprandial FGF19-induced phosphorylation by Src is critical for FXR function in bile acid homeostasis. Nat Commun, 9(1), 2590. 10.1038/s41467-018-04697-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Byun S., Seok S., Kim Y. C., Zhang Y., Yau P., Iwamori N., Xu H. E., Ma J., Kemper B., & Kemper J. K. (2020). Fasting-induced FGF21 signaling activates hepatic autophagy and lipid degradation via JMJD3 histone demethylase. Nat Commun, 11(1), 807. 10.1038/s41467-020-14384-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Calkin A. C., & Tontonoz P. (2012). Transcriptional integration of metabolism by the nuclear sterol-activated receptors LXR and FXR. Nat Rev Mol Cell Biol, 13(4), 213–224. 10.1038/nrm3312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cech T. R., & Steitz J. A. (2014). The noncoding RNA revolution-trashing old rules to forge new ones. Cell, 157(1), 77–94. 10.1016/j.cell.2014.03.008 [DOI] [PubMed] [Google Scholar]
  10. Chen J., Wang Z., Hu X., Chen R., Romero-Gallo J., Peek R. M. Jr., & Chen L. F. (2016). BET Inhibition Attenuates Helicobacter pylori-Induced Inflammatory Response by Suppressing Inflammatory Gene Transcription and Enhancer Activation. J Immunol, 196(10), 4132–4142. 10.4049/jimmunol.1502261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Claudel T., Staels B., & Kuipers F. (2005). The Farnesoid X receptor: a molecular link between bile acid and lipid and glucose metabolism. Arterioscler Thromb Vasc Biol, 25(10), 2020–2030. 10.1161/01.ATV.0000178994.21828.a7 [DOI] [PubMed] [Google Scholar]
  12. Dobin A., Davis C. A., Schlesinger F., Drenkow J., Zaleski C., Jha S., Batut P., Chaisson M., & Gingeras T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29(1), 15–21. 10.1093/bioinformatics/bts635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Downes M., Verdecia M. A., Roecker A. J., Hughes R., Hogenesch J. B., KastWoelbern H. R., Bowman M. E., Ferrer J. L., Anisfeld A. M., Edwards P. A., Rosenfeld J. M., Alvarez J. G., Noel J. P., Nicolaou K. C., & Evans R. M. (2003). A chemical, genetic, and structural analysis of the nuclear bile acid receptor FXR. Mol Cell, 11(4), 1079–1092. 10.1016/s1097-2765(03)00104-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Evans R. M., & Mangelsdorf D. J. (2014). Nuclear Receptors, RXR, and the Big Bang. Cell, 157(1), 255–266. 10.1016/j.cell.2014.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fang B., Everett L. J., Jager J., Briggs E., Armour S. M., Feng D., Roy A., Gerhart-Hines Z., Sun Z., & Lazar M. A. (2014). Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo. Cell, 159(5), 1140–1152. 10.1016/j.cell.2014.10.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fang S., Suh J. M., Reilly S. M., Yu E., Osborn O., Lackey D., Yoshihara E., Perino A., Jacinto S., Lukasheva Y., Atkins A. R., Khvat A., Schnabl B., Yu R. T., Brenner D. A., Coulter S., Liddle C., Schoonjans K., Olefsky J. M., . . . Evans R. M. (2015). Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance. Nat Med, 21(2), 159–165. 10.1038/nm.3760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Friedman S. L., Neuschwander-Tetri B. A., Rinella M., & Sanyal A. J. (2018). Mechanisms of NAFLD development and therapeutic strategies. Nat Med, 24(7), 908–922. 10.1038/s41591-018-0104-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gerstberger S., Hafner M., & Tuschl T. (2014). A census of human RNA-binding proteins. Nat Rev Genet, 15(12), 829–845. 10.1038/nrg3813 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Giudice G., Sanchez-Cabo F., Torroja C., & Lara-Pezzi E. (2016). ATtRACT-a database of RNA-binding proteins and associated motifs. Database (Oxford), 2016. 10.1093/database/baw035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Goodwin B., Jones S. A., Price R. R., Watson M. A., McKee D. D., Moore L. B., Galardi C., Wilson J. G., Lewis M. C., Roth M. E., Maloney P. R., Willson T. M., & Kliewer S. A. (2000). A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell, 6(3), 517–526. 10.1016/s1097-2765(00)00051-4 [DOI] [PubMed] [Google Scholar]
  21. Heinz S., Benner C., Spann N., Bertolino E., Lin Y. C., Laslo P., Cheng J. X., Murre C., Singh H., & Glass C. K. (2010). Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell, 38(4), 576–589. 10.1016/j.molcel.2010.05.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hernandez E. D., Zheng L., Kim Y., Fang B., Liu B., Valdez R. A., Dietrich W. F., Rucker P. V., Chianelli D., Schmeits J., Bao D., Zoll J., Dubois C., Federe G. C., Chen L., Joseph S. B., Klickstein L. B., Walker J., Molteni V., . . . Laffitte B. (2019). Tropifexor-Mediated Abrogation of Steatohepatitis and Fibrosis Is Associated With the Antioxidative Gene Expression Profile in Rodents. Hepatol Commun, 3(8), 1085–1097. 10.1002/hep4.1368 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hirabayashi S., Bhagat S., Matsuki Y., Takegami Y., Uehata T., Kanemaru A., Itoh M., Shirakawa K., Takaori-Kondo A., Takeuchi O., Carninci P., Katayama S., Hayashizaki Y., Kere J., Kawaji H., & Murakawa Y. (2019). NET-CAGE characterizes the dynamics and topology of human transcribed cis-regulatory elements. Nat Genet, 51(9), 1369–1379. 10.1038/s41588-019-0485-9 [DOI] [PubMed] [Google Scholar]
  24. Hon C. C., Ramilowski J. A., Harshbarger J., Bertin N., Rackham O. J., Gough J., Denisenko E., Schmeier S., Poulsen T. M., Severin J., Lizio M., Kawaji H., Kasukawa T., Itoh M., Burroughs A. M., Noma S., Djebali S., Alam T., Medvedeva Y. A., . . . Forrest A. R. (2017). An atlas of human long non-coding RNAs with accurate 5’ ends. Nature, 543(7644), 199–204. 10.1038/nature21374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hsieh C. L., Fei T., Chen Y., Li T., Gao Y., Wang X., Sun T., Sweeney C. J., Lee G. S., Chen S., Balk S. P., Liu X. S., Brown M., & Kantoff P. W. (2014). Enhancer RNAs participate in androgen receptor-driven looping that selectively enhances gene activation. Proc Natl Acad Sci U S A, 111(20), 7319–7324. 10.1073/pnas.1324151111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Jung H., Chen J., Hu X., Sun H., Wu S. Y., Chiang C. M., Kemper B., Chen L. F., & Kemper J. K. (2020). BRD4 inhibition and FXR activation, individually beneficial in cholestasis, are antagonistic in combination. JCI Insight, 6(1). 10.1172/jci.insight.141640 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kim D. H., Kwon S., Byun S., Xiao Z., Park S., Wu S. Y., Chiang C. M., Kemper B., & Kemper J. K. (2016). Critical role of RanBP2-mediated SUMOylation of Small Heterodimer Partner in maintaining bile acid homeostasis. Nat Commun, 7, 12179. 10.1038/ncomms12179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim Y. C., Fang S., Byun S., Seok S., Kemper B., & Kemper J. K. (2015). Farnesoid X receptor-induced lysine-specific histone demethylase reduces hepatic bile acid levels and protects the liver against bile acid toxicity. Hepatology, 62(1), 220–231. 10.1002/hep.27677 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kim Y. C., Jung H., Seok S., Zhang Y., Ma J., Li T., Kemper B., & Kemper J. K. (2020). MicroRNA-210 Promotes Bile Acid-Induced Cholestatic Liver Injury by Targeting Mixed-Lineage Leukemia-4 Methyltransferase in Mice. Hepatology, 71(6), 2118–2134. 10.1002/hep.30966 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kleene K. C. (2018). Y-box proteins combine versatile cold shock domains and arginine-rich motifs (ARMs) for pleiotropic functions in RNA biology. Biochem J, 475(17), 2769–2784. 10.1042/BCJ20170956 [DOI] [PubMed] [Google Scholar]
  31. Kliewer S. A., & Mangelsdorf D. J. (2015). Bile Acids as Hormones: The FXR-FGF15/19 Pathway. Dig Dis, 33(3), 327–331. 10.1159/000371670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kremoser C. (2021). FXR agonists for NASH: How are they different and what difference do they make? J Hepatol, 75(1), 12–15. 10.1016/j.jhep.2021.03.020 [DOI] [PubMed] [Google Scholar]
  33. Lai F., & Shiekhattar R. (2014). Enhancer RNAs: the new molecules of transcription. Curr Opin Genet Dev, 25, 38–42. 10.1016/j.gde.2013.11.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lam M. T., Li W., Rosenfeld M. G., & Glass C. K. (2014). Enhancer RNAs and regulated transcriptional programs. Trends Biochem Sci, 39(4), 170–182. 10.1016/j.tibs.2014.02.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lee F. Y., Lee H., Hubbert M. L., Edwards P. A., & Zhang Y. (2006). FXR, a multipurpose nuclear receptor. Trends Biochem Sci, 31(10), 572–580. 10.1016/j.tibs.2006.08.002 [DOI] [PubMed] [Google Scholar]
  36. Lee J., Padhye A., Sharma A., Song G., Miao J., Mo Y. Y., Wang L., & Kemper J. K. (2010). A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition. J Biol Chem, 285(17), 12604–12611. 10.1074/jbc.M109.094524 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lee J., Seok S., Yu P., Kim K., Smith Z., Rivas-Astroza M., Zhong S., & Kemper J. K. (2012). Genomic analysis of hepatic farnesoid X receptor binding sites reveals altered binding in obesity and direct gene repression by farnesoid X receptor in mice. Hepatology, 56(1), 108–117. 10.1002/hep.25609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lee J. M., Wagner M., Xiao R., Kim K. H., Feng D., Lazar M. A., & Moore D. D. (2014). Nutrient-sensing nuclear receptors coordinate autophagy. Nature, 516(7529), 112–115. 10.1038/nature13961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Li J., Woolbright B. L., Zhao W., Wang Y., Matye D., Hagenbuch B., Jaeschke H., & Li T. (2018). Sortilin 1 Loss-of-Function Protects Against Cholestatic Liver Injury by Attenuating Hepatic Bile Acid Accumulation in Bile Duct Ligated Mice. Toxicol Sci, 161(1), 34–47. 10.1093/toxsci/kfx078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Li W., Notani D., Ma Q., Tanasa B., Nunez E., Chen A. Y., Merkurjev D., Zhang J., Ohgi K., Song X., Oh S., Kim H. S., Glass C. K., & Rosenfeld M. G. (2013). Functional roles of enhancer RNAs for oestrogen-dependent transcriptional activation. Nature, 498(7455), 516–520. 10.1038/nature12210 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Li W., Notani D., & Rosenfeld M. G. (2016). Enhancers as non-coding RNA transcription units: recent insights and future perspectives. Nat Rev Genet, 17(4), 207–223. 10.1038/nrg.2016.4 [DOI] [PubMed] [Google Scholar]
  42. Li Y., Tan Z., Zhang Y., Zhang Z., Hu Q., Liang K., Jun Y., Ye Y., Li Y. C., Li C., Liao L., Xu J., Xing Z., Pan Y., Chatterjee S. S., Nguyen T. K., Hsiao H., Egranov S. D., Putluri N., . . . Yang L. (2021). A noncoding RNA modulator potentiates phenylalanine metabolism in mice. Science, 373(6555), 662–673. 10.1126/science.aba4991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Love M. I., Huber W., & Anders S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol, 15(12), 550. 10.1186/s13059-014-0550-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Mattick J. S., Amaral P. P., Carninci P., Carpenter S., Chang H. Y., Chen L. L., Chen R., Dean C., Dinger M. E., Fitzgerald K. A., Gingeras T. R., Guttman M., Hirose T., Huarte M., Johnson R., Kanduri C., Kapranov P., Lawrence J. B., Lee J. T., . . . Wu M. (2023). Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol, 24(6), 430–447. 10.1038/s41580-022-00566-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mirtschink P., Bischof C., Pham M. D., Sharma R., Khadayate S., Rossi G., Fankhauser N., Traub S., Sossalla S., Hagag E., Berthonneche C., Sarre A., Stehr S. N., Grote P., Pedrazzini T., Dimmeler S., Krek W., & Krishnan J. (2019). Inhibition of the Hypoxia-Inducible Factor 1alpha-Induced Cardiospecific HERNA1 Enhance-Templated RNA Protects From Heart Disease. Circulation, 139(24), 2778–2792. 10.1161/CIRCULATIONAHA.118.036769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Oh S., Shao J., Mitra J., Xiong F., D’Antonio M., Wang R., Garcia-Bassets I., Ma Q., Zhu X., Lee J. H., Nair S. J., Yang F., Ohgi K., Frazer K. A., Zhang Z. D., Li W., & Rosenfeld M. G. (2021). Enhancer release and retargeting activates disease-susceptibility genes. Nature, 595(7869), 735–740. 10.1038/s41586-021-03577-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rahnamoun H., Lee J., Sun Z., Lu H., Ramsey K. M., Komives E. A., & Lauberth S. M. (2018). RNAs interact with BRD4 to promote enhanced chromatin engagement and transcription activation. Nat Struct Mol Biol, 25(8), 687–697. 10.1038/s41594-018-0102-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Sallam T., Jones M. C., Gilliland T., Zhang L., Wu X., Eskin A., Sandhu J., Casero D., Vallim T. Q., Hong C., Katz M., Lee R., Whitelegge J., & Tontonoz P. (2016). Feedback modulation of cholesterol metabolism by the lipid-responsive non-coding RNA LeXis. Nature, 534(7605), 124–128. 10.1038/nature17674 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sanyal A. J., Lopez P., Lawitz E. J., Lucas K. J., Loeffler J., Kim W., Goh G. B. B., Huang J. F., Serra C., Andreone P., Chen Y. C., Hsia S. H., Ratziu V., Aizenberg D., Tobita H., Sheikh A. M., Vierling J. M., Kim Y. J., Hyogo H., . . . Brass C. A. (2023). Tropifexor for nonalcoholic steatohepatitis: an adaptive, randomized, placebo-controlled phase 2a/b trial. Nat Med, 29(2), 392–400. 10.1038/s41591-022-02200-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sartorelli V., & Lauberth S. M. (2020). Enhancer RNAs are an important regulatory layer of the epigenome. Nat Struct Mol Biol, 27(6), 521–528. 10.1038/s41594-020-0446-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Seok S., Fu T., Choi S. E., Li Y., Zhu R., Kumar S., Sun X., Yoon G., Kang Y., Zhong W., Ma J., Kemper B., & Kemper J. K. (2014). Transcriptional regulation of autophagy by an FXR-CREB axis. Nature, 516(7529), 108–111. 10.1038/nature13949 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Seok S., Kim Y. C., Byun S., Choi S., Xiao Z., Iwamori N., Zhang Y., Wang C., Ma J., Ge K., Kemper B., & Kemper J. K. (2018). Fasting-induced JMJD3 histone demethylase epigenetically activates mitochondrial fatty acid beta-oxidation. J Clin Invest, 128(7), 3144–3159. 10.1172/JCI97736 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Seok S., Sun H., Kim Y. C., Kemper B., & Kemper J. K. (2021). Defective FXR-SHP Regulation in Obesity Aberrantly Increases miR-802 Expression, Promoting Insulin Resistance and Fatty Liver. Diabetes, 70(3), 733–744. 10.2337/db20-0856 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Statello L., Guo C. J., Chen L. L., & Huarte M. (2021). Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol, 22(2), 96–118. 10.1038/s41580-020-00315-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Sun H., Seok S., Jung H., Kemper B., & Kemper J. K. (2022). Obesity-induced mi-R802 directly targets AMPK and promotes nonalcoholic steatohepatitis in mice. Mol Metab, 66, 101603. 10.1016/j.molmet.2022.101603 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Tang X., Luo Y., Yuan D., Calandrelli R., Malhi N. K., Sriram K., Miao Y., Lou C. H., Tsark W., Tapia A., Chen A. T., Zhang G., Roeth D., Kalkum M., Wang Z. V., Chien S., Natarajan R., Cooke J. P., Zhong S., & Chen Z. B. (2023). Long noncoding RNA LEENE promotes angiogenesis and ischemic recovery in diabetes models. J Clin Invest, 133(3). 10.1172/JCI161759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Thomas A. M., Hart S. N., Kong B., Fang J., Zhong X. B., & Guo G. L. (2010). Genome-wide tissue-specific farnesoid X receptor binding in mouse liver and intestine. Hepatology, 51(4), 1410–1419. 10.1002/hep.23450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tully D. C., Rucker P. V., Chianelli D., Williams J., Vidal A., Alper P. B., Mutnick D., Bursulaya B., Schmeits J., Wu X., Bao D., Zoll J., Kim Y., Groessl T., McNamara P., Seidel H. M., Molteni V., Liu B., Phimister A., . . . Laffitte B. (2017). Discovery of Tropifexor (LJN452), a Highly Potent Non-bile Acid FXR Agonist for the Treatment of Cholestatic Liver Diseases and Nonalcoholic Steatohepatitis (NASH). J Med Chem, 60(24), 9960–9973. 10.1021/acs.jmedchem.7b00907 [DOI] [PubMed] [Google Scholar]
  59. Wahlstrom A., Sayin S. I., Marschall H. U., & Backhed F. (2016). Intestinal Crosstalk between Bile Acids and Microbiota and Its Impact on Host Metabolism. Cell Metab, 24(1), 41–50. 10.1016/j.cmet.2016.05.005 [DOI] [PubMed] [Google Scholar]
  60. Wang Y. D., Chen W. D., Wang M., Yu D., Forman B. M., & Huang W. (2008). Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic inflammatory response. Hepatology, 48(5), 1632–1643. 10.1002/hep.22519 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Warren C. F. A., Wong-Brown M. W., & Bowden N. A. (2019). BCL-2 family isoforms in apoptosis and cancer. Cell Death Dis, 10(3), 177. 10.1038/s41419-019-1407-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zhao X. Y., Xiong X., Liu T., Mi L., Peng X., Rui C., Guo L., Li S., Li X., & Lin J. D. (2018). Long noncoding RNA licensing of obesity-linked hepatic lipogenesis and NAFLD pathogenesis. Nat Commun, 9(1), 2986. 10.1038/s41467-018-05383-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zheng W., Lu Y., Tian S., Ma F., Wei Y., Xu S., & Li Y. (2018). Structural insights into the heterodimeric complex of the nuclear receptors FXR and RXR. J Biol Chem, 293(32), 12535–12541. 10.1074/jbc.RA118.004188 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zou C., Wan Y., He L., Zheng J. H., Mei Y., Shi J., Zhang M., Dong Z., & Zhang D. (2021). RBM38 in cancer: role and mechanism. Cell Mol Life Sci, 78(1), 117–128. 10.1007/s00018-020-03593-w [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement 1

Data Availability Statement

RNA-seq and Gro-seq data were deposited in GEO under the following accession numbers GSE 221986.


Articles from bioRxiv are provided here courtesy of Cold Spring Harbor Laboratory Preprints

RESOURCES