UVRAG cooperates with cargo receptors to assemble the ER‐phagy site

Abstract

ER‐phagy is a selective autophagy process that targets specific regions of the endoplasmic reticulum (ER) for removal via lysosomal degradation. During cellular stress induced by starvation, cargo receptors concentrate at distinct ER‐phagy sites (ERPHS) to recruit core autophagy proteins and initiate ER‐phagy. However, the molecular mechanism responsible for ERPHS formation remains unclear. In our study, we discovered that the autophagy regulator UV radiation Resistance‐Associated Gene (UVRAG) plays a crucial role in orchestrating the assembly of ERPHS. Upon starvation, UVRAG localizes to ERPHS and interacts with specific ER‐phagy cargo receptors, such as FAM134B, ATL3, and RTN3L. UVRAG regulates the oligomerization of cargo receptors and facilitates the recruitment of Atg8 family proteins. Consequently, UVRAG promotes efficient ERPHS assembly and turnover of both ER sheets and tubules. Importantly, UVRAG‐mediated ER‐phagy contributes to the clearance of pathogenic proinsulin aggregates. Remarkably, the involvement of UVRAG in ER‐phagy initiation is independent of its canonical function as a subunit of class III phosphatidylinositol 3‐kinase complex II.

The autophagy regulator UVRAG promotes degradation of specific regions of the endoplasmic reticulum independently of its role in PI3KC3 complex II.

Introduction

The endoplasmic reticulum (ER) is involved in vital cellular processes such as protein synthesis, lipid metabolism, calcium homeostasis, and signal transduction. To ensure its proper functioning, the ER is tightly regulated by various quality‐control mechanisms. While correctly folded proteins are directed to the Golgi apparatus, misfolded proteins trigger the unfolded protein response (UPR) and are subsequently eliminated through ER‐associated degradation (ERAD) pathways (Smith et al, 2011; Walter & Ron, 2011; Hetz, 2012). Recent studies have revealed that large‐sized, aggregation‐prone ER proteins, which are resistant to ERAD, are degraded via a process called ER‐phagy (Schultz et al, 2018; Cui et al, 2019; Cunningham et al, 2019; Forrester et al, 2019; Ji et al, 2019; Chen et al, 2021; Parashar et al, 2021). These harmful proteins are closely associated with various human diseases, including neurodegeneration, liver disease, and diabetes (Cui et al, 2019; Cunningham et al, 2019; Chen et al, 2021).

ER‐phagy is an autophagic process where specific ER membranes and luminal proteins are selectively targeted into double‐membrane‐bound autophagosomes through cargo receptors. Under conditions such as nutrient deprivation, mTOR inhibition, or accumulation of aggregation‐prone proteins, cargo receptors oligomerize and cluster at distinct ER subdomains (Stolz & Grumati, 2019). Concentrated cargo receptors then interact with chaperones that bind to ER luminal protein aggregates, and they recruit core autophagy proteins, such as Atg8 family proteins (Atg8/LC3/GABARAP), to initiate the formation of ER‐phagy sites (ERPHS) (Cui et al, 2019; Forrester et al, 2019; Chen et al, 2021). The assembly of ERPHS is crucial for sorting specific ER subdomains into autophagosomes for subsequent lysosomal degradation. Several mammalian ER‐phagy cargo receptors have been identified, each playing distinct roles depending on the physiological or environmental context (Khaminets et al, 2015; Fumagalli et al, 2016; Grumati et al, 2017; Smith et al, 2018; An et al, 2019; Chen et al, 2019; Chino et al, 2019; Ji et al, 2019; Nthiga et al, 2020; Stefely et al, 2020; Stephani et al, 2020; Reggio et al, 2021). However, the molecular mechanisms underlying ERPHS assembly remain unclear.

UV radiation Resistance‐Associated Gene (UVRAG) was initially identified as a tumor suppressor (Perelman et al, 1997; Liang et al, 2006) and has since been implicated in regulating organ rotation (Lee et al, 2011), genome homeostasis (Zhao et al, 2012), apoptosis (Yin et al, 2011), and peripheral naive T‐cell homeostasis (Afzal et al, 2015). UVRAG forms the class III phosphoinositide 3‐kinase complex II (PI3KC3‐II) through its interactions with Beclin‐1, VPS34, and p150, catalyzing the production of phosphatidylinositol‐3‐phosphate (PI3P) (Itakura et al, 2008). The UVRAG‐containing PI3KC3‐II complex is involved in endocytic trafficking and non‐selective macro‐autophagy (Liang et al, 2006, 2008; Takahashi et al, 2007; Itakura et al, 2008). However, the precise role of UVRAG in macro‐autophagy remains elusive and subject to debate. While Liang et al (2008) reported that UVRAG is involved in autophagosome maturation and fusion with the lysosome, Jiang et al (2014) demonstrated its dispensability for autophagosome–lysosome fusion. In this study, we identified UVRAG as a novel regulator of ER‐phagy through a genetic screen searching for uncharacterized players in ER‐phagy. UVRAG piqued our interest due to its potential interaction with several ER‐phagy cargo receptors. This led us to speculate that UVRAG might cooperate with different cargo receptors to regulate the assembly of ERPHS. Further investigation confirmed that UVRAG indeed interacts with specific cargo receptors (FAM134A/B/C, ATL3, and RTN3L), promoting the recruitment of Atg8 family proteins and enhancing the oligomerization of receptors, thereby facilitating the efficient assembly of ERPHS. Importantly, the specific role of UVRAG in initiating ER‐phagy is independent of its canonical function as a subunit of PI3KC3‐II.

Results

Upregulation of UVRAG promotes ER‐phagy

To confirm the involvement of UVRAG in ER‐phagy, we initially investigated whether the upregulation of UVRAG affects ER‐phagy. We monitored ER‐phagy flux by measuring the cleavage of ER‐localized GFP‐Sec61β into free GFP via immunoblotting. Accumulation of free GFP indicates delivery of GFP‐Sec61β to the lysosome through ER‐phagy, as Sec61β is degraded while GFP exhibits relative resistance to lysosomal hydrolysis. In human U2‐osteosarcoma (U2OS) cells, transient expression of UVRAG led to the cleavage of GFP‐Sec61β into free GFP under nutrient‐rich conditions, whereas control cells showed no detectable free GFP (Fig 1A). As the expression level of UVRAG increased, the cleavage of GFP‐Sec61β was further enhanced (Fig 1A and B), indicating that UVRAG overexpression is sufficient to promote basal levels of ER‐phagy in a nutrient‐rich environment. Upon shifting the cells from rich medium to Earle's balanced salt solution (EBSS) deprived of amino acids, UVRAG significantly enhanced the cleavage of GFP‐Sec61β (Fig 1C and D). Similar results were observed when cells were treated with the mTOR inhibitor Torin 2 (Fig EV1A and B). These findings demonstrate that UVRAG promotes ER‐phagy induced by starvation or mTOR inhibition.

Figure 1. Upregulation of UVRAG specifically promotes ER‐phagy but not macro‐autophagy.

1. Immunoblot analysis of GFP‐Sec61β cleavage to GFP in U2OS cells transfected with empty vector or increasing amounts of FLAG‐UVRAG plasmid. Anti‐GFP antibodies were used for detection.
2. Quantitative analysis of the ratio of free GFP to GFP‐Sec61β based on the data in (A). n = 3.
3. Immunoblot analysis of GFP‐Sec61β cleavage to GFP in U2OS cells transfected with empty vector or FLAG‐UVRAG plasmid, with or without treatment with EBSS.
4. Quantitative analysis of the ratio of free GFP to GFP‐Sec61β based on the data in (C). n = 4.
5. Representative confocal images of U2OS cells transiently transfected with RFP‐GFP‐KDEL plasmids. NC, cells stably transfected with empty vector and cultured in rich medium; UVRAG, cells stably transfected with FLAG‐UVRAG and cultured in rich medium; EBSS, cells stably transfected with empty vector and starved in EBSS for 2 h. Arrowheads indicate RFP‐positive (+) and GFP‐negative (−) puncta. Scale bar, 10 μm.
6. Quantitative analysis of the number of RFP⁺/GFP⁻ puncta in (E). N = 25 cells.
7. Immunoblot analysis of UVRAG, REEP5, and CLIMP63 protein levels in U2OS cells treated with different durations of EBSS.
8. Quantitative analysis of the relative intensity of protein bands in (G). The protein levels of cells cultured in full medium (EBSS 0 h) were normalized to one. n = 3.
9. Immunoblot analysis of p62 and LC3B‐II protein levels in U2OS cells transfected with empty vector or FLAG‐UVRAG plasmid. Cells were starved in EBSS, with or without the presence of Baf‐A1 (250 nM).
10. Quantitative analysis of the relative intensity of protein bands in (I). The intensity of p62/GAPDH or LC3B‐II/GAPDH in cells cultured in full medium and transfected with empty vector was normalized to one. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

Figure EV1. UVRAG upregulation specifically promotes ER‐phagy but not macro‐autophagy, mitophagy, or aggrephagy.

1. Cleavage of GFP‐Sec61β to GFP in U2OS cells transfected with empty vector or FLAG‐UVRAG plasmid, treated with or without 250 nM Torin 2.
2. Quantitative analysis of the ratio of free GFP to GFP‐Sec61β from the data in (A). n = 3.
3. Quantitative analysis of ER‐phagy flux by flow cytometry. HEK293T cells were transfected with RFP‐GFP‐KEDL plasmid, together with empty vector control or FLAG‐UVRAG plasmid. Cells were either starved in EBSS or left untreated, in the presence or absence of Baf‐A1 (250 nM). n = 3.
4. qRT–PCR analysis of UVRAG mRNA abundance in U2OS cells treated with the indicated time of EBSS. The relative mRNA level of cells cultured in full medium (EBSS 0 h) was normalized to one. n = 3.
5. Immunoblotting to analyze the protein level of UVRAG in U2OS cells treated under the indicated conditions.
6. Quantitative analysis of the relative intensity of protein bands in (E). The relative protein levels of cells cultured in full medium were normalized to one. n = 3.
7. p62 and LC3B‐II protein levels were measured by immunoblotting in U2OS, Hela, and HEK293T cells cultured in full medium, transfected with empty vector or FLAG‐UVRAG plasmid.
8. Quantitative analysis of the relative intensity of protein bands in U2OS cells in (G). The relative intensity of p62/GAPDH or LC3B‐II/GAPDH in cells transfected with empty vector (NC) was normalized to one. n = 3.
9. p62 and LC3B‐II protein levels were determined by immunoblotting in U2OS cells transfected with empty vector or FLAG‐UVRAG plasmid, treated with the indicated conditions.
10. Quantitative analysis of the relative intensity of protein bands in (I). The relative intensity of p62/GAPDH or LC3B‐II/GAPDH of cells cultured in full medium and transfected with empty vector was normalized to one. n = 3.
11. Representative confocal images of U2OS cells transfected with RFP‐GFP‐LC3B plasmid, together with empty vector control or FLAG‐UVRAG plasmid. Cells were either starved in EBSS for 2 h or left untreated. NC: U2OS cells co‐transfected with RFP‐GFP‐LC3B and empty vector; UVRAG: U2OS cells co‐transfected with RFP‐GFP‐LC3B and FLAG‐UVRAG plasmid. Arrowheads indicate RFP‐positive (+) and GFP‐negative (−) puncta. Scale bar, 10 μm.
12. Quantitative analysis of the number of autophagosomes (RFP⁺/GFP⁺ LC3B) and autolysosomes (RFP⁺/GFP⁻ LC3B) in (K). N > 10 cells.
13. Quantitative analysis of macro‐autophagy flux by flow cytometry. HEK293T cells were transfected with RFP‐GFP‐LC3B plasmid, together with empty vector control or FLAG‐UVRAG plasmid. Cells were either starved in EBSS or left untreated, in the presence or absence of Baf‐A1 (250 nM). n = 3.
14. Quantitative analysis of mitophagy flux by flow cytometry in U2OS cells transfected with the indicated plasmids. Cells were either treated with 1 μM CCCP or left untreated. n = 3.
15. Cleavage of GFP‐103Q to free GFP in U2OS cells transfected with the indicated plasmids. Cells were either left untreated or treated with 1 μM MG132.
16. Quantitative analysis of the ratio of free GFP to GFP‐103Q based on the data in (O). n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001; unpaired Student's t test.

Source data are available online for this figure.

To validate the findings from the GFP‐Sec61β cleavage assay, we employed a tandem fluorescent‐tagged ER protein, RFP‐GFP‐KDEL, for visualizing ER‐phagy through confocal microscopy. In this construct, only red fluorescence is emitted when RFP‐GFP‐KDEL is delivered to the lysosome. Consistently, upon overexpression of UVRAG, we observed a significant increase in RFP‐positive and GFP‐negative puncta (Fig 1E and F). Flow cytometry analysis yielded similar results (Fig EV1C). Consistent with the reliance on core autophagy machinery in ER‐phagy, treatment with Bafilomycin A1 (Baf‐A1), an inhibitor of autophagosome–lysosome fusion, prevented the increase of RFP fluorescence (Fig EV1C). Taken together, these findings provide further evidence that UVRAG enhances both the basal level of ER‐phagy and ER‐phagy induced by starvation or mTOR inhibition.

To further understand the dynamics of endogenous UVRAG during ER‐phagy, we examined its response under conditions of ER‐phagy induction. Real‐time quantitative reverse transcription PCR (qRT–PCR) analysis revealed that the mRNA level of UVRAG was upregulated in response to starvation (Fig EV1D). Moreover, upon shifting the cells to EBSS, the protein level of UVRAG rapidly increased (Fig 1G and H), indicating that UVRAG expression levels may regulate the timing and magnitude of ER‐phagy. This observation also explains why overexpression of UVRAG enhances ER‐phagy. Interestingly, with prolonged starvation, the protein level of UVRAG gradually decreased, coinciding with the degradation of ER tubular protein REEP5 and ER sheet protein CLIMP63 (Fig 1G and H). Furthermore, treatment with Baf‐A1 prevented the degradation of UVRAG (Fig EV1E and F), suggesting that UVRAG may be delivered to the lysosome as a component of the autophagosome during its involvement in mediating ER‐phagy.

Overexpression of UVRAG does not enhance macro‐autophagy, mitophagy, or aggrephagy

UVRAG has been implicated in mediating the fusion between autophagosomes and lysosomes in macro‐autophagy as a subunit of PI3KC3‐II (Liang et al, 2008). To determine whether the increased ER‐phagy activity in cells overexpressing UVRAG is a result of increased general, non‐selective macro‐autophagy, we examined the effect of UVRAG overexpression on macro‐autophagy. When U2OS cells were cultured in a nutrient‐rich medium, the overexpression of UVRAG had no discernible effect on macro‐autophagy. This was evidenced by the absence of any changes in the lipidation of LC3B and degradation of p62, a well‐known substrate for macro‐autophagy (Fig EV1G and H). Similar results were obtained in human cervical cancer Hela cells and embryonic kidney HEK293T cells (Fig EV1G). Furthermore, UVRAG overexpression did not enhance macro‐autophagy induced by either short‐ or long‐term starvation (Figs EV1I and J, and 1I and J). These findings were further confirmed by assessing the delivery of RFP‐GFP‐LC3B to the lysosome using both confocal microscopy (Fig EV1K and L) and flow cytometry (Fig EV1M).

Additionally, we investigated the role of UVRAG in two other types of selective autophagy: mitophagy and aggrephagy. Mitophagy was assessed by measuring the delivery of Tom20‐mCherry‐GFP to the lysosome using flow cytometry. The overexpression of UVRAG did not show any apparent effects on mitophagy induced by CCCP, a mitochondrial uncoupler (Fig EV1N). Aggrephagy was monitored by measuring the cleavage of GFP‐103Q into free GFP using immunoblotting. No significant effects were observed following UVRAG overexpression when cells were treated with a proteasome inhibitor, MG132 (Fig EV1O and P). Collectively, our data suggest that the upregulation of UVRAG does not enhance general macro‐autophagy, mitophagy, or aggrephagy, but specifically promotes ER‐phagy.

UVRAG induces ER‐phagy independently of its interaction with Beclin‐1

UVRAG is a multifunctional protein consisting of distinct domains, including an N‐terminal proline‐rich domain (PR) (Takahashi et al, 2007), a potential calcium‐dependent phospholipid binding domain (C2) (Liang et al, 2006; Yin et al, 2011; He et al, 2013), a central coiled‐coil domain (CC) responsible for Beclin‐1 binding (Liang et al, 2006, 2008; Sun et al, 2008), and a C‐terminal DNA‐dependent protein kinase binding domain (DNA‐PK BD) (Zhao et al, 2012) (Fig 2A; Ma et al, 2017). The CC domain is crucial for direct interaction with Beclin‐1 as part of the PI3KC3‐II complex. To investigate if UVRAG's role in promoting ER‐phagy depends on its function within PI3KC3‐II, we generated a Beclin‐1‐binding deficient mutant of human UVRAG, called UVRAG‐6E (Wu et al, 2018). In UVRAG‐6E, six leucine residues within the CC domain, which form leucine zipper pairings with Beclin‐1, were substituted with glutamate (Fig 2A and B). While wild‐type UVRAG exhibited co‐immunoprecipitation with Beclin‐1, UVRAG‐6E completely abolished its binding to Beclin‐1 (Fig 2C). This finding aligns with previous observations for mouse UVRAG‐6E (Wu et al, 2018). Interestingly, UVRAG‐6E overexpression induced ER‐phagy more effectively than wild‐type UVRAG in nutrient‐rich conditions (Fig 2D and E). Similar to wild‐type UVRAG, UVRAG‐6E showed no discernible impact on macro‐autophagy (Fig 2D and F). The ER‐phagy‐driving ability of UVRAG‐6E was further validated by the degradation of CLIMP63, REEP5, and CALNEXIN (Fig 2G and H). These results indicate that the ability of UVRAG to bind to Beclin‐1 is not essential for its capacity to induce ER‐phagy. Thus, UVRAG exhibits a novel function in ER‐phagy, which is independent of its role as a subunit of PI3KC3‐II.

Figure 2. UVRAG drives ER‐phagy independent of its binding with Beclin‐1.

• A
  Schematic representation of UVRAG protein structures, including the PR, proline‐rich domain, C2, calcium‐dependent phospholipid binding domain, CC, coiled‐coil domain, and DNA‐PK BD, DNA‐dependent protein kinase binding domain. The six leucine residues within the CC domain, indicated by red vertical lines, are mutated to glutamates in UVRAG‐6E.
• B
  Parallel dimeric structure of the UVRAG‐Beclin‐1 coiled‐coil complex, showing six pairs of key residues for interaction.
• C
  Co‐IP experiment to assess the binding of wild‐type (WT) UVRAG or UVRAG‐6E with Beclin‐1.
• D
  Immunoblot analysis of GFP‐Sec61β cleavage to GFP, p62, and LC3B‐II protein levels in U2OS cells transfected with empty vector (NC), FLAG‐UVRAG‐WT, or FLAG‐UVRAG‐6E.
• E, F
  Quantitative analysis of the immunoblotting results shown in (D). The intensity of p62/GAPDH or LC3B‐II/GAPDH in cells transfected with empty vector (NC) was normalized to one. n = 3.
• G
  Immunoblot analysis of CLIMP63, REEP5, and CALNEXIN protein levels in U2OS cells transfected with empty vector (NC), FLAG‐UVRAG‐WT, or FLAG‐UVRAG‐6E, with or without treatment with EBSS.
• H
  Quantitative analysis of the relative intensity of protein bands in (G). The intensity of CLIMP63/GAPDH, REEP5/GAPDH, or CALNEXIN/GAPDH in cells cultured in full medium and transfected with empty vector (NC, lane 1 in G) was normalized to one. n = 4.
• I
  Immunoblot analysis of GFP‐Sec61β cleavage to GFP in U2OS cells transfected with the indicated plasmids.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

There is another PI3KC3 complex, PI3KC3‐I, sharing three common subunits (Beclin‐1, VPS34, and p150) with PI3KC3‐II, while UVRAG is specific to PI3KC3‐II and replaced by ATG14L in PI3KC3‐I. The ATG14L‐containing PI3KC3‐I complex is crucial for early autophagosome formation (Itakura et al, 2008; Sun et al, 2008; Matsunaga et al, 2009; Zhong et al, 2009). We aimed to investigate whether overexpression of ATG14L could also induce ER‐phagy. Surprisingly, unlike UVRAG, overexpressing ATG14L did not exhibit any detectable effect on ER‐phagy (Fig 2I). This finding suggests that the overexpression of ATG14L, which is an essential autophagy protein and a subunit of PI3KC3‐I, is not adequate to drive ER‐phagy.

UVRAG localizes to ERPHS and interacts with ER‐phagy cargo receptors

The aforementioned data indicate an uncharacterized function of UVRAG in ER‐phagy. To investigate its role further, we conducted immunoprecipitation mass spectrometry (IP‐MS) to identify novel interactors of UVRAG. As expected, known UVRAG interactors such as Beclin‐1 and mTOR (Kim et al, 2015) were identified (Fig EV2A). Interestingly, we also discovered several ER‐phagy cargo receptors (FAM134B, ATL3, RTN3L, and TEX264) among the identified proteins (Fig EV2A). ER‐phagy receptors play a pivotal role in the assembly of ERPHS (Cui et al, 2019; Stolz & Grumati, 2019), leading us to speculate that UVRAG may have a broader role in regulating the assembly of ERPHS by collaborating with various cargo receptors.

Figure EV2. Interaction of UVRAG with ER‐phagy receptors.

• A
  UVRAG interactome. Unbiased IP‐MS experiments were performed using FLAG‐UVRAG as a bait. Protein–protein interaction network was plotted by R package, depicting interactions among proteins that belonged to autophagy pathway. The information of protein interactions (edges) was provided in Table EV3. Each node represents an individual protein, and each line refers an interaction. Green node represents bait protein; red nodes represent potential UVRAG interactors identified from our IP‐MS, gray nodes represent proteins which were not identified from our IP‐MS, but defined as UVRAG interactors by STRING.
• B–H
  Co‐IP of UVRAG and ER‐phagy receptor proteins: FAM134B (B), ATL3 (C), RTN3L(D), TEX264 (E), CCPG1 (F), SEC62 (G), and CALCOCO1 (H). Protein lysates were prepared from HEK293T cells cultured in rich medium and co‐transfected with the indicated plasmids.
• I, J
  Co‐IP of ectopically expressed HA‐FAM134A (I) and HA‐FAM134C (J) with endogenous UVRAG in U2OS cells.

Source data are available online for this figure.

To validate the IP‐MS results, we performed individual co‐immunoprecipitation (Co‐IP) assays. The Co‐IP experiments using exogenously expressed proteins confirmed the interactions between UVRAG and FAM134B, ATL3, and RTN3L, while no interaction was observed with TEX264 (Fig EV2B–E). These findings were further supported by Co‐IP experiments using endogenous proteins (Fig 3A). Additionally, we investigated whether UVRAG interacts with other well‐established ER‐phagy cargo receptors that were not identified by IP‐MS. However, no interactions were found between UVRAG and CCPG1, SEC62, or CALCOCO1 (Fig EV2F–H). Intriguingly, UVRAG exhibited interactions with FAM134A and FAM134C, two other members of the FAM134 family known to mediate sheet ER autophagy (Fig EV2I and J). For the sake of simplicity, our subsequent study focused on FAM134B, the most extensively characterized protein within this family. Collectively, these results demonstrate that UVRAG specifically interacts with three sheet ER‐phagy receptors (FAM134A, FAM134B, and FAM134C) and two tubular ER‐phagy receptors (ATL3 and RTN3L).

Figure 3. UVRAG interacts with cargo receptors to promote ER‐phagy.

• A
  Co‐IP of endogenous UVRAG and ER‐phagy cargo receptor proteins in U2OS cells cultured in rich medium using anti‐UVRAG antibodies or IgG as a negative control.
• B
  Co‐IP of endogenous ER‐phagy receptor proteins with ectopically expressed FLAG‐UVRAG in U2OS cells treated with EBSS for the indicated time.
• C
  Quantification of the receptor proteins co‐immunoprecipitated with UVRAG from (B). The amount of receptor proteins co‐immunoprecipitated with UVRAG from non‐starved cells was normalized to one. n = 3.
• D, E
  Immunoblot analysis of GFP‐Sec61β cleavage to GFP in U2OS cells transfected with empty vector control or the indicated plasmids.
• F
  Quantification of the ratio of free GFP to GFP‐Sec61β from the data in (D) and (E). n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

Furthermore, Co‐IP results revealed that their interactions were enhanced upon starvation (Fig 3B and C). Functionally, co‐overexpression of UVRAG and its interacting ER‐phagy receptors resulted in a significant induction of ER‐phagy (Fig 3D–F). These findings suggest that the augmented interactions between UVRAG and specific ER‐phagy receptors in response to starvation contribute to an accelerated ER‐phagy flux.

While the interactions between UVRAG and ER‐phagy receptors have been established, the precise subcellular localization of these interactions remains unknown. To address this, we examined the subcellular localization of UVRAG. Confocal microscope images revealed a substantial increase in UVRAG puncta and their co‐localization with ER‐phagy receptors and the early autophagosomal marker WIPI2 after 2 h of starvation (Fig 4A–E). Furthermore, an increased co‐localization of UVRAG, ER‐phagy receptors, and the lysosomal protein LAMP1 was observed after starvation (Fig 4F–I). This finding explains the earlier observation that the degradation of UVRAG is dependent on lysosomes (Fig EV1E and F). Based on these results, we hypothesize that, upon starvation, UVRAG is recruited to the ERPHS, interacts with specific ER‐phagy receptors, then regulates the formation of ERPHS, and eventually undergoes degradation in lysosomes along with ER‐phagy receptors.

Figure 4. UVRAG localizes to ERPHS and is required for the formation of ERPHS.

• A–C
  Confocal images of U2OS cells co‐transfected with mCherry‐WIPI2 and FLAG‐FAM134B (A), FLAG‐ATL3 (B), and FLAG‐RTN3L (C). UVRAG and FLAG‐tagged ER‐phagy receptors were stained with antibodies. Cells were subjected to EBSS for 2 h or left untreated. Arrowheads indicate receptor⁺/UVRAG⁺/WIPI2⁺ puncta. Scale bars represent 10 μm.
• D
  Quantification of the number of receptor⁺/UVRAG⁺/WIPI2⁺ puncta from (A) to (C). N > 10 cells.
• E
  Quantification of the average number of UVRAG puncta per cell from (A) to (C). N = 25 cells.
• F–H
  Confocal images of U2OS cells co‐transfected with mCherry‐LAMP1 and FLAG‐FAM134B (F), FLAG‐ATL3 (G), and FLAG‐RTN3L (H). UVRAG and FLAG‐tagged ER‐phagy receptors were stained with antibodies. Cells were subjected to EBSS for 2 h or left untreated. Arrowheads indicate receptor⁺/UVRAG⁺/LAMP1⁺ puncta. Scale bars represent 10 μm.
• I
  Quantification of the number of receptor⁺/UVRAG⁺/LAMP1⁺ puncta from (F) to (H). N = 10 cells.
• J–L
  Confocal images of WT or UVRAG‐KO U2OS cells treated with EBSS for 2 h. WIPI2 and ER‐phagy receptors, FAM134B (J), ATL3 (K), and RTN3L (L) were stained with antibodies. Scale bars represent 10 μm.
• M
  Quantification of the data from (J) to (L). N = 10 cells.

Data information: Error bars represent SEM; ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

Next, we investigated whether UVRAG directly regulates the formation of ERPHS. To address this question, we generated three UVRAG knockout U2OS cell lines using the CRISPR‐Cas9 approach with different single guide RNAs (sgRNAs). UVRAG knockout completely blocked ER‐phagy, as evidenced by the absence of GFP‐Sec61β cleavage (Fig EV3A) and impaired turnover of CLIMP63, REEP5, and CALNEXIN (Fig EV3B and C). Consistent with UVRAG's role in autophagosome–lysosome fusion, UVRAG knockout also impaired macro‐autophagy, as indicated by the accumulation of p62 and LC3B‐II (Fig EV3B and D). Confocal microscope images demonstrated a significant reduction in ER‐phagy receptor puncta co‐localized with WIPI2 in UVRAG knockout cells following cellular starvation for 2 h (Fig 4J–M). These findings indicate that UVRAG is essential for the assembly of ERPHS. Collectively, our data suggest that UVRAG plays a critical role in regulating the assembly of ERPHS by collaborating with different cargo receptors.

Figure EV3. UVRAG deficiency inhibits both ER‐phagy and macro‐autophagy.

• A
  Cleavage of GFP‐Sec61β to GFP in wild‐type (WT) and three different UVRAG knockout (UVRAG‐KO‐1, ‐2, and ‐3) U2OS cell lines starved with EBSS for the indicated time.
• B
  Immunoblotting to analyze CLIMP63, REEP5, CALNEXIN, p62, and LC3B‐II protein levels in WT or UVRAG‐KO U2OS cells starved with EBSS for the indicated time.
• C, D
  Quantification of data in (B). The relative protein levels of WT cells cultured in full medium were normalized to one. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; *P < 0.05, **P < 0.01, ***P < 0.001; unpaired Student's t test.

Source data are available online for this figure.

The N‐terminal PR domain of UVRAG binds to the cytosolic domains of cargo receptors

To identify the specific domain responsible for the interaction between UVRAG and ER‐phagy cargo receptors, we generated a series of UVRAG deletion mutants (Fig 5A). Co‐IP experiments revealed that the N‐terminal region of UVRAG (UVRAG 1–189) was sufficient to bind FAM134B, ATL3, and RTN3L (Fig 5B–D). Importantly, UVRAG 1–189 lacks the CC domain, indicating that the Beclin‐1‐binding motif of UVRAG is not required for its interaction with ER‐phagy cargo receptors. Consistent with this finding, Co‐IP experiments demonstrated that UVRAG‐6E, which lacks the ability to bind Beclin‐1, was still capable of interacting with these three ER‐phagy cargo receptors, and even more efficiently than wild‐type UVRAG (Fig EV4A–D). These results strongly suggest that UVRAG binds to cargo receptors independently of its Beclin‐1‐binding domain.

Figure 5. UVRAG interacts with cargo receptors through its PR domain.

• A
  Schematic representation of the full‐length (FL) UVRAG protein and truncated UVRAG protein structures.
• B–J
  Co‐IP of UVRAG and HA‐tagged ER‐phagy receptors in U2OS cells cultured in rich medium, using anti‐HA antibodies or IgG as a negative control. Asterisks indicate the specific bands of full‐length or truncated UVRAG proteins.
• K
  Immunoblot analysis of LC3B‐II and p62 protein levels in WT or UVRAG‐KO U2OS cells stably expressing the indicated plasmids.
• L, M
  Quantification of the data from (K). n = 3.
• N
  Immunoblot analysis of GFP‐Sec61β cleavage to GFP in WT or UVRAG‐KO U2OS cells stably transfected with the indicated plasmids.
• O
  Quantification of the data from (N). n = 3.
• P
  Quantitative analysis of ER‐phagy flux by flow cytometry. U2OS cells stably expressing WT or mutated UVRAG and transfected with RFP‐GFP‐KDEL plasmids. Cells were either starved in EBSS or left untreated. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001; unpaired Student's t test.

Source data are available online for this figure.

Figure EV4. PR domain of UVRAG interacts with the cytosolic domains of ER‐phagy receptors, independent of the LIR/GIM of ER‐phagy receptors.

• A–C
  Co‐IP of UVRAG‐WT or UVRAG‐6E with ER‐phagy receptor proteins, HA‐FAM134B (A), HA‐ATL3 (B), or HA‐RTN3L (C). U2OS cells were cultured in rich medium and co‐transfected with the indicated plasmids.
• D
  Quantification of the amount of UVRAG proteins (WT or 6E) co‐immunoprecipitated with HA‐FAM134B (A), HA‐ATL3 (B), or HA‐RTN3L (C). The amount of WT UVRAG proteins co‐immunoprecipitated with each receptor was normalized to one. n = 3.
• E–G
  Co‐IP of wild‐type UVRAG and UVRAG ΔPR with ER‐phagy cargo receptors, HA‐FAM134B (E), HA‐ATL3 (F), and HA‐RTN3L (G). Protein lysates were prepared from HEK293T cells cultured in rich medium and co‐transfected with the indicated plasmids.
• H
  Schematic representation of the full‐length and truncated receptor protein structures. RHD, reticulon‐homology domain; TM, transmembrane domain; LIR/GIM, LC3 interacting region/GABARAP‐interacting motif.
• I–K
  Co‐IP of UVRAG and truncated ER‐phagy receptor proteins, HA‐FAM134B 1–229 (I), GFP‐ATL3 446–524 (J), HA‐RTN3L 752–921 (K), which do not contain their main cytosolic domains.
• L–N
  Co‐IP of FLAG‐UVRAG with WT or LIR/GIM mutated (LIRm/GIMm) ER‐phagy receptor proteins. HEK293T cells were cultured in rich medium and co‐transfected with the indicated plasmids.
• O
  Quantification of the amount of WT or LIR/GIM mutated ER‐phagy receptor proteins co‐immunoprecipitated with UVRAG proteins. The amount of WT ER‐phagy receptor proteins co‐immunoprecipitated was normalized to one. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, *P < 0.05, **P < 0.01, ***P < 0.001; unpaired Student's t test.

Source data are available online for this figure.

To further determine the specific region within UVRAG 1–189 that mediates the interaction, we generated N‐terminal UVRAG mutants lacking either the PR domain (UVRAG 37–189) or amino acids 159–189 (UVRAG 1–158) (Fig 5A). Co‐IP experiments revealed that UVRAG 37–189 lost its ability to bind FAM134B, ATL3, or RTN3L, indicating that the PR domain is critical for the interaction (Fig 5E–G). This observation was further confirmed by Co‐IP experiments using a full‐length UVRAG with the deletion of the PR domain alone (Fig EV4E–G). Additionally, a fusion protein consisting of GFP fused to the UVRAG PR domain (GFP‐UVRAG 1–36) was able to immunoprecipitate with the ER‐phagy cargo receptors (Fig 5H–J), suggesting that the PR domain alone is sufficient for binding to these receptors. Collectively, these findings demonstrate that the N‐terminal PR domain of UVRAG is both necessary and sufficient for its interaction with ER‐phagy receptors.

We then examined whether the PR domain of UVRAG is crucial for its ability to drive ER‐phagy. To explore this, we generated several UVRAG mutants with deletions or point mutations within the PR domain. When these PR mutants of UVRAG were reintroduced into UVRAG knockout cells, they effectively rescued the macro‐autophagy defect (Fig 5K–M). However, assessment using the GFP‐Sec61β cleavage assay and flow cytometry analysis with RFP‐GFP‐KDEL demonstrated that ER‐phagy remained largely impaired, although slight rescue effects were observed (Fig 5N–P). Notably, the reintroduction of UVRAG‐6E into UVRAG knockout cell failed to rescue ER‐phagy (Fig 5P), indicating that the canonical function of UVRAG in PI3KC3‐II complex is crucial for completing ER‐phagy. These findings collectively indicate that while the PR domain of UVRAG is essential for ER‐phagy, it is dispensable for macro‐autophagy.

To determine the specific domains within ER‐phagy cargo receptors that are crucial for their interaction with UVRAG, we generated truncated forms of three receptors: FAM134B 1–229, ATL3 446–524, and RTN3 752–921 (Fig EV4H). Co‐IP experiments revealed that the truncated receptors lacking their main cytosol domains completely abolished their interaction with UVRAG (Fig EV4I–K). The LC3‐interacting region/GABARAP‐interacting motif (LIR/GIM), which are responsible for binding to Atg8 family proteins (LC3s and GABARAPs), are located within the cytosolic domains of these receptors (Fig EV4H). We then investigated whether the interaction between UVRAG and the receptors depends on the LIR/GIM. Co‐IP results demonstrated that UVRAG binds to the receptors regardless of LIR/GIM mutations (Fig EV4L–O). Collectively, these findings indicate that UVRAG interacts with the cytosolic domain of ER‐phagy cargo receptors through its N‐terminal PR domain, and this interaction is independent of the receptor's LIR/GIM.

UVRAG promotes the interaction between ER‐phagy cargo receptors and Atg8 family proteins

To understand the consequences of the interaction between UVRAG and ER‐phagy receptors, we examined whether UVRAG influences the binding of ER‐phagy cargo receptors to Atg8 family proteins. FAM134B and RTN3L are known to bind both LC3s and GABARAPs (Khaminets et al, 2015; Grumati et al, 2017), while ATL3 predominantly interacts with GABARAPs (Chen et al, 2019). Co‐IP experiments demonstrated that the interaction between FAM134B and LC3B was increased by starvation (Fig 6A, compare lane 1 with lane 2), and this increase was abolished in UVRAG knockout cells (Fig 6A, compare lane 2 with lane 4). Similar results were observed with ATL3 and RTN3L (Fig 6A). Conversely, overexpression of UVRAG resulted in enhanced interaction between FAM134B and LC3B (Fig 6B, compare lane 1 with lane 2, and E), reaching a level comparable to that induced by starvation alone (Fig 6B, compare lane 2 with lane 3, and E). Moreover, the combined effect of starvation and UVRAG overexpression was additive (Fig 6B, compare lane 4 with lanes 2 or 3, and E). Similar findings were observed for ATL3 (Fig 6C and F) and RTN3L (Fig 6D and G). Notably, UVRAG‐6E, which promotes ER‐phagy more efficiently than wild‐type UVRAG (Fig 2D, E, G and H) and exhibits stronger binding to ER‐phagy receptors (Fig EV4A–D), further enhanced the interactions between ER‐phagy receptors and Atg8 family proteins (Fig 6H–K). Collectively, our results suggest that UVRAG is necessary for the augmentation of interactions between ER‐phagy cargo receptors and Atg8 family proteins in response to starvation.

Figure 6. UVRAG enhances the interaction between the receptor proteins and Atg8 family proteins.

• A
  Co‐IP of LC3B/GABARAP with ER‐phagy receptor proteins (FAM134B, ATL3, or RTN3L) in WT or UVRAG‐KO U2OS cells treated with or without EBSS, in the presence of Baf‐A1 (250 nM), using antibodies against the receptors.
• B–D
  Co‐IP of HA‐tagged ER‐phagy receptors (FAM134B, ATL3, or RTN3L) with LC3B or GABARAP in U2OS cells co‐transfected with the indicated plasmids and treated with or without EBSS.
• E–G
  Quantification of the amount of LC3B/GABARAP co‐immunoprecipitated with HA‐FAM134B (B), HA‐ATL3 (C), and HA‐RTN3L (D). n = 3.
• H–J
  Co‐IP of LC3B or GABARAP with HA‐tagged ER‐phagy receptors (FAM134B, ATL3, or RTN3L) in U2OS cells co‐transfected with the indicated plasmids, using anti‐HA antibodies or IgG as a negative control.
• K
  Quantification of the amount of LC3B or GABARAP co‐immunoprecipitated with HA‐FAM134B (H), HA‐ATL3 (I), or HA‐RTN3L (J). The amount of LC3B or GABARAP co‐immunoprecipitated from cells transfected with FLAG‐UVRAG‐WT was normalized to one. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; ns, no significance, P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

UVRAG is essential for the oligomerization of ER‐phagy receptors

During the assembly of ERPHS, ER‐phagy receptors undergo oligomerization and cluster at distinct subdomains of the ER (Stolz & Grumati, 2019). FAM134B, for instance, has been reported to drive ER membrane scission for ER‐phagy through its homo‐oligomerization (Bhaskara et al, 2019; Jiang et al, 2020). We investigated whether UVRAG plays a role in regulating the oligomerization of its interacting ER‐phagy receptors. Native polyacrylamide gel electrophoresis (PAGE) immunoblotting revealed that UVRAG knockout impaired both basal‐level and starvation‐induced oligomerization of FAM134B (Fig 7A). This was evidenced by the drastic decrease of high‐molecular‐weight FAM134B on native PAGE, while the total protein levels of FAM134B on SDS–PAGE displayed no apparent changes (Fig 7A, compare lane 2 with lane 3, or compare lane 4 with lane 5). Similar results were observed for ATL3 and RTN3L (Fig 7B and C). Conversely, overexpression of UVRAG led to a significant increase in FAM134B oligomer formation (Fig 7D, compare lane 2 with lane 3), which was comparable to the effect of starvation (Fig 7D, compare lane 3 with lane 6). Notably, neither UVRAG overexpression nor starvation could promote the oligomerization of ER‐phagy receptors harboring LIR/GIM mutations (Fig 7D). These results indicate that the binding of ER‐phagy receptors with LC3s/GABARAPs is crucial for their oligomerization. Similar findings were observed for ATL3 and RTN3L (Fig 7E and F). Moreover, UVRAG overexpression resulted in increased ER fragmentation, likely attributable to the enhanced oligomerization of ER‐phagy receptors (Fig 7G and H). Collectively, our data demonstrate that the binding of LC3s/GABARAPs is crucial for ER‐phagy receptor oligomerization, which is promoted by UVRAG.

Figure 7. UVRAG is essential for the oligomerization of its interacting ER‐phagy cargo receptors.

• A–C
  Oligomerization of ER‐phagy receptors was detected via native PAGE immunoblotting using anti‐FAM134B (A), ATL3 (B), and RTN3L (C) antibodies. WT or UVRAG‐KO U2OS cells were treated under the indicated conditions and subjected to immunoprecipitation with anti‐FAM134B (A), ATL3 (B), and RTN3L (C) antibodies or IgG as a negative control. The protein levels in the input were analyzed by immunoblotting after SDS–PAGE.
• D–F
  Oligomerization of FAM134B (D), ATL3 (E), and RTN3L (F) was detected via native PAGE immunoblotting using anti‐HA antibodies. HEK293T cells were co‐transfected with the indicated plasmids, treated with or without starvation, and subjected to immunoprecipitation with anti‐HA antibodies or IgG as a negative control. The protein levels in the input were analyzed by immunoblotting after SDS–PAGE.
• G
  Confocal images of WT and UVRAG‐overexpressing U2OS cells grown in rich medium and immunostained for the ER using anti‐REEP5 antibodies. Scale bar, 10 μm.
• H
  Quantification of cells with fragmented ER based on the data in (G). N > 40 cells.
• I
  HEK293T cells were transfected with the indicated plasmids. Soluble and insoluble fractions were generated and processed as described in Materials and Methods. GAPDH was used as a loading control for the soluble proteins, while Ponceau S staining was used for the insoluble proteins.
• J
  Quantitative analysis of insoluble Myc‐Akita levels in (I). The amount of insoluble Myc‐Akita in cells transfected with empty vector (−)/NC was normalized to one. n = 3.
• K
  Analysis of soluble and insoluble Myc‐Akita levels in WT and UVRAG‐KO U2OS cells, similar to (I).
• L
  Quantitative analysis of the data in (K). The amount of insoluble Myc‐Akita in WT cells was normalized to one. n = 3.

Data information: n represents the number of biological repeats. Error bars represent SEM; **P < 0.01, ****P < 0.0001; unpaired Student's t test.

Source data are available online for this figure.

UVRAG‐mediated ER‐phagy promotes the clearance of prohormone aggregates

Finally, we aimed to investigate the potential pathological significance of UVRAG‐mediated ER‐phagy using Akita proinsulin as a substrate. Akita proinsulin is a mutant form of proinsulin that leads to diabetes in young individuals. Due to improper folding, Akita tends to aggregate and become trapped in the ER, resulting in reduced insulin production. Previous studies have demonstrated that RTN3L‐dependent ER‐phagy contributes to the clearance of Akita aggregates (Grumati et al, 2017; Cunningham et al, 2019; Chen et al, 2021). In RTN3 knockdown cells, insoluble Akita aggregates significantly increased (Cunningham et al, 2019). Since we observed an interaction between UVRAG and RTN3L during ER‐phagy, we examined whether UVRAG could promote the clearance of Akita proinsulin. In cells transfected with a UVRAG‐expressing plasmid, we observed a significant decrease in the level of insoluble Akita aggregates (Fig 7I and J). Conversely, UVRAG knockout cells showed an accumulation of insoluble Akita aggregates (Fig 7K and L). These findings suggest that UVRAG‐mediated ER‐phagy may play a role in facilitating the disposal of pathogenic prohormone aggregates, such as mutated proinsulin.

Discussion

The ER is the largest organelle in eukaryotic cells and consists of interconnected membranes. ER‐phagy specifically occurs at distinct sites within the ER, known as ER‐phagy sites (ERPHS). Various sequential events take place at the ERPHS during the induction of ER‐phagy, including the sorting of aggregation‐prone proteins by chaperones, the concentration and oligomerization of ER‐phagy cargo receptors, and the recruitment of core autophagy machinery to initiate the formation of the phagophore surrounding the ERPHS (Cui et al, 2019; Forrester et al, 2019; Stolz & Grumati, 2019; Chen et al, 2021). However, the coordination of these events remains largely unknown. In our study, we identified UVRAG as a novel player in ER‐phagy that regulates multiple steps in the assembly of ERPHS (Fig EV5). Upon induction of ER‐phagy, the expression of UVRAG is upregulated, leading to the formation of more punctate structures. UVRAG puncta localize to specific ER subdomains and interact with specific ER‐phagy cargo receptors, namely, FAM134A/B/C, ATL3, and RTN3L. As a result, UVRAG enhances the interaction between cargo receptors and Atg8 family proteins. Furthermore, UVRAG drives the oligomerization of its interacting cargo receptors, in a manner dependent on enhanced recruitment of Atg8 family proteins. The oligomerized receptors facilitate the scission of ER fragments from the ER network and the recruitment of Atg8 not only promotes the formation of the autophagosome but also potentially generates pulling forces that lead to the pinching off and fragmentation of the ER (Popelka & Klionsky, 2022). In this way, UVRAG promotes the efficient targeting of ER fragments into the autophagosome.

Figure EV5. UVRAG possesses dual functions in ER‐phagy.

Firstly, UVRAG plays a critical role in initiating ER‐phagy by driving the formation of ER‐phagy site (ERPHS). Upon cellular starvation, UVRAG expression level increases, leading to the formation of more punctate structures. These UVRAG puncta localize to specific ERPHS, where aggregation‐prone proteins are sorted by cargo adaptors. At the ERPHS, UVRAG interacts with cargo receptors, such as FAM134B, ATL3, and RTN3L. As a result, UVRAG enhances the interaction between cargo receptors and Atg8 family proteins (LC3/GABARAP). Furthermore, UVRAG drives the oligomerization of cargo receptors. Through these interactions and activities, UVRAG drives the assembly of ERPHS, facilitates the scission of ER membranes, and promotes the engulfment of ER fragments by the autophagosome. Secondly, UVRAG facilitates the maturation of ER‐containing autophagosomes and the fusion with lysosomes as a component of PI3KC3‐II. Both functions are essential for ER‐phagy.

An unexpected discovery from our research is that the specific role of UVRAG in ER‐phagy initiation can be distinguished from its well‐characterized function as a subunit of PI3KC3‐II through its binding with Beclin‐1. This conclusion is supported by two lines of evidence. Firstly, UVRAG‐6E, a mutant of UVRAG that lacks Beclin‐1 binding ability, still retains the capacity to bind ER‐phagy receptors and promote ER‐phagy, exhibiting even higher efficiency than wild‐type UVRAG. The findings that the UVRAG mutant lacking the entire Beclin‐1‐interacting CC domain still binds ER‐phagy receptors further corroborate the data observed with UVRAG‐6E. Secondly, the N‐terminal PR domain of UVRAG, which does not participate in Beclin‐1 binding, is essential and sufficient for the interaction with ER‐phagy receptors. Functionally, the PR domain plays a critical role in ER‐phagy but is not required for macro‐autophagy. Therefore, our results indicate that UVRAG possesses dual functions in ER‐phagy (Fig EV5). On the one hand, it facilitates the assembly of ERPHS during the early stages. On the other hand, as a component of PI3KC3‐II, it potentially contributes to the maturation of ER‐containing autophagosomes and their fusion with lysosomes. The function of UVRAG in ER‐phagy appears to be evolutionarily conserved, because deleting VPS38 (the yeast orthologue of UVRAG) also impairs ER‐phagy (Chen et al, 2020).

Furthermore, our findings revealed that UVRAG plays a role in the assembly of ERPHS not only in sheet ER but also in tubular ER, highlighting its versatility as an ER‐phagy regulator. This versatility stems from its ability to interact with FAM134A/B/C, which are involved in sheet ER‐phagy, as well as ATL3 and RTN3L, which are established players in tubular ER‐phagy. As a result, UVRAG contributes to the turnover of both CLIMP63‐positive sheets and REEP5‐enriched tubules. Intriguingly, our results showed that UVRAG does not bind to other ER‐phagy receptors we tested, namely, CCPG1, SEC62, CALCOCO1, or TEX264, specifically. The reason for UVRAG's preference in binding with different cargo receptors remains unclear. We conducted bioinformatic analyses of the primary sequences of these receptors, to check for unique amino‐acid sequences that allow this binding. The analysis revealed that the only shared domain among these receptors is the reticulon‐homology domain, which is responsible for their insertion into the ER membrane. However, no obvious commonality was identified within the cytosolic domains that interact with UVRAG. A more advanced analysis based on structural information could potentially provide further insights into the unique amino‐acid sequences facilitating the binding between UVRAG and these specific ER‐phagy receptors. Additionally, we examined the expression patterns of UVRAG and the receptors in various mouse tissues to explore any potential correlation between expression patterns and binding specificity. Unfortunately, we have not yet discovered any definitive clues. Furthermore, investigation is warranted to unravel the underlying mechanisms behind UVRAG's binding preference for different cargo receptors. Moreover, conducting investigations with high‐resolution microscopy and electron microscopy could yield more comprehensive insights into how UVRAG facilitates the initiation of ER‐phagy.

In summary, our study unveils UVRAG as a novel and versatile participant in ER‐phagy, shedding light on its comprehensive regulation of the sequential events involved in ERPHS assembly. Notably, we also demonstrate the crucial role of UVRAG‐mediated ER‐phagy in preventing the accumulation of insoluble aggregates of Akita proinsulin. These findings highlight the potential therapeutic significance of targeting UVRAG in the treatment of diabetes or other diseases resulting from the aggregation of mutated proteins in the ER.

Materials and Methods

Vector construction

Sequences encoding human UVRAG, FAM134A, FAM134B, FAM134C, ATL3, RTN3L, CCPG1, SEC62, TEX264, and CALCOCO1 were amplified from the cDNA of HEK293T cell and cloned into the following vectors for transient gene expression, pCMV‐3xFLAG, pcDNA3‐3xHA, pRK‐HA, pGFP‐C1, or pmCherry‐C1. Site‐directed mutagenesis strategy was used to generate the UVRAG‐6E (L233E/L240E/L247E/L251E/L265E/L272E), UVRAG‐P10A/P12A, UVRAG‐P14A/P15A/P16A/P18A, and UVRAG‐P23A/P24A/P36A mutations. FAM134B LIRm, ATL3 2GIMm, and RTN3L 6LIRm were synthesized by Sango Biotech. To construct various truncated mutants, UVRAG‐FL, UVRAG 1–36 aa, UVRAG 1–158 aa, UVRAG 1–189 aa, UVRAG 37–189 aa, UVRAG 1–330 aa, UVRAG 1‐330ΔC2 aa, UVRAG 331–699 aa, UVRAG ΔPR (Δ2‐36 aa), UVRAG Δ10‐18 aa, UVRAG Δ19‐27 aa, UVRAG Δ28‐36 aa, FAM134B 1–229 aa, ATL3 446–524 aa, and RTN3L 752–921 aa were amplified and cloned into pCMV‐3xFLAG, pCDH‐CMV‐MCS‐EF1α‐Hygro, pcDNA3‐3xHA, pGFP‐C1, or pmCherry‐C1. The plasmids were extracted using the Endo‐Free Plasmid Mini Kit II (Omega, D6950‐02). All plasmids used in the manuscript were verified by sequencing and reported in Table EV1.

Cell culture, transfection, and starvation

U2OS, Hela, and HEK293T cells were cultured in high glucose (4,500 mg/l) Dulbecco's modified Eagle's medium (DMEM, GIBCO, C11965500BT) supplemented with 10% FBS (GIBCO, 10270106) and 1% Penicillin–Streptomycin (Sangon Biotech, E607011‐0100) at 37°C in a humidified atmosphere of 5% CO₂.

Lipofectamine 3000 (Invitrogen, L3000015) was used to transiently transfect cells when they reached 50–70% confluence. After transfection for 8 h, the medium was replaced with fresh medium. Nutrition starvation was performed by washing the cells three times with phosphate‐buffered saline (PBS, GIBCO, C10010500BT) before they were shifted into Earle's balanced salt solution (EBSS, GIBCO, 24010043) and cultured for the indicated time. Cells were treated with Bafilomycin A1 (Baf‐A1, Sangon Biotech, A601116‐0025), Torin 2 (Sigma, SML1224), MG132 (Selleck, S2619), CCCP (MCE, HY‐100941) for the indicated concentration and time.

Immunoblotting

Cells were cultured to 70–90% confluence in 6‐ or 12‐well plates. After removing the medium, the cells were washed three times with PBS and lysed with RIPA buffer (50 mM Tris–HCl pH 7.4, 150 mM NaCl, 1% Triton X‐100, 10 mM NaF, 1 mM EDTA, and proteinase inhibitor cocktail [Roche, 4693132001]) for 30 min at 4°C. Cell lysates were collected by cell scrapers and centrifuged at 12,000 g for 30 min at 4°C. The supernatant was collected and boiled in 2 × SDS loading buffer (100 mM Tris–HCl pH 6.8, 4% SDS, 200 mM dithiothreitol, 0.2% bromophenol blue, and 20% glycerol) for 10 min at 98°C.

Protein samples were separated using SDS–PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, 0.45 μm, IPVH0001). The membranes were blocked with 5% skimmed milk in TBST (TBS + 0.1% Tween‐20) and then probed with primary antibodies for 2 h and peroxidase‐conjugated goat anti‐rabbit or mouse IgG (H + L) secondary antibodies for 45 min at room temperature. The membranes were incubated with ultra‐sensitive chromogenic solution (Meilunbio, MA0186) for 10 ~ 30 s and then exposed and analyzed through BIO‐RAD ChemiDoc MP Imaging System.

Immunofluorescence staining and fluorescence microscopy

The complete list of primary antibodies used for the experiments is reported in Table EV2. For fluorescence microscopy, cells were grown on a coverslip to 70–80% confluence, then starved in EBSS for 2 h, either untreated or treated with 250 μM Baf‐A1 for 2 h. Then, the coverslips were washed three times with PBS and fixed with 4% paraformaldehyde (Sigma, P6148‐500G) at room temperature for 15 min. Then, the coverslips were washed three times with PBS and mounted with a drop of antifade mounting medium with DAPI (Sigma, F6057‐20ML). Finally, the coverslips were sealed with nail polish and observed under a confocal microscope (ZEISS, LSM880) equipped with 63× oil objective lens.

For immune‐fluorescence staining, U2OS cells were transfected with the indicated plasmids, grown to 70–80% confluence on a coverslip. Cells were either untreated or treated with EBSS for 2 h. The coverslips were washed three times with PBS and then fixed with 4% paraformaldehyde at room temperature for 15 min and washed three times with PBS. Samples were permeabilized with 0.1% Triton X‐100 (Sigma, X100‐5ML) in PBS for 15 min, then washed three times with PBS and blocked with 10% goat serum (AntGene, ANT052) in PBST (PBS + 0.1% Triton X‐100) at room temperature for 2 h. Subsequently, the coverslips were incubated with corresponding primary antibodies overnight at 4°C. Then, the coverslips were washed three times with PBS and incubated with fluorescent‐dye conjugated secondary antibodies at room temperature for 1 h. Then, the coverslips were washed three times with PBS and mounted with a drop of antifade mounting medium with DAPI. Finally, the coverslips were sealed with nail polish and observed under a confocal microscope (ZEISS, LSM880) equipped with 63× oil objective lens.

Native co‐immunoprecipitation

Cells were cultured to 80–90% confluence in 10 cm dishes. After removing the medium, the cells were washed for three times with PBS, and lysed with Nondenature Lysis Buffer (Sangon Biotech, C510013) for 30 min at 4°C. Cell lysates were collected by scrapers and centrifuged at 12,000 g for 30 min at 4°C, and an aliquot of 100 μl was taken out as the input sample to for SDS–PAGE and immunoblotting. The supernatant left was incubated with primary antibodies overnight and then incubated with Protein A/G magnetic beads (Biolinkedin, L‐1004/L‐1004A) for 2 h at 4°C. The beads were collected and washed with PBS for three times. Then, the immune‐precipitates were eluted from the beads by 1 × Native loading buffer (30 mM Tris–HCl pH 6.8, 10% glycerol, 0.5% bromophenol blue) and then subjected to native PAGE and immunoblotting.

Co‐immunoprecipitation

Cells were cultured to 80–90% confluence in 10 cm dishes. After removing the medium, the cells were washed three times with PBS and lysed with RIPA buffer for 30 min at 4°C. Cell lysates were collected by cell scrapers and centrifuged at 12,000 g for 30 min at 4°C. The supernatant was collected and the protein concentration was measured using the Protein Assay kit (Yeasen, 20201ES86), and an aliquot of 100 μl was taken out as the input sample for immunoblotting. The supernatant left was incubated with primary antibodies overnight, and then incubated with Protein A/G magnetic beads (Biolinkedin, L‐1004/L‐1004A) for 2 h at 4°C. The beads were collected and washed with PBS for three times, then with RIPA lysis buffer for three times. Then, the immune‐precipitates were eluted from the beads by adding and boiling with 2 × SDS loading buffer for 10 min at 98°C and then subjected to SDS–PAGE and immunoblotting.

Immunoprecipitation mass spectrometry (IP‐MS)

For analysis of UVRAG interactome, HEK293T cells transfected with FLAG‐UVRAG plasmid were either untreated or starved for 2 h, then lysed with NP‐40 lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1% NP‐40, 2 mM sodium pyrophosphate, 25 mM β‐glycerophosphate, 1 mM EDTA, 1 mM Na₃VO₄, 0.5 μg/ml leupeptin) and centrifuged at 14,000 g for 10 min to remove insoluble materials. The supernatant was incubated overnight with FLAG antibody (Sigma, F1804‐1MG) and then incubated with Protein A/G magnetic beads (Biolinkedin, L‐1004/L‐1004A) for 2 h at 4°C. The immunoprecipitates were washed three times in washing buffer (10 mM HEPES‐NaOH, pH 7.5, 150 mM NaCl, and 0.1% Triton X‐100), and then incubated in reaction buffer (1% SDC, 100 mM Tris pH 8.5, 10 mM Tris (2‐carboxyethyl) phosphine, 40 mM chloroacetamide) at 95°C for 10 min. Then, the supernatant was collected and subjected to tryptic digestion at 37°C. TFA was added to stop the overnight digestion. Finally, the peptide samples were purified using self‐made C18 desalting columns and then vacuum dried and stored at −20°C for later analysis. LC–MS/MS was carried out on a Q Exactive HF‐X mass spectrometer coupled with an Easy‐nLC 1200 system.

Flow cytometry

Cells were co‐transfected with ssRFP‐GFP‐KDEL/RFP‐GFP‐LC3B and other indicated plasmids, then subjected to indicated treatments. Then, the cells were collected and suspended in PBS, and analyzed by flow cytometry (BD LSRFortessa X‐20). The data were processed by FlowJo software. The RFP signal was excited by a 561‐nm laser and acquired with the FL3 filter. The GFP signal was excited by a 488‐nm laser and acquired with the FL1 filter. At least 10,000 cells were measured for each sample. The 561/488 nm ratio distribution graph was processed by Prism software after the 488 and 561 nm fluorescence intensity of individual cells was counted. Autophagic flux was determined by the ratio change in the median fluorescence intensity of RFP: GFP.

Quantitative reverse transcription polymerase chain reaction (qRT–PCR)

Total RNA was isolated using TRIzol (Invitrogen). 0.5 μg total RNA was reversely transcribed into cDNA using the TransScript Reverse Transcriptase (HiScript III RT SuperMix, Vazyme, R323‐01). 0.5 μg cDNA served as the template for quantitative PCR analysis using the ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711‐02) and Real‐Time PCR System (Bio‐Rad). Primers for specific genes are listed as follows: Human UVRAG, 5′‐TGACAATTCGTTGCAGGCAGTTA‐3′ and 5′‐AGGCAACTTGACACCGCATACA‐3′; Human β‐actin, 5′‐CACCATTGGCAATGAGCGGTTC‐3′ and 5′‐AGGTCTTTGCGGATGTCCACGT‐3′.

Generation of UVRAG knockout cell lines using CRISPR‐Cas9 gene editing

UVRAG knockout cell lines were generated using the CRISPR‐Cas9 lentiviral system. Four different gRNA guides specific for UVRAG were designed. The complete list of gRNA guides is reported below. gRNA 1: 5′‐TATGAATTATAGGATATCTG‐3′ (targeting exon 12), gRNA 2: 5′‐GAGCGCCTCCGCGTCGGTCG‐3′ (targeting exon 1), gRNA 3: 5′‐TGCATGTGGAGCTGCCGTCT‐3′ (targeting exon 1), gRNA 4: 5′‐ACTTTACACTTCACTTGTGT‐3′ (targeting exon 2). These gRNA guides were cloned into lenti‐CRISPR vectors with different drug resistances (lenti‐CRISPR‐V2‐Blast and lenti‐CRISPR‐V2‐Puro). In particular, gRNA 1 was ligated into the gRNA vector lenti‐CRISPR‐V2‐Blast; gRNA 2, gRNA 3, and gRNA 4 were ligated into the gRNA vector lenti‐CRISPR‐V2‐Puro. To generate knockout cell line efficiently, combinations of two different gRNAs were used (gRNA 1 + gRNA 2, gRNA 1 + gRNA 3, gRNA 1 + gRNA 4).

These three gRNA combinations were packaged into lentivirus using HEK293T cells. Briefly, HEK293T cells were grown in 3 ml DMEM media supplemented with 10% FBS in six‐well plates until they reached 60–80% confluence. Each plate was then transfected with different lentiviral plasmids, containing the Cas9 and the sgRNA guides combinations, together with two packaging vectors, pxPAX2 and VSV‐G. The supernatant containing lentivirus was collected after 48 h and filtered with 0.45‐μm filter. Then, the supernatant was used to infect the U2OS cells. After 8 h of infection, cells were selected using fresh DMEM media containing 1.0 μg/ml puromycin (further reduced to 0.4 μg/ml for the maintenance) and 20 μg/ml blasticidin (further reduced to 5 μg/ml for the maintenance) for 4 days, until the wild‐type cells treated with the same antibiotics all died. All antibiotic selections were performed for at least three passages to ensure complete selection. Cells were screened by immunoblotting with UVRAG antibodies (MBL, M160‐3) to verify knockout. Here, three different UVRAG knockout cell lines were generated, UVRAG‐KO‐1 (sgRNA 1 + sgRNA 2), UVRAG‐KO‐2 (sgRNA 1 + sgRNA 3), and UVRAG‐KO‐3 (sgRNA 1 + sgRNA 4).

Separation of soluble and insoluble Akita proinsulin

The soluble/insoluble components of Akita proinsulin were extracted by Soluble & Insoluble Protein Extraction Kit (Sangon Biotech, C500071). Briefly, the U2OS cells were subjected to ice‐cold hypotonic solution supplemented with protease and phosphatase inhibitors, and incubated on ice for 15 min, then centrifuged at 22,800 g for 60 min at 4°C. After centrifugation, the supernatant containing the soluble proteins was transferred to a new tube. Then, extraction buffer was added into the remaining pellet to dissolve the insoluble proteins. At the end, both the soluble and insoluble proteins were boiled in 2 × SDS loading buffer for 10 min at 98°C, then subjected to SDS–PAGE and immunoblotting.

Statistical analysis

Statistical analyses and data plotting were performed using GraphPad Prism 6. All experiments were performed in at least three independent biological replicates. Data are presented as mean ± SEM. Statistical analysis of two experimental groups was performed using unpaired two‐tailed Student's t test, and statistical significance was considered at test level P < 0.05. Statistical details for each experiment including P and n values were provided in the figure and figure legends.

Author contributions

Xuehong Qian: Conceptualization; data curation; software; formal analysis; validation; investigation; visualization; methodology; writing – original draft; writing – review and editing. Lingang He: Data curation; formal analysis; validation; investigation; methodology; writing – original draft; writing – review and editing. Jiejie Yang: Data curation; formal analysis; investigation; methodology; writing – original draft. Jiajia Sun: Data curation; formal analysis; investigation; methodology; writing – original draft. Xueying Peng: Investigation; methodology. Yuting Zhang: Investigation; methodology. Yizhou Mao: Data curation; formal analysis; investigation; methodology; writing – original draft. Ying Zhang: Data curation; formal analysis; investigation; methodology; writing – original draft. Yixian Cui: Conceptualization; supervision; funding acquisition; validation; methodology; writing – original draft; writing – review and editing.

Disclosure and competing interests statement

The authors declare that they have no conflict of interest.

Supporting information

Expanded View Figures PDF

Table EV1

Table EV2

Table EV3

Source Data for Expanded View

PDF+

The EMBO Journal (2023) 42: e113625

Data availability

All data porting this study are included in the main text and EV Figures. The MS raw data are available at https://www.iprox.cn/page/home.html. Microscopic image data have been deposited at BioImage with the dataset identifier S‐BIAD888 (https://www.ebi.ac.uk/biostudies/studies/S‐BIAD888).§