Abstract
Background
We have recently identified a novel virus detected in alfalfa seed material. The virus was tentatively named alfalfa-associated potyvirus 1, as its genomic fragments bore similarities with potyvirids. In this study, we continued investigating this novel species, expanding information on its genomic features and biological characteristics.
Methods
This research used a wide range of methodology to achieve end results: high throughput sequencing, bioinformatics tools, reverse transcription-polymerase chain reactions, differential diagnostics using indicator plants, virus purification, transmission electron microscopy, and others.
Results
In this study, we obtained a complete genome sequence of the virus and classified it as a tentative species in the new genus, most closely related to the members of the genus Ipomovirus in the family Potyviridae. This assumption is based on the genome sequence and structure, phylogenetic relationships, and transmission electron microscopy investigations. We also demonstrated its mechanical transmission to the indicator plant Nicotiana benthamiana and to the natural host Medicago sativa, both of which developed characteristic symptoms therefore suggesting a pathogenic nature of the disease.
Conclusions
Consistent with symptomatology, the virus was renamed to alfalfa vein mottling virus. A name Alvemovirus was proposed for the new genus in the family Potyviridae, of which alfalfa vein mottling virus is a tentative member.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12985-023-02250-5.
Keywords: Plant viruses, Positive-strand RNA viruses, Potyviridae, Alfalfa vein mottling virus, Alvemovirus, Alfalfa (Medicago sativa L.)
Background
Research on alfalfa (Medicago sativa L.), a major forage crop worldwide, greatly benefited from the latest advances in high throughput sequencing (HTS) technologies that enabled the completion of its genome assembly [1] revealing new insights into the mechanisms of the crop’s resistance to abiotic and biotic stresses [2–5], identification of genetic markers associated with important agronomic traits [6–8] and discovery of numerous microorganisms infecting alfalfa, primarily viruses [9–12]. Viruses were found to be an integral part of multi-pathogenic infections collectively forming the alfalfa pathobiome, a diverse community of pathogenic microbes within the biotic environment of the plant [13, 14]. Recently, during the initial seed screenings of alfalfa germplasm accessions maintained by the USDA ARS National Plant Germplasm System (NPGS), we have detected a broad range of viruses in the mature seeds of different germplasm sources [15]. Among them were fragments of a poty-like virus with a genomic organization typical for Potyviridae that shared ~ 26–32% identity with a few members of the family. Therefore, the virus was provisionally named alfalfa-associated potyvirus 1 (AaPV1), [15]. In the present study, aimed at surveying alfalfa varieties grown in the U.S. to identify, characterize, and prevent the spread of novel and emerging viruses in the country, AaPV1 was found in plant samples collected from commercial alfalfa fields in Arizona, USA. A complete genome of the virus was assembled from overlapping sets of contigs and phylogenetic relationships with other members of the family Potyviridae were established. The virus was further categorized as a novel species, tentatively related to the genus Ipomovirus and potentially representing a new genus in the family Potyviridae. Consistent with symptomatology in the natural host Medicago sativa L., the virus was designated as alfalfa vein mottling virus (AVMV), a representative member of a new taxon, provisionally named Alvemovirus.
Materials and methods
Plant material
Five alfalfa plants (stems and leaves) were sampled from each of the four different fields, 10–15 acres in size, located in Yuma Country, Arizona, USA. Geographic coordinates of the alfalfa fields and the adjacent crops are shown in Table 1.
Table 1.
Geographic locations of alfalfa fields
| Alfalfa fields, No | GPS coordinates | Adjacent crops | No. of plants collected |
|---|---|---|---|
| 24E | 32° 40′ 56.58"N 114° 13′ 42.72"W | Cantaloupe, lettuce, cauliflower | 5 |
| 32E | 32° 42′ 38.62"N 114°05′ 28.21″ W | Cantaloupe, cauliflower, spinach | 5 |
| 43E | 32° 47′ 11.44"N 113° 54′ 15.81"W | Cantaloupe, lettuce, broccoli, cauliflower | 5 |
| 51E | 32° 46′ 42.26"N 113° 45′ 20.89"W | Cantaloupe, lettuce | 5 |
Total RNA extraction and RNA sequencing
Five leaves were pooled from each of the 20 plants for RNA extraction. Total RNA was extracted using Promega Maxwell® RSC Plant RNA Kit (Promega Corp., Fitchburg, WI) according to the manufacturer’s directions. cDNA libraries were prepared using Illumina TruSeq Stranded Total RNA with the Ribo-Zero Library Prep Kit (Illumina Inc., San Diego, CA USA) and RNA sequencing was performed by Psomagen (Psomagen Inc., Rockville MD USA) on a NovaSeq6000 S4 platform (150PE, 1Gb, 20 million total reads).
Bioinformatic analysis
A schematic representation of the bioinformatics pipeline used in this study is shown in Fig. 1. Briefly, sequence reads were first trimmed using Trimmomatic [16], followed by their assembly with SPAdes [17]. The resulting contigs were screened using BLASTx searches [18] against a virus database containing all plant virus protein sequences from the NCBI RefSeq database (https://www.ncbi.nlm.nih.gov/refseq/). The potential plant viral hits were searched once again using BLASTx against the full NCBI nr protein database. BBMap [19] was used to generate sequencing coverage values for the identified contigs. For the prediction of cleavage sites for viral proteases, polyproteins from 109 different members of the family Potyviridae were aligned by four different Multiple Sequence Alignments (MSA) software applications: ClustalW, ClustalO, MUSCLE, and CLC Genomics Workbench 23, very accurate setting (QIAGEN LLC, Germantown MD USA). Cleavage sites obtained by each MSA method were compared and the most likely sites were selected by another comparison with previously reported consensus sites [20].
Fig. 1.
Bioinformatics pipeline
5’RACE and Reverse transcription–polymerase chain reactions (RT-PCR)
5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions. Gene-specific primers for amplification were LN1074, 5’ GATTATCTGATTGGTTACCACAGAACTGGC 3’ (reverse, pos. 361–390 nt) and LN1115 5’ TGATCTCAAGGTGATTATCTGATTGGTTAC 3’ (reverse, pos. 373–402 nt). Total RNA for RT-PCRs was extracted using TRIzol Reagent and reactions were performed using the SuperScript One-Step RT-PCR System or SuperScript™ III First-Strand Synthesis System following by PCR amplification with AmpliTaq Gold DNA Polymerase under conditions recommended by the manufacturer (Thermo Fisher Scientific Inc., Waltham, MA USA). Negative control reactions were performed with RNA obtained from uninfected N. benthamiana or with sterile RNAse-free water processed for cDNA preparation the same way as RNA extracted from the infected alfalfa plants. Three virus-specific sets of primers were designed based on the results of the HTS analysis: 1) LN1077/LN1078 (forward, 5’ CTCCCTTTGGTACTCGGTATTG, 3′, pos. 7468–7489, and reverse, 5′ CTCTAATGTGCGGACCTTTCT 3′, pos. 7861–7881, size 414 bp); 2) LN1079/LN1080 (forward, 5′ TGACAGCGAGTTCTCATTCC 3′, pos. 8954–8973, and reverse, 5′ GTCAGTCAAACCAGCCTTTATTC 3′, pos. 9589–9611, size 658 bp); 3) LN1095/LN1096 (forward, 5′ CCAGGGTGTTGTTGATGATTTG 3′, pos. 3965–3986, and reverse, 5′ TCTCAGTCACATTCCGCATAAA 3′, pos. 4368–4389, size 425 bp). PCR products were either sequenced directly or cloned into the TOPO II vector (Thermo Fisher Scientific Inc., Waltham, MA USA) and sequenced.
Phylogenetic analysis
Phylogenetic analysis was performed with polyproteins from selected members of the family Potyviridae. Sequences were aligned with Clustal W and the unrooted tree was built with RAxML-NG [21] using the maximum likelihood algorithm, a maximum of 1000 bootstrap replicates, and bootstopping (autoMRE, cutoff: 0.030000). Boostrapping converged after 150 replicates.
Mechanical inoculation of Nicotiana benthamiana Domin. and alfalfa (Medicago sativa L.) plants
Symptomatic leaves from field alfalfa plants were homogenized in cold 20 mM potassium phosphate buffer, pH 7.0, using a sterile mortar and pestle. The resulting suspension was briefly centrifuged to precipitate plant debris and ten microliters of the supernatant were rubbed onto carborundum-dusted leaves of three-weeks old N. benthamiana plants using sterile inoculating loops. Carborundum-dusted leaves of the three weeks-old seedlings of two alfalfa cultivars, cv. CUF 101 and cv. Maverick, were rub-inoculated with purified viral preparations using sterile inoculating loops.
Virus purification
The virus was partially purified from 20 g of symptomatic N. bentamiana leaves precisely as described in the protocol developed for Poinsettia mosaic virus [22]. Briefly, symptomatic N. benthamiana leaves were homogenized in 0.07 M phosphate buffer (pH 7.2) containing 0.I % mercapto-acetic acid. Plant debris was removed by squeezing through cotton cloth, and the sap was mixed with n-butanol to 8% (v/v). After 30 min at 18°C, the mixture was used for one cycle of differential centrifugation (20 min at 12 000 g; 90 min at 65 000 g) and the final pellet was resuspended in 0.03 M phosphate buffer [22].
Transmission electron microscopy
For transmission electron microscopy (TEM), copper TEM grids were incubated on the drop of purified viral preparation for 2 min, rinsed with one milliliter of sterile water and stained with 1% phosphotungstic acid (PTA) solution. The grids were examined in a Hitachi H-7700 Electron Microscope at the Electron and Confocal Microscope Unit, Beltsville Agricultural Research Center.
Results
Symptoms displayed on the infected alfalfa plants
According to the results of HTS, eight out of 20 plants examined (40%) originating from three different alfalfa fields, were infected with the virus resembling AaPV1. These plants displayed a variety of virus-like symptoms including mottling, chlorosis, vein clearing, and bright yellow blotches (Fig. 2). The symptoms were likely triggered by multiple co-infecting pathogens, including the virus in question [14].
Fig. 2.

Diverse symptomatology of alfalfa plants in the field. A, asymptomatic plants. B-D, plants displaying different virus-like symptoms
Viral genome assembly and structure
Assembled contigs generated from each of the eight plants exceeded 9–10 kb in length and represented variants of the same virus (Additional file 1: Table S1). The longest contig with 4940 × per-nt average coverage consisted of 10,323 nucleotides (nt) and included a poly (A) tail, thus indicating that the 3’-terminal portion of the viral genome is complete. Multiple 5’RACE reactions adjusted the HTS-derived length of the viral genome to 10,037 nt, excluding the poly(A) tail (75 nt). According to the sequenced 5’RACE PCR products, the 5' non-coding region of the virus contains 107 nt; an open reading frame (ORF) encoding a large polyprotein comprises 9732 nt (108–9839 nt); and the 3' non-coding region of the virus appears complete, encompassing 198 nt (9840–10,037) without the poly (A) tail.
In a PSI-BLAST search, the top three hits for the viral polyprotein (excluding AaPV1 submissions) were: eggplant ipomovirus A (GenBank ID: BCG55390.1; 32.8% identity, query cover 78%; E-value = 0.0); the roymovirus, rose yellow mosaic virus (GenBank ID: BBI90117.2; 31.6% identity; query cover 87%; E-value = 0.0); and Potyvirus spp. polyprotein (GenBank ID: QHB15167.1; 31.3% identity, query cover 85%; E-value = 0.0). Among other hits were squash vein yellowing virus (genus Ipomovirus; GenBank ID: AEV45694.1; 34,4% identity; query cover 65%, E-value = 0.0); chili ringspot virus (genus Potyvirus; GenBank ID: APW85806.1; 28.7% identity; query cover 79%; E-value = 0.0), and numerous species from different genera of the family Potyviridae.
The InterPro tool for functional analysis of proteins [23], predicted nine protein domains in the viral ORF: Potyviridae P1 protease domain (IPR002540); Helper component proteinase domain (PR001456); Protein P3 of potyviral polyprotein (IPR039560); Superfamilies 1 and 2 helicase ATP-binding type-1 domain (IPR014001); Superfamilies 1 and 2 helicase C-terminal domain (IPR001650; Potyviridae polyprotein domain (IPR013648); Potyvirus NIa protease (NIa-pro) domain (IPR001730); Viral RNA-dependent RNA polymerase domain (IPR001205); and Potyvirus coat protein domain (IPR001592). The tentative genome structure of the virus and predicted cleavage sites, obtained by multiple alignment of 109 different potyvirids, are shown in Fig. 3.
Fig. 3.
Tentative genome structure of the new virus infecting alfalfa. Black arrow heads indicate putative cleavage sites in the polyprotein. Numbers under the genome map indicate predicted amino acid positions of the cleavage sites. P1: protein 1 protease; P3: protein 3; Hc-Pro: helper component proteinase; PIPO: Pretty Interesting Potyviridae ORF (Chung et al. 2008); 6K1: 6 kDa peptide 1; CI: cylindrical inclusion protein; 6K2: 6 kDa peptide 2; VPg: virus protein genome-linked; Nia-Pro: nuclear inclusion a protease; NIb: nuclear inclusion protein b, RNA-directed RNA polymerase; CP: coat protein
The virus does not appear to have a highly conserved G1-2 A6-7 motif preceding overlapping PIPO ORF characteristic for Potyviridae and located within the P3 cistron [24], Instead, there is an A7 motif, which is embedded in the overlapping ORF, presumably (according to the ORF Finder; https://www.ncbi.nlm.nih.gov/orffinder/) starting at the position 3122 nt (+ 3 ORF relative to the polyprotein) and followed by 63 codons with a termination codon TGA at pos. 3311–3313.
Phylogenetic analysis
Phylogenetic analysis deduced from the alignment of the viral polyprotein and representative polyproteins of different members of the family Potyviridae, clustered the virus into a distinct outgroup, branching from the genus Ipomovirus (Fig. 4). This concurs with the significant divergence of the viral genomic and amino acid sequences from other members of the genus and likely indicates that the virus should be classified as member of a new, not yet established, genus in the family Potyviridae.
Fig. 4.
Phylogenetic relationships of alfalfa vein mottling virus with other members of the family Potyviridae. The unrooted tree was deduced from the Clustal W alignment and built with RaxML-NG [18] tool using maximum likelihood algorithm, 1000 bootstrap replicates and bootstopping (autoMRE, cutoff: 0.030000)
Mechanical transmission to N. benthamiana plants
Since potivirids are readily transmissible mechanically (https://ictv.global/report/chapter/potyviridae/potyviridae), we attempted mechanical transmission of the virus to N. benthamiana, a common indicator host for diagnosis of many plant viruses [25]. N. benthamiana plants mechanically inoculated with sap produced from infected alfalfa leaves, developed distinct symptoms two–three weeks post inoculation. The resulting symptoms could be visually characterized as chlorosis, mottling, and chlorotic lesions on non-inoculated leaves. The infected plants were also stunted compared to healthy control plants (Fig. 5). The infection of N. bentamiana plants was additionally confirmed by RT-PCR assay with primers LN1095/96 developed based on the HTS data and specific for the virus (Fig. 6). The amplicon was of the correct size predicted by the analysis of the HTS-derived assembly and Sanger sequencing verified it is a fragment of the virus.
Fig. 5.

Symptoms developed on Nicotiana benthamiana plants after mechanical inoculation with AVMV-infected alfalfa. A, uninfected N. benthamiana plant. B-D, symptomatic plants
Fig. 6.

RT-PCR assay with total RNA extracted from symptomatic Nicotiana benthamiana plants. Virus-specific primers used in the assay were developed based on the HTS data. M, 1 Kb Plus DNA Ladder (Thermo Fisher Scientific, Waltham, MA USA). 1, RT-PCR amplicon obtained from the virus-infected plant using primer pair LN1095/LN1096. 2, no RT-PCR amplicons were obtained from the uninfected N. benthamiana plants
Transmission electron microscopy of the purified viral preparations
Transmission electron microscopy (TEM) can provide reliable information on particle dimensions and morphology, based on which a virus can be placed to a particular taxonomic group [26]. TEM examinations of the purified viral preparations showed that the virions were flexuous filaments with a modal length of 800–1050 nm and the modal diameter of about 11–13 nm (Fig. 7). This morphology is indicative of the members of the family Potyviridae and the larger particle length is consistent with the viruses of the genus Ipomovirus.
Fig. 7.

Transmission electron microscopy photograph of partially purified viral preparations. Magnification: 30,000. Scale bar: 500 nm
Mechanical transmission to alfalfa (Medicago sativa L.) plants
Among several plants of two alfalfa cultivars inoculated with purified viral preparations, only a single plant of cv. CUF 101 developed obvious symptoms ~ 20 days post mechanical inoculation. Symptoms consisted of mottling and vein yellowing (Fig. 8A). The symptomatic plant was tested, and the infection confirmed by RT-PCR assay with two different sets of primers developed based on the HTS data and specific for the virus (Fig. 8B). PCR products were sequenced and matched the virus in question.
Fig. 8.
A, Symptoms developed on leaves of alfalfa (Medicago sativa L.) cv. CUF101 after mechanical inoculation with partially purified viral preparations. B, RT-PCR assay with symptomatic leaves of mechanically inoculated alfalfa plants. M, 1 Kb Plus DNA Ladder (Thermo Fisher Scientific, Waltham, MA USA). 1, PCR amplicon obtained from the symptomatic leaves of alfalfa cv. CUF101 using primer pair LN1077/LN1078. 2, no PCR amplicon was obtained from control reaction using the same primers. 3, PCR amplicon obtained from the symptomatic alfalfa leaves using primer pair LN1079/LN1079. 4, no PCR amplicon was obtained from control reaction with the same primers
Discussion
We report here the identification and characterization of a new virus infecting alfalfa (Medicago sativa L.) and belonging to the family Potyviridae. Genomic fragments of the same virus were previously found in mature alfalfa seeds [15]. Since they shared some homology (~ 30%) to several potyvirids from different genera of the family, the virus was provisionally named alfalfa-associated potyvirus 1 (AaPV1) [15].
In this study, based on the complete genome sequence and structure, phylogenetic relationships, TEM observations, and symptomatology on its primary agricultural host, we propose a more descriptive name for the virus, alfalfa vein mottling virus. Additionally, our results indicate that AVMV should be reclassified as a novel species related to but distinct from viruses of the genus Ipomovirus. Furthermore, distinct clustering of AVMV in the phylogenetic tree and low identity levels with other members of the genus Ipomovirus suggest that alfalfa vein mottling virus likely represents a new species of a unique taxon most closely related to the genus Ipomovirus. We propose this new genus be named Alvemovirus.
The characteristic symptoms caused by the virus on indicator plant Nicotiana benthamiana and on its agricultural host alfalfa, confirm pathogenicity of AVMV on these host species. Successful mechanical inoculation of alfalfa with virus purified from the indicator plant followed by RT-PCR detection of the AVMV in mechanically inoculated alfalfa, satisfies Koch’s postulates and establishes the virus as cause of the symptoms observed on M. sativa plants.
Viruses of the genus Ipomovirus, to which AVMV is presumably related but distinct, infect a wide range of hosts, including economically important crops such as tomato, cucumber, melon, squash, sweet potato, watermelon, and others. To our knowledge, ipomoviruses or closely related viruses have not previously been identified from alfalfa. Our findings indicate that M. sativa can be a natural reservoir for the AVMV and thus, considering its possible relationship to ipomoviruses, which are transmitted by sweetpotato whitefly (Bemisia tabaci), it is possible that AVMV is also whitefly-transmitted and could infect other crops growing in the vicinity. Therefore, further studies will examine incidence of AVMV in additional regional crop and/or weed species and the potential for AVMV transmission by B. tabaci. Since all alfalfa samples used in this study were collected within 100 m of the melon fields in an area with exceptionally high populations of the whitefly, B. tabaci MEAM1, (Table 1), further testing this melon would likely clarify the virus origin and host range.
Conclusions
This work reports the discovery and characterization of a novel plant viral pathogen naturally infecting alfalfa (Medicago sativa L.), a major forage crop worldwide. The virus was identified as a member of the large and economically important family Potyviridae, in which it tentatively belongs to the new genus designated as Alvemovirus.
Supplementary Information
Additional file 1 Table S1. Different viral contigs generated from each of the eight plant samples infected with the virus
Abbreviations
- AaPV1
Alfalfa-associated potyvirus 1
- AVMV
Alfalfa vein mottling virus
- HTS
High-throughput sequencing
- PTA
Phosphotungstic acid
- 5’RACE
Rapid Amplification of cDNA Ends
- RT-PCR
Reverse transcription–polymerase chain reactions
- TEM
Transmission electron microscopy
Author contributions
Conceptualization: LGN. Sample collection and evaluation: JCP and WMW; Methodology: OAP, LGN, SG. Data analysis: SG and LGN. Experimentation: LGN and OAP. Writing – original draft preparation: LGN. Writing – review and editing: all authors.
Funding
This study was supported by the United States Department of Agriculture, Agricultural Research Service (CRIS number 8042–21000-300-00D) and partially by the National Plant Disease Recovery System (NPDRS) grants to LGN.
Availability of data and materials
The genomic sequence of the alfalfa vein mottling virus has been deposited in GenBank on 08/24/2023 under the accession number OR483877.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
All authors consent to the publication of the manuscript.
Competing interests
The authors declare that there are no conflicts of interest.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Chen H, Zeng Y, Yang Y, Huang L, Tang B, et al. Allele-aware chromosome-level genome assembly and efficient transgene-free genome editing for the autotetraploid cultivated alfalfa. Nat Commun. 2020;11:2494. doi: 10.1038/s41467-020-16338-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Postnikova OA, Shao J, Nemchinov LG. Analysis of the alfalfa root transcriptome in response to salinity stress. Plant Cell Physiol. 2013;54:1041–1055. doi: 10.1093/pcp/pct056. [DOI] [PubMed] [Google Scholar]
- 3.Postnikova OA, Hult M, Shao J, Skantar A, Nemchinov LG. Transcriptome analysis of resistant and susceptible alfalfa cultivars infected with root-knot nematode Meloidogyne incognita. PLoS ONE. 2015;10(3):e0123157. doi: 10.1371/journal.pone.0123157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Nemchinov LG, Shao J, Lee MN, Postnikova OA, Samac DA. Resistant and susceptible responses in alfalfa (Medicago sativa) to bacterial stem blight caused by Pseudomonas syringae pv. Syringae PloS One. 2017;12(12):e0189781. doi: 10.1371/journal.pone.0189781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Vieira P, Mowery J, Eisenback JD, Shao J, Nemchinov LG. Cellular and transcriptional responses of resistant and susceptible cultivars of alfalfa to the root lesion nematode. Pratylenchus penetrans Front Plant Sci. 2019;2019(10):971. doi: 10.3389/fpls.2019.00971. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Yu L-X, Zheng P, Bhamidimarri S, Liu X-P, Main D. The impact of genotyping-by-sequencing pipelines on SNP discovery and identification of markers associated with verticillium wilt resistance in autotetraploid alfalfa (Medicago sativa L.) Front Plant Sci. 2017;8:89. doi: 10.3389/fpls.2017.00089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yu L-X, Zhang F, Culma CM, Lin S, Niu Y, et al. Construction of high-density linkage maps and identification of quantitative trait loci associated with verticillium wilt resistance in autotetraploid alfalfa (Medicago sativa L.) Plant Dis. 2020;104(5):1439–1444. doi: 10.1094/PDIS-08-19-1718-RE. [DOI] [PubMed] [Google Scholar]
- 8.Lin S, Medina CA, Boge B, Hu J, Fransen S, et al. Identification of genetic loci associated with forage quality in response to water deficit in autotetraploid alfalfa (Medicago sativa L.) BMC Plant Biol. 2020;20(1):303. doi: 10.1186/s12870-020-02520-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Bejerman N, Roumagnac P, Nemchinov LG. High-throughput sequencing for deciphering the virome of alfalfa (Medicago sativa L.) Front Microbiol. 2020;11:553109. doi: 10.3389/fmicb.2020.553109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nemchinov LG, Irish BM, Grinstead S, Shao J, Vieira P. Diversity of the virome associated with alfalfa (Medicago sativa L.) in the U.S. Pacific Northwest. Sci Rep. 2020;12(1):8726. doi: 10.1038/s41598-022-12802-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jiang P, Shao J, Nemchinov LG. Identification of emerging viral genomes in transcriptomic datasets of alfalfa (Medicago sativa L.) Virol J. 2019;16:153. doi: 10.1186/s12985-019-1257-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Nemchinov LG, Grinstead SC, Mollov DS. Alfalfa virus a new species in the family Alphaflexiviridae. PLoS ONE. 2017;12(5):e0178222. doi: 10.1371/journal.pone.0178222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Vayssier-Taussat M, Albina E, Citti C, Cosson JF, Jacques MA, Lebrun MH, et al. Shifting the paradigm from pathogens to pathobiome: new concepts in the light of meta-omics. Front Cell Infect Microbiol. 2014;4:29. doi: 10.3389/fcimb.2014.00029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nemchinov LG, Irish BM, Uschapovsky IV, Grinstead S, Shao J, Postnikova OA. Composition of the alfalfa pathobiome in commercial fields. Front Microbiol. 2023;14:1225781. doi: 10.3389/fmicb.2023.1225781. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Nemchinov LG, Irish BM, Grinstead S, Postnikova OA. Characterization of the seed virome of alfalfa (Medicago sativa L.) Virol J. 2023;20(1):96. doi: 10.1186/s12985-023-02063-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Bankevich A, Nurk S, Antipov D, Gurevich A, Dvorkin M, et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 19.Bushnell, B. BBMap: A fast, accurate, splice-aware aligner. In: 9th Annual Genomics of Energy & Environment Meeting, Walnut Creek, CA, USA. 2014. https://www.osti.gov/servlets/purl/1241166
- 20.Goh CA, Hahn Y. Analysis of proteolytic processing sites in potyvirus polyproteins revealed differential amino acid preferences of Nia-Pro protease in each of seven cleavage sites. PLoS ONE. 2021;16(1):e0245853. doi: 10.1371/journal.pone.0245853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. RaxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics. 2019;35:4453–4455. doi: 10.1093/bioinformatics/btz305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lesemann DE, Koenig R, Huth W, Brunt AA, Phillips S, Barton RJ. Poinsettia mosaic virus: a tymovirus? Phytopath Z. 1983;107:250–262. doi: 10.1111/j.1439-0434.1983.tb00544.x. [DOI] [Google Scholar]
- 23.Paysan-Lafosse T, Blum M, Shuguransky S, Grego T, Pinto BL, et al. InterPro in 2022. Nucleic Acids Res. 2023;51(D1):D418–D427. doi: 10.1093/nar/gkac993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chung BYW, Miller WA, Atkins JF, Firth AE. An overlapping essential gene in the Potyviridae. Proc Natl Acad Sci USA. 2008;105:5897–5902. doi: 10.1073/pnas.0800468105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hull RM. Plant Virology. 4. Academic Press; 2002. [Google Scholar]
- 26.Bhat AI, Rao GP 2020 Electron Microscopy and Utramicrotomy. In: Characterization of plant viruses. Methods and Protocols. Humana Press, New York, NY U.S.A. p 173–185
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1 Table S1. Different viral contigs generated from each of the eight plant samples infected with the virus
Data Availability Statement
The genomic sequence of the alfalfa vein mottling virus has been deposited in GenBank on 08/24/2023 under the accession number OR483877.




