Decreased syntaxin17 expression contributes to the pathogenesis of acute pancreatitis in murine models by impairing autophagic degradation

Abstract

Acute pancreatitis (AP) is an inflammatory disease of the exocrine pancreas. Disruptions in organelle homeostasis, including macroautophagy/autophagy dysfunction and endoplasmic reticulum (ER) stress, have been implicated in human and rodent pancreatitis. Syntaxin 17 (STX17) belongs to the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) subfamily. The Qa-SNARE STX17 is an autophagosomal SNARE protein that interacts with SNAP29 (Qbc-SNARE) and the lysosomal SNARE VAMP8 (R-SNARE) to drive autophagosome-lysosome fusion. In this study, we investigated the role of STX17 in the pathogenesis of AP in male mice or rats induced by repeated intraperitoneal injections of cerulein. We showed that cerulein hyperstimulation induced AP in mouse and rat models, which was characterized by increased serum amylase and lipase activities, pancreatic edema, necrotic cell death and the infiltration of inflammatory cells, as well as markedly decreased pancreatic STX17 expression. A similar reduction in STX17 levels was observed in primary and AR42J pancreatic acinar cells treated with CCK (100 nM) in vitro. By analyzing autophagic flux, we found that the decrease in STX17 blocked autophagosome-lysosome fusion and autophagic degradation, as well as the activation of ER stress. Pancreas-specific STX17 knockdown using adenovirus-shSTX17 further exacerbated pancreatic edema, inflammatory cell infiltration and necrotic cell death after cerulein injection. These data demonstrate a critical role of STX17 in maintaining pancreatic homeostasis and provide new evidence that autophagy serves as a protective mechanism against AP.

Introduction

Acute pancreatitis (AP) is a potentially fatal inflammatory disease with considerable morbidity and mortality, and is the most common cause of hospitalization of gastrointestinal disorders in the world. Systemic inflammatory response syndrome (SIRS) and multiple organ dysfunction syndrome (MODS) contribute to the high mortality rate of AP. Inflammatory factor release from necrotic cells during AP triggers the cascade of inflammatory reactions and causes SIRS, ultimately leading to MODS, which includes lung and intestine injuries [1, 2]. Moreover, the incidence and hospitalization rates after AP have been increasing over the last two decades, but the exact molecular mechanisms in the pathogenesis of pancreatitis remain largely unclear; thus, no successful therapeutic treatment for pancreatitis is available [3, 4].

Recent studies have suggested that macroautophagy (hereafter referred to as autophagy) plays a pivotal role in maintaining pancreatic homeostasis. Autophagy is a conserved cellular catabolic process that requires autophagy-related (ATG) protein-mediated autophagosome formation to carry cargoes for lysosomal degradation [5]. Direct evidence of a link between the autophagy-lysosomal pathway and pancreatitis comes from mice with genetic deletion of essential ATG and lysosomal genes. A lack of ATG5 or ATG7 blocks the formation of autophagosomes in mice, which leads to spontaneous pancreatitis [6, 7]. Lysosomal dysfunction and a decrease in lysosomal proteins such as lysosomal-associated membrane protein 1/2 (LAMP1/2) have been shown in human and rodent pancreatitis [8, 9]. Moreover, we have reported that impaired TFEB-mediated lysosomal biogenesis causes an insufficient number of lysosomes to fulfill the maximal capacity of autophagic degradation, and can promote the development of pancreatitis in humans and mice [10, 11]. However, autophagy is a multistep process, and whether impaired autophagy is due to defects in autophagosome-lysosome fusion in AP has been poorly explored.

Syntaxin 17 (STX17) belongs to the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) subfamily. Since the discovery of SNARE proteins, SNAREs have been recognized as key components of protein complexes that drive membrane fusion [12]. According to the SNARE motifs, SNARE proteins can be classified as Qa-, Qb-, Qc- and R-SNAREs. Specific membrane fusion events are generally mediated by these SNAREs, which form a parallel four-helix bundle composed of Qa-, Qb-, Qc- and R-SNAREs to bridge two membranes [13, 14]. The Qa-SNARE STX17 is an autophagosomal SNARE protein that can interact with SNAP29 (Qbc-SNARE) and the lysosomal SNARE VAMP8 (R-SNARE) to mediate autophagosome-lysosome fusion [15, 16].

In the present study, we found that pancreatic levels of STX17 were decreased in experimental AP models in vitro and in vivo. A decrease in STX17 blocked the fusion of autophagosomes and lysosomes, leading to impaired autophagic degradation and ER stress. STX17 knockdown in the pancreas further exacerbated the pathogenesis of experimental AP and AP-associated lung injury in mice.

Materials and methods

Animal model of pancreatitis

GFP-LC3 mice were generated by Dr. Noburu Mizushima of the University of Tokyo and were received from RIKEN (Wako, Japan). C57BL/6 J mice and Sprague Dawley rats were obtained from the Animal Experiment Center of Guangzhou University of Chinese Medicine. All animal procedures were carried out in accordance with the China Animal Welfare Legislation, and the animals were housed under specific pathogen-free conditions. Acute pancreatitis was induced using cerulein as described previously [10]. Eight- to twelve-week-old male GFP-LC3 mice, C57BL/6 J WT mice or rats received 7 hourly intraperitoneal injections of 50 μg/kg or 20 μg/kg cerulein. Control mice or rats received similar injections of saline. All mice or rats were sacrificed 1 h after the last injection of cerulein, and serum, pancreas, and lung samples were collected.

Pancreas-specific STX17 knockdown and pancreatitis induction

Pancreatic STX17 knockdown was achieved by retrograde infusion of adenovirus shRNA targeting STX17 into the mouse pancreatic duct. Adenovirus delivery was performed as previously described with slight modifications [17, 18]. Briefly, retrograde infusion of one dose of adenovirus-shSTX17 (5 × 10⁸ PFU/mouse, 50 μL) or adenovirus-shScramble (5 × 10⁸ PFU/mouse, 50 μL) into the mouse pancreatic duct was performed at a rate of 5 μL/min. Three weeks after being perfused, the mice were subjected to 7 hourly injections of cerulein to induce acute pancreatitis. The mice were sacrificed 1 h after the last injection of cerulein, and serum, pancreas and lung samples were collected.

Antibodies

The antibodies used for this study were: Syntaxin17 (17815-1-AP), MPO (22225-1-AP), F4/80 (28463-1-AP) and HSPA5/BIP (11587-1-AP), which were from Proteintech. eIF2α (D7D3) (5324) and phospho-eIF2α (Ser51) (3398) were purchased from Cell Signaling Technology. LAMP1 (DSHB,1D4B), SQSTM1/p62 (Abnova, H00008878-M01), and LC3II (Sigma, L7543) were used. Peroxidase-conjugated goat anti-mouse IgG (H + L) (115-035-062), peroxidase-conjugated goat anti-rabbit IgG (H + L) (111-035-045), Alexa Fluor 488-conjugated goat anti-rabbit IgG (111-545-144), and rhodamine-conjugated goat anti-rat IgG (112-025-143), rhodamine-conjugated goat anti mouse IgG (115-025-146) were purchased from Jackson ImmunoResearch.

Histology and immunohistochemistry

Paraffin-embedded pancreas sections were stained with hematoxylin and eosin (H&E) and immunostained for MPO and F4/80. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed with commercial kit (Roche, 11684809910). Images were taken using a Nikon Eclipse Ni microscope (Nikon, Tokyo, Japan). The H&E score was evaluated according to the criteria as described previously with minor modifications [19].

RNA isolation and real-time quantitative polymerase chain reaction

RNA was isolated from the pancreas using TRIzol reagent (Accurate Biology, AG21102) and reverse transcribed into cDNA using an EVO M-MLV reverse transcription kit II (Accurate Biology, AG11711). qPCR was performed using SYBR Green chemistry (Accurate Biology, AG11718). The qPCR primer sequences (5ʹ – 3ʹ) for primers used in qPCR were as follows:

Ddit3

F: CAGGAGGTCCTGTCCTCAGA;

R: CTCCTGCTCCTTCTCCTTCA;

Dnajb9

F: CCCCAGTGTCAAACTGTACCAG;

R: AGCGTTTCCAATTTTCCATAAATT;

Hspa5

F: AGTGGTGGCCACTAATGGAG;

R: CAATCCTTGCTTGATGCTGA;

Rpl13a

F: AGCCTACCAGAAAGTTTGCTTAC;

R: GCTTCTTCTTCCGATAGTGCATC.

Syntaxin17 (rat)

F: GCTTAGCCATCTGGTCACCGATATG;

R: TGGTTCCCTCTTCAACATTCACAGC;

Rpl13a (rat)

F:GGTGGTGGTTGTACGCTGTGAG;

R: CGAGACGGGTTGGTGTTCATCC;

Preparation of tissue lysate and immunoblot analysis

Total pancreatic tissues were prepared using radioimmunoprecipitation assay buffer (1% NP40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl [lauryl] sulfate). Lysates were centrifuged for 15 min at 12,500 ×g and the supernatants were collected and stored at −80 °C. The protein (30 µg) was separated by 10%–12% SDS-PAGE gels before being transferred to a polyvinylidene difluoride membrane. The membranes were probed using appropriate primary and secondary antibodies and developed with Biodlight ECL Chemiluminescent HRP Substrate (Tanon, 180-5001).

Immunostaining and confocal microscopy

Immunostaining for LAMP1, p62 and Syntaxin17 was conducted using pancreatic cryosections. Nuclei were counterstained with DAPI. Images were obtained using a Leica confocal microscope (Leica, Wetzlar, Germany).

Statistical analysis

All experimental data are expressed as the mean ± SEM and were subjected to one-way ANOVA with Bonferroni’s post hoc test or Student’s t test where appropriate. P < 0.05 was considered significant.

Results

Cerulein induces acute pancreatitis in mice and rats

Experimental pancreatitis was induced by 7 hourly injections of cerulein as described previously [10]. Cerulein treatment markedly increased the enzymatic activities of amylase and lipase, which are the two main indicators of pancreas injury, in mice and rats (Fig. 1a). Histopathological analysis revealed significantly increased intra-acinar vacuolization, immune cell infiltration and necrotic cell death in the pancreas in cerulein-treated mice and rats (Fig. 1b, c). Immunohistochemical staining of MPO, F4/80 and TUNEL further confirmed inflammatory infiltration and cell death in the pancreas (Fig. 1d, e). Lung injury is one of the most common AP-associated complication and a leading cause of death in pancreatitis [20]. Increased inflammatory cells, hemorrhage and cell death were readily detected in cerulein-treated mouse lungs (Supplementary Fig. 1a, b). These data indicate successful establishment of acute pancreatitis in mice and rats.

Fig. 1. Cerulein induces acute pancreatitis in mice and rats.

Pancreatitis was induced by 7 hourly intraperitoneal injections of 50 μg/kg or 20 μg/kg cerulein in male C57BL/6 J mice or Sprague-Dawley rats, respectively. a Serum amylase and lipase activities were measured. Data shown are the mean ± SEM (n = 3–5). **P < 0.01; Student’s t test. b Representative images of H&E staining of mouse or rat pancreatitis samples. The black arrows indicate the vacuolization of acinar cells. Yellow arrows show the infiltration of inflammatory cells. The red arrows denote cell death. Bar: 50 μm. c Individual histology scores of H&E staining were graded. Data shown are the mean ± SEM (n = 3–4). More than 18 fields were counted in each group. **P < 0.01; Student’s t test. d Representative images of MPO staining (for neutrophils), F4/80 staining (for macrophages) and TUNEL staining (for cell death) Bar: 50 μm. e MPO, F4/80 and TUNEL positive cells were quantified. Data shown are the mean ± SEM (n = 3–4). More than 12 fields were counted in each group. *P < 0.05, **P < 0.01; Student’s t test.

Cerulein blocks autophagic degradation in GFP-LC3 mice

Impaired autophagy has been implicated in human pancreatitis [21]. We monitored autophagic degradation in cerulein-treated GFP-LC3 mice. In the cerulein-treated group, the number of GFP-LC3 puncta significantly increased due to lipidated LC3 targeting to autophagosomal membranes. A diffuse GFP-LC3 pattern and fewer GFP-LC3 puncta were found in the cytoplasm of acinar cells in the pancreas in saline-treated mice (Fig. 2a, b). SQSTM1/p62 is a well-known target for autophagic degradation [22]. Increased p62 puncta were also found in the pancreas in cerulein-treated mice (Fig. 2a, b). Immunoblotting analysis further confirmed the increased expression levels of p62 and LC3II in the cerulein-treated group (Fig. 2c, d). Collectively, these data suggest that autophagic degradation is blocked in the pancreas in cerulein-treated mice.

Fig. 2. Cerulein blocks autophagic degradation.

Male GFP-LC3 transgenic mice were treated with 7 hourly injections of cerulein (50 μg/kg). a GFP-LC3 mouse pancreatic cryosections were subjected to immunostaining for p62, and nuclei were stained with DAPI. Bar: 50 μm. b The numbers of GFP-LC3 puncta and p62 puncta per cell in each group were quantified. Data are the mean ± SEM (n = 3–4). More than 498 cells were counted in each group. **P < 0,01. Student’s t test. c Total pancreatic lysates were subjected to immunoblotting. d Densitometry was performed on LC3II and p62 (normalized to the loading control Ponceau S), and the data shown are the mean ± SEM (n = 4). *P < 0.05 by Student’s t test.

Cerulein decreases pancreatic STX17 expression

Complete autophagy requires lysosomal degradation of cargo carried by autophagosomes. Genetic deletion of genes that regulate autophagosome formation [6, 7, 23] or lysosomal biogenesis [10, 11] leads to the development of spontaneous pancreatitis. However, whether blocking autophagosome-lysosome fusion contributes to impaired autophagy in acute pancreatitis has been poorly explored. Since STX17 is an autophagosomal SNARE that is essential for autophagosome-lysosome fusion, we examined whether autophagy impairment in AP was due to alterations in STX17. Immunoblot showed decreased expression of STX17 in the mouse and rat pancreas (Fig. 3a, b). qRT-PCR analysis of STX17 mRNA expression revealed a significant decrease in STX17 in cerulein-treated pancreatic tissues (Fig. 3c). Moreover, Immunofluorescence staining revealed decreased expression of STX17 in the AP mouse pancreas (Fig. 3d). Similarly, decreased levels of STX17 were observed in primary and AR42J pancreatic acinar cells treated with cholecystokinin (CCK) (Supplementary Fig. 2).

Fig. 3. Cerulein decreases pancreatic STX17 expression.

a Total pancreatitis lysates were subjected to immunoblotting (normalized to the loading control Ponceau S). Left: mouse. Right: rat. b Densitometry was conducted on STX17. The data shown are mean ± SE (n = 3). **P < 0.01 by Student’s t test. c Pancreatic RNA was extracted for qPCR analysis. The results were normalized to Rpl13a and are expressed as the fold changes compared to the control group. The data shown are the mean ± SEM (n = 4–5). *P < 0.05 by Student’s t test. d Pancreatic cryosections were subjected to immunostaining for STX17, and nuclei were stained with DAPI. Bar: 50 μm.

To determine whether decreased STX17 expression could block autophagosome-lysosome fusion or autolysosome formation, we further stained LAMP1, a lysosomal marker, in the GFP-LC3 mouse pancreas. We found that cerulein treatment significantly decreased the number of lysosomes but increased the size of lysosomal puncta (Fig. 4a, b), which was consistent with our previous report that cerulein impairs TFEB-mediated lysosomal biogenesis, leading to “insufficient autophagy” in the mouse pancreas [10]. Moreover, cerulein treatment increased not only the number but also the size of GFP-LC3 puncta (Figs. 2b and 4a, c), indicating the accumulation of autophagosomes in the pancreas in cerulein-treated mice. However, the number of GFP-LC3 puncta that colocalized with LAMP1 was significantly decreased in the cerulein-treated group (Fig. 4a, d). Furthermore, the fusion rate of LAMP1 (colocalized LAMP1 vs. total LAMP1) or GFP-LC3 (colocalized GFP-LC3 vs. total GFP-LC3) was markedly decreased in the cerulein-treated group (Fig. 4a, e). Electron microscopic analysis revealed increased numbers of undegraded or partially degraded autophagic vacuoles in cerulein-treated pancreas samples (Fig. 4f). Collectively, these data suggest that autophagosome-lysosome fusion is decreased in pancreatitis, possibly due to STX17 deficiency.

Fig. 4. The decrease in STX17 blocks autophagosome-lysosome fusion.

Male GFP-LC3 transgenic mice or Sprague-Dawley rats were administered 7 hourly intraperitoneal injections of 50 μg/kg or 20 μg/kg cerulein, respectively. a GFP-LC3 mouse pancreatic cryosections were subjected to immunostaining for LAMP1 and nuclei were stained with DAPI. White arrows indicate the colocalized puncta of GFP-LC3 with LAMP1, white arrowheads denote larger GFP-LC3 puncta and yellow arrows indicate enlarged LAMP1 puncta. Bar: 20 μm. b The size and number of LAMP1 puncta, c the size of GFP-LC3 puncta, d the number of colocalized GFP-LC3/LAMP1 puncta, and e the LAMP1 fusion and GFP-LC3 fusion rates were quantified. Data shown are the mean ± SEM (n = 4). More than 498 cells were counted in each group. **P < 0.01 by Student’s t test. f Representative electron microscopic images of saline and cerulein-treated rat pancreatic samples. N: nucleus. White arrows: lysosomes. Green arrows: undegraded or partially degraded autophagic vacuoles, yellow arrows: degraded autophagic vacuoles. Bar: 2 μm.

The decrease in STX17 is accompanied by ER stress in AP

Since STX17 has been reported to localize to the ER [24], we next determined whether a decrease in STX17 could affect ER homeostasis. Electron microscopy showed ER dilation in the pancreas in cerulein-treated mice (Fig. 5a). The protein levels of several ER stress markers, including HSPA5, p-EIF2α and DDIT3, increased after cerulein treatment (Fig. 5b, c). Consistent with the immunoblot data, qRT-PCR analysis revealed significantly increased mRNA levels of Hspa5, Ddit3 and Dnajb9 (Fig. 5d). These data suggest that a decrease in STX17 may disrupt ER homeostasis and trigger ER stress.

Fig. 5. The decrease in STX17 is accompanied by ER stress in cerulein-induced pancreatitis.

Pancreatitis was induced by 7 hourly intraperitoneal injections of cerulein (50 μg/kg) in male C57BL/6 J mice. a Representative electron microscopic images of pancreatic tissues are shown. Bar: 1 μm. Arrows: dilated ER. b Immunoblot analysis of ER stress in pancreatic tissues followed by (c) densitometry. The data shown are the mean ± SEM (n = 4). **P < 0.01 by Student’s t test. d Pancreatic mRNA was extracted for qPCR analysis. The data were normalized to Rpl13a and expressed as the fold changes compared to the saline group. Data shown are the mean ± SEM (n = 4–5). *P < 0.05, **P < 0.01 by Student’s t test.

Multiple organ injuries are exacerbated in cerulein-treated mice with STX17 knockdown

To determine whether decreased STX17 plays a causal role in the pathogenesis of pancreatitis, we generated pancreas-specific STX17 knockdown mice and subjected these mice to cerulein or saline treatment. Pancreatic STX17 knockdown was achieved by retrograde pancreatic ductal infusion of shSTX17 adenovirus followed by cerulein treatment (Fig. 6a). Knockdown of STX17 was confirmed by immunoblotting, and pancreatic levels of STX17 were decreased after adeno-shSTX17 treatment, suggesting successful knockdown of STX17 (Fig. 6b). Notably, STX17 knockdown was accompanied by increased levels of LC3 II and p62, suggesting impaired autophagic degradation due to the lack of STX17-mediated autophagosome-lysosome fusion in the mouse pancreas. Consistent with the in vivo data, STX17 knockdown in AR42J acinar cells resulted in the accumulation of LC3 II and p62 in the presence or absence of CCK treatment (Supplementary Figs. 3 and 4). H&E staining revealed increased interstitial edema, inflammatory cell infiltration and necrotic cell death in cerulein-treated control mice, which were further increased in STX17 knockdown mice (Fig. 6c, f). MPO and F4/80 staining further confirmed the increased inflammation in the pancreas of STX17-knockdown mice (Fig. 6d, e, g, h). Moreover, AP-associated lung injury was worsened in STX17 knockdown mice (Supplementary Fig. 5a, b). Taken together, these data suggest that STX17 deficiency exacerbates the pathogenesis of cerulein-induced experimental pancreatitis and AP-associated multiple organ injury.

Fig. 6. Knockdown of STX17 exacerbates cerulein-induced pancreatitis.

Adenovirus-shSTX17 (5 × 10⁸ PFU/mouse) or adenovirus-shScramble (5 × 10⁸ PFU/mouse) was delivered through retrograde infusion into the mouse pancreatic duct. The mice were further fed for 21 days after adenovirus injection followed by cerulein treatment. a Illustration of retrograde infusion of adenovirus into the pancreatic duct followed by cerulein treatment. b Immunoblot analysis of lysates of pancreatic tissues. c Representative images of H&E staining are shown. Bar: 50 μm. Representative images of F4/80 (d) and MPO (e) staining are shown. Bar: 50 μm. f Individual histology scores were graded. The data shown are the mean ± SEM (n = 3). More than 17 fields were counted in each group. *P < 0.05, **P < 0.01 by one-way ANOVA. MPO- (g) and F4/80- (h) positive cells were quantified. The data shown are the mean ± SEM (n = 3). More than 13 fields were counted in each group. **P < 0.01 by one way ANOVA.

Knockdown of STX17 aggravates ER stress

To test the role of STX17 in the ER, we then analyzed the pathological changes in the pancreas in STX17 knockdown mice and pancreatic acinar cells. Electron microscopic analysis showed more dilated and whorl-like ER structures in cerulein-treated STX17 knockdown pancreatic tissues than in matched control tissues (Fig. 7a). Immunoblot further showed increased ER stress markers, including HSPA5 and p-EIF2α, in cerulein-treated STX17 knockdown pancreatic lysates (Fig. 7b). Similarly, STX17 knockdown in AR42J acinar cells increased the mRNA levels of Hspa5, Ddit3 and Dnajb9 (Supplementary Fig. 6), as well as the protein levels of HSPA5 and p-EIF2α, with or without CCK treatment (Fig. 7c, d). These data indicate that STX17 knockdown can exacerbate ER stress.

Fig. 7. STX17 knockdown worsens cerulein-induced ER stress.

STX17 knockdown was achieved by retrograde infusion of adenovirus-shSTX17 into the pancreatic duct. a Representative electron microscopic images of the pancreas in saline- and cerulein-treated mice. N: nucleus, black arrows: dilated ER, yellow arrows: whorl-like ER. Bar: 2 μm. b Immunoblot analysis of lysates of pancreatic tissues. c Immunoblot analysis of ER stress in AR42J cells followed by (d) densitometry. The data shown are the mean ± SEM (n = 3). *P < 0.05, **P < 0.01 by one-way ANOVA.

Discussion

In the present study, we found that cerulein decreased pancreatic levels of STX17 and STX17-mediated autophagosome-lysosome fusion, leading to the accumulation of autophagosomes and impaired autophagic degradation. STX17 knockdown in the pancreas or pancreatic acinar cells exacerbated cerulein- or CCK-induced experimental pancreatitis. Our data highlight a critical role of STX17 in maintaining pancreatic acinar cell homeostasis mainly through autophagy-mediated quality control (Fig. 8).

Fig. 8. A schematic summary of STX17 in cerulein-induced impaired autophagy and pancreatitis.

Autophagy degrades damaged and excessive organelles and macromolecules within lysosomes to maintain intracellular homeostasis. Cerulein decreases STX17 levels to block autophagosome and lysosome fusion, thus preventing autophagic degradation and inducing ER stress and, ultimately leading to the pathogenesis of pancreatitis.

As a quality control mechanism, autophagy ensures cellular homeostasis by removing defective/excessive organelles, abnormal protein aggregates and invasive pathogens [25, 26]. Intracellular activation of zymogen granules (ZGs) is a major trigger for the initiation of pancreatitis. Autophagy can selectively remove damaged or accumulated ZGs to prevent the release of digestive enzymes within acinar cells [11, 27]. Genetic disruption of the autophagy process, including pancreatic deletion of ATG5 [6], ATG7 [7], or VMP1 [23], which blocks autophagosome formation, can cause intracellular activation of ZGs and the development of spontaneous pancreatitis in mice. Moreover, comparable phenotypes can be found in mice lacking LAMP2 [8, 9] or TFEB/TFE3 [10], which hampers lysosomal function or biogenesis, respectively. These data clearly highlight the protective role of autophagy in maintaining pancreatic homeostasis.

Paradoxically, autophagy has also been shown to induce pancreatitis because trypsinogen can be activated when autophagic vacuoles containing ZGs fuse with lysosomes, where lysosomal hydrolases cleave trypsinogen and subsequently trigger pancreatitis [28]. However, this theory fails to explain why starvation does not induce pancreatitis. Neither can it clarify why autophagy- deficient mice lacking ATG5, TFEB [11] or VMP1 [23] can exhibit intracellular trypsinogen activation. These data strongly suggest that trypsinogen can be activated outside of autolysosomes or lysosomes.

To address this issue, we further examined autophagosome and lysosome fusion in the mouse pancreas. One intriguing finding was that autophagosome-lysosome fusion was impaired due to the decreased levels of STX17. We found decreased colocalization of GFP-LC3-positive autophagosomes and LAMP1-positive autolysosomes or lysosomes in the pancreas in cerulein-treated mice, supporting that the fusion of autophagosomes and lysosomes was inhibited. STX17 is an autophagosomal Qa-SNARE protein. Under nutrient-rich conditions, STX17 localizes to the ER and mitochondria, as well as in the cytosol, while STX17 translocates to autophagosomes under starvation conditions. STX17 selectively targets the completed autophagosomal membrane through its two transmembrane domains containing glycine zipper-like motifs. STX17 further interacts with cytosolic SNAP29 and lysosomal VAMP7/VAMP8 to facilitate autophagosome-lysosome fusion [15, 29]. We found that cerulein caused the accumulation of the autophagic marker LC3-II and autophagic substrate p62, suggesting impaired autophagic degradation. Comparable results were found in the pancreas in STX17 knockdown mice and pancreatic acinar cells. Moreover, STX17 knockdown triggered more severe pancreatic injuries and AP-associated injuries. Collectively, these findings suggest that impaired autophagosome-lysosome fusion or autophagic degradation can worsen cerulein-induced experimental pancreatitis.

Another intriguing finding in the present study was that a decrease in STX17 induced ER stress. Pancreatic acinar cells have the highest rate of protein synthesis and translation compared to any other adult human cell type; thus, these cells have abundant ER to meet the high demand for protein synthesis, which also makes them more susceptible to ER perturbations [30]. STX17 has been reported to localize to the ER and is involved in membrane trafficking between the ER and ERGIC compartments [24]. Whether a decrease in STX17 blocks protein trafficking from the ER to trigger ER stress needs further exploration. An alternative explanation for ER stress was that the decrease in STX17 blocked selective autophagy of the ER (termed ER-phagy). ER-phagy can remove ER retained misfolded proteins and damaged ER to ameliorate ER stress [31]. Several ER-phagy receptors have been documented to mediate ER-phagy, and genetic deletion of CCPG1, which is an ER-phagy receptor, induces ER stress and pancreatic injury [32–37]. Since lysosomal degradation occurs in the last stage of the autophagy process, the decrease in STX17 blocked autophagosome-lysosome fusion and prevented lysosomal hydrolases from entering autophagosomes to degrade their contents, leading to impaired autophagic degradation and persistent ER stress.

In conclusion, our data demonstrate that STX17-mediated autophagosome-lysosome fusion and autophagic degradation are critical mechanisms to protect pancreatic acinar cells against cerulein-induced pancreatic injury. Pharmacological targeting of STX17 may be a promising therapeutic strategy to prevent and treat pancreatitis.

Author contributions

SGW, ZQL and ZXZ conceived and designed the study, TTW, LCZ, ZQ, SJC, JMZ, JYL, LA conducted the experiments and analyzed the data, CYW, YG. LMW provided reagents, SGW analyzed data and wrote the manuscript.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41401-023-01139-x.