Skip to main content
NCBI home page
Iranian Journal of Microbiology logoLink to Iranian Journal of Microbiology
. 2023 Aug;15(4):550–556. doi: 10.18502/ijm.v15i4.13509

Evaluation of anti-biofilm activity of Lactobacillus rhamnosus GG and Nisin on the expression of aap, ica-A and ica-D as biofilm-associated genes of Staphylococcus epidermidis

Mohammad Dalvand 1, Seyed Ali Mirhosseini 1, Kiumarss Amini 2, Soghra Khani 3, Hamideh Mahmoodzadeh Hosseini 1,*, Kowsar Mansoori 4
PMCID: PMC10692973  PMID: 38045711

Abstract

Background and Objectives:

In the present study, the anti-biofilm activity of Lactobacillus rhamnosus GG and Nisin was investigated on biofilm-forming abilities of Staphylococcus epidermidis strains and the expression of the biofilm-associated genes.

Materials and Methods:

In this study, the standard strain of L. rhamnosus GG (ATCC 53103) and Nisin were used to assess their anti-microbial and anti-biofilm effects on S. epidermidis (RP62A).

Results:

The MIC and MBC analysis showed that Nisin at 256 μg/mL and 512 μg/mL, and L. rhamnosus GG at 1×107 CFU/mL and 1×108 CFU/mL have anti-microbial activity compared to the negative control respectively. L. rhamnosus GG bacteria and Nisin inhibited the biofilm formation of S. epidermidis based on optical density of at 570 nm (P <0.001). The relative mRNA expression of aap, icaA, and icaD genes was significantly reduced compared to the negative control after treating S. epidermidis with sub-MIC of Nisin (0.44, 0.25 and 0.6 fold, respectively) (P>0.05). In addition, the relative expression of aap and icaA genes, but not icaD (P>0.05), was significantly lower than the negative control (0.62 and 0.7 fold, respectively) (P>0.05), after exposure to the sub MIC of L. rhamnosus GG.

Conclusion:

Nisin and L. rhamnosus GG exhibit potent activity against biofilm-forming abilities of S. epidermidis and these agents could be utilized as an anti-biofilm agents against S. epidermidis infections.

Keywords: Staphylococcus epidermidis, Probiotic, Lactobacillus rhamnosus GG, Nisin, Biofilm

INTRODUCTION

Staphylococcus epidermidis is the most frequent commensal bacterium of human skin and is considered an opportunistic microorganism. Due to the increasing number of immunocompromised patients and recipients of biomedical implants, infections caused by this bacterium have dramatically increased. S. epidermidis is now one of the leading causes of hospital-acquired infections, including catheter-associated infections and infections resulting from the use of external equipment (1).

The ability of this bacterium to form biofilms and colonize different surfaces is associated with its capability to cause life-threatening catheter-related bloodstream infections in immunocompromised patients. S. epidermidis possesses a range of genes that contribute to the biofilm phenotype, including the ica (icaABCD) gene, which produces Polysaccharide Intercellular Adhesive (PIA); the Bap (biofilm-associated protein) gene; the Aap (accumulation-associated protein) gene; and other genes that produce surface proteins and exopolymers essential for adhesion and biofilm formation on host cells and implanted devices (2, 3).

Considering the emergence of antibiotic-resistant S. epidermidis strains as a significant health concern, it is necessary to explore alternative novel approaches to control infections caused by this bacterium.

Lactobacillus rhamnosus is a facultatively anaerobic, heterofermentative, rod-shaped bacterium that can be found in different parts of the human body, including the gastrointestinal tract (4). Lactobacillus rhamnosus strain GG is one of the most well-studied probiotic strains and is generally recognized as safe (GRAS) by the Food and Drug Administration (5). Initially, L. rhamnosus GG was obtained from a fecal sample of a healthy adult person by Barry Golding and Sherwood Gorbach, and later, the abbreviation L. rhamnosus GG was used to refer to this strain (6).

The anti-pathogenic mechanisms of L. rhamnosus GG include its ability to endure gastrointestinal stress, acid, and bile tolerance, high growth ability, adherence capacity to the intestinal epithelium, protection, and strengthening of the epithelial barrier, production of different antimicrobial substances, immunomodulatory effects, ability to produce biofilm, prevention of pathogen biofilm formation, competitive adhesion to host cells, inhibition of bacterial pathogen growth, and more (5, 7–9).

According to the mentioned characteristics of this strain, it has been applied to various disease states in clinical trials and has shown many benefits to the host. These include improvements in diarrhea in children, atopic diseases, anti-obesity, and respiratory pathology, lower depression and anxiety scores in women, reduced risk of colon cancer, and treatment of recurrent Clostridium difficile-induced colitis in children (10–13).

Nisin is an antimicrobial peptide produced by Lactococcus lactis. In 1969, FAO (Food and Agriculture Organization) and WHO (World Health Organization) approved the usage of this bacteriocin as a food preservative instead of a chemical one (14, 15). Nisin has gained considerable attention due to its potent and broad-spectrum activity, low likelihood of promoting the development of bacterial resistance, easy degradability by proteolytic enzymes in mammals, and low cellular cytotoxicity at antimicrobial conentrations (16, 17). Several studies have shown that the antimicrobial activity of Nisin is due to pore formation on the surface of cells, inhibition of cell wall biosynthesis, and anti-biofilm formation (16, 18, 19).

According to the information presented above and in order to explore alternative novel methods, the purpose of this study is to evaluate the effects of Nisin and L. rhamnosus GG on the biofilm-forming potential of S. epidermidis and the expression of biofilm-associated genes, including icaA, aap, and icaD.

MATERIALS AND METHODS

Sources and chemicals.

Lactobacillus rhamnosus GG (ATCC53103) was obtained from the Pasteur Institute of Iran, and Nisin was purchased from Sigma Co. (St. Louis, MO, USA). Staphylococcus epidermidis (RP62A) was gifted by the Applied Microbiology Research Center, Baqiyatallah University of Medical Sciences.

Determination of MIC and MBC of Nisin and Lactobacillus rhamnosus GG.

The broth micro dilution method determined MIC and MBC concentrations according to the Mottaghiyan approach (20). MIC is considered the lowest concentration of an antimicrobial agent capable of inhibiting the visible growth of bacteria after overnight culture. To this purpose, Nisin and L. rhamnosus GG were treated or co-cultured with S. epidermidis to determine their MIC individually on S. epidermidis. Initially, 100 μL of S. epidermidis suspension in TSB (0.4 ≤ OD ≤ 0.6) was cultured in a 96-well plate. Next, 100 μL of Tryptic Soy Broth (TSB) containing probiotic bacteria (ranging from 1×105 to 1×108 CFU/mL) or 100 μL of TSB containing Nisin (ranging from 64 μg/mL to 1024 μg/mL in two-fold serial dilutions) was added to each well of the 96-well microtiter plate, followed by overnight incubation with gentle rotation at 37°C using a shaker incubator. Bacterial growth was evaluated based on the broth’s turbidity and the lowest concentration of probiotic or Nisin that prevented S. epidermidis growth was considered their MIC. The MBC was defined as the lowest concentration where no bacterial growth was observed. This was determined by aseptically sub-culturing the contents of wells from the MIC results for individual bacteria on antimicrobial-free agar.

Biofilm formation.

To identify the effects of Nisin and L. rhamnosus GG on biofilm formation, the microtiter plate test (MPT) was employed with some modifications compared to the method described by Merritt et al. (21). Bacterial suspension in Muller-Hinton Broth (MHB) (Hi-Media Ltd., Mumbai, India) with a density of 0.5 McFarland was prepared. Then 100 μL of the suspension was added to separate wells in a 96-well microtiter plate. Next, 100 μL of MHB containing Nisin (ranging from 64 μg/mL to 1024 μg/mL in two-fold serial dilutions) or 100 μL of TSB containing probiotic bacteria (ranging from 1×105 to 1×108 CFU/mL) was added to each well. The plates were incubated overnight at 37°C. Next, the free-floating cells were removed, and the plate was washed using distilled water. Then, the wells were stained with 125 μL of 0.2% (w/v) crystal violet and incubated at room temperature for 15 min. The excess dye was rinsed with distilled water three times, and the plates were allowed to dry. Subsequently, 200 μL of absolute ethanol was added and incubated for an additional 15 min at room temperature. The contents of each well were transferred to new microtiter plate wells. Finally, the optical density of each well was measured at 570 nm. The negative controls consisted of all added reagents except for the bacterial suspension. The test was performed in triplicate. The mean absorbance at 570 nm was calculated. Merritt et al. explained that the strain is considered a biofilm producer if the optical density is higher than 0.2.

Expression levels of genes associated with biofilm formation.

To evaluate the effects of Nisin and L. rhamnosus GG on the expression of some biofilm-associated genes (aap, icaA, and icaD), the Mottaghiyan approach (20) was used. S. epidermidis was treated with a sub-MIC amount of Nisin (128 μg/mL) and L. rhamnosus GG (1×106 CFU/mL) for 24 h. After that, RNA extraction was carried out using the CinnaPure kit (cat No: PR891620, Cinnagen Co., Tehran). The concentration of RNA samples was quantified via the Nanodrop2000 (Thermo Fisher Scientific, Wilmington, DE, USA). Next, RNA samples were treated with DNase (Fermentase, Thermo Fisher Scientific, USA) based on the manufacturer’s instructions, followed by cDNA synthesis using Reverse Transcriptase AMV at 25 U/μL (Roche Life Science). Target genes were relatively quantified using Q-Master Mix with SYBR Green I (Genetbio, Daejeon, Korea; cat. No: Q9210) by the Real-time PCR system (Applied Biosystems, Foster City, CA, USA). For each sample, the reaction mixture comprised the following components: 10 μL of 2X Prime Q-Master Mix with SYBR Green I (Genetbio CAT. NO: Q9210), 1 μL of each primer (final concentration 1 μM), 1 μL of Rox Dye, 5 μL of RNase-free water, and 2 μL of cDNA, in a final reaction volume of 20 μL. The primer sequences and cycling temperature are presented in Table 1. The expression level of the gyr gene was surveyed as an internal control. The ΔΔCT method that normalizes to a housekeeping gene was used for quantification.

Table 1.

Primer sequences and thermal conditions of Real-time PCR analysis

Gene Forward (F) (5′-3′)
Revers (R) (5′-3′) 		Denaturation Temp & Time Annealing Temp & Time Extension Temp & Time Amplicon Size (bp) Ref
Aap F-AGAAACAAGCTGGTCAAG 90°C 30 s 56°C 40 s 72°C 60 s 117 (20)
R- CTGCGTAGTTAAGAAAATC
icaA F-TCTCTTGCAGGAGCAATCAA 90°C 30 s 56°C 40 s 72°C 60 s 186 (20)
R- AGGCACTAACATCCAGCA
icaD F-CCGGAGTATTTTGGATGTATTG 90°C 30 s 56°C 40 s 72°C 60 s 197 (20)
R-TTGAAACGCGAGACTAAATGTA
gyr F-CTTATATGAGAATCCATCTGTAGG 90°C 30 s 56°C 40 s 72°C 60 s 154 (20)
R- AGAACAATCTGCCAATTTACC
Open in a new tab

Statistical analysis.

Relative quantitative gene expression was analyzed using an independent t-test. Changes with a P-value of ≤0.05 were considered statistically significant.

RESULTS

MIC and MBC of Nisin and probiotic Lactobacillus rhamnosus GG on Staphylococcus epidermidis strains.

To evaluate the inhibitory and bactericidal effects of Nisin and L. rhamnosus GG on S. epidermidis growth, MIC and MBC tests were performed using the broth microdilution method. The MIC and MBC values were calculated as the medians of the three experiments. In this study, S. epidermidis was exposed to serial concentrations of Nisin or L. rhamnosus GG. The results showed that the MIC values for Nisin and L. rhamnosus GG were 256 μg/mL and 1×107 CFU/mL, respectively. The optimal MBC results for Nisin and L. rhamnosus GG were also observed at 512 μg/mL and 1×108 CFU/mL, respectively.

Nisin and Lactobacillus rhamnosus GG efficiently eliminate S. epidermidis biofilms on microtiter plates.

The biofilm-forming capacity of S. epidermidis was examined using a microtiter plate assay. As shown in Fig. 1A, increasing the concentration of Nisin bacteria prevented the biofilm formation of S. epidermidis strains, as indicated by the optical density at 570 nm. Our results also revealed that L. rhamnosus GG treatment could reduce S. epidermidis biofilm formation in vitro (Fig. 1B).

Fig. 1.

Fig. 1.

Open in a new tab

The effects of Nisin (A) and L. rhamnosus GG (B) treatment on biofilm-formation ability of S. epidermidis clinical isolates and on their anti-biofilm activities. Means and standard deviation of three independent experiments are shown.

Significant differences were observed between the untreated group and the Nisin or L. rhamnosus GG-treated groups (P<0.001). The highest biofilm inhibition rates were achieved with Nisin at a concentration of 512 μg/mL and with L. rhamnosus GG at a concentration of 1×108 CFU/mL against S. epidermidis.

Biofilm-associated gene expression analysis.

All extracted RNA was subjected to DNase treatment to remove genomic DNA before cDNA synthesis. RT-PCR was performed for each RNA sample to confirm the absence of genomic DNA. As seen in Fig. 2, there is only one single product for each target gene.

Fig. 2.

Fig. 2.

Open in a new tab

Evaluating the specificity of gene amplifications.

Specific primer pairs were used to assess the genes of interest using real-time qRT-PCR. As illustrated in Fig. 3, each reaction shows a single melt curve, confirming the optimal experimental design.

Fig. 3.

Fig. 3.

Open in a new tab

Melting curve analysis from a Real-time PCR assay for Aap, IcaA and IcaD gene expression in S. epidermidis isolates.

The RT-qPCR data showed that the expression ratio of the aap, icaA and icaD gene was significantly reduced after Nisin treatment compared to the untreated group (0.44, 0.25 and 0.6 fold, respectively) (P>0.05). Quantitative gene expression analysis was performed at 1×106 CFU/mL of the probiotic, based on the MIC assay results on S. epidermidis. In the present study, all biofilm-forming bacteria treated with L. rhamnosus GG showed reduced gene expression in biofilm production. The relative mRNA expression of the aap and icaA gene was significantly reduced (0.62 and 0.7 fold, respectively) compared to the negative control (P>0.05). Lactobacillus rhamnosus GG did not appear to affect the gene expression levels of icaD (P<0.05).

DISCUSSION

Staphylococcus epidermidis, due to its various virulence factors and unique features, such as its potential ability in biofilm formation and colonization on different surfaces, is considered the most important cause of nosocomial infections. In recent decades, this bacterium has posed many challenges in the treatment process due to the increase in the number of immunocompromised patients, the rise in medical device interventions, and the emergence of methicillin-resistant S. epidermidis strains, all of which are associated with the growing elderly population. Therefore, finding new alternative approaches to control S. epidermidis infections seems necessary. Considering that L. rhamnosus GG can prevent the production of biofilm by pathogenic bacteria and the anti-biofilm effects of Nisin have already been proven, this study aims to evaluate, for the first time, the antibiofilm activity of Nisin and L. rhamnosus GG on S. epidermidis and the expression of biofilm-associated genes, including icaA, aap, and icaD. To study the effect of Nisin on the target genes, the MIC of this bacteriocin on S. epidermidis was initially determined, and then the effects of Nisin and L. rhamnosus GG on aap, icaA, and icaD were assessed. The same steps were carried out for L. rhamnosus GG.

Our results demonstrated that Nisin can diminish the expression of aap, icaA, and icaD genes in S. epidermidis bacteria. The gene products of the icaADBC locus are responsible for synthesizing polysaccharide intercellular adhesin (PIA), the main molecule for intercellular adhesion in S. epidermidis. Additionally, the aap gene synthesizes the accumulation-associated protein, which is the main protein involved in self-aggregation and biofilm formation (2). However, biofilm formation is more complex than being solely governed by these genes, and suppressing these genes alone does not guarantee the inhibition of biofilm formation (22).

Twomey and his colleagues showed that Nisin A, at a MIC concentration of 3.75 μMol, can control S. epidermidis 28 strain, and at 7.5 μMol, it can control S. epidermidis 53 strain. Additionally, Nisin A significantly reduces the amount of biofilm formation by S. epidermidis on all surfaces (23). This study’s results were consistent with the current study’s results, and the difference in MIC concentrations was due to the use of different S. epidermidis strains in the two studies. Another study by Field et al. indicated that Nisin and its derivatives, alone and in combination with classical antibiotics, have antibiofilm effects against S. aureus and S. pseudintermedius (19). The effects of Nisin on aap, icaA, and icaD in other microorganisms have also been studied, such as the study by Pimentel-Filho et al., which showed that Nisin reduces icaD expression in Staphylococcus aureus (24). Furthermore, a study conducted on the inhibitory effect of Nisin on biofilm generation by Listeria monocytogenes, Staphylococcus aureus, and Salmonella enteritidis demonstrated that Nisin can reduce biofilm formation by all studied species (25).

We provided novel insights regarding the inhibitory effect of L. rhamnosus GG on the expression of biofilm-associated genes of S. epidermidis. In this study, we showed that L. rhamnosus GG reduced the expression of the aap and icaA genes. Other studies align with our results, but they focus on other bacteria. For example, the results by Saidi et al. indicated that the cell-free supernatant (CFS) extracts of L. casei ATCC 39392 and L. rhamnosus ATCC 7469 cultures significantly increased the expression levels of the cidA, hld, and icaR genes, but significantly downregulated the sarA and icaA genes in S. aureus. Consequently, the CFSs of both Lactobacillus spp. significantly reduced cell surface hydrophobicity, initial attachment, and biofilm formation in S. aureus (26). Another study showed that commercially available Lactobacillus strains, such as L. rhamnosus GG, reduced the biofilm formation of S. mutans clinical isolates (27).

Similarly, Lee et al. demonstrated that L. rhamnosus GG exerted an anti-biofilm activity by decreasing the expression of the gtfs gene, which is involved in the synthesis of the exopolysaccharide matrix crucial for biofilm formation, in S. mutans (28). Additionally, L. rhamnosus GG has other mechanisms to prevent biofilm formation by pathogenic bacteria. For instance, it has been shown that L. rhamnosus GG expresses lectin-like molecules capable of suppressing Escherichia coli and Salmonella biofilm formation (29).

The current study is the first to report the inhibitory effect of L. rhamnosus GG on biofilm formation and the expression of biofilm-associated genes of S. epidermidis, and there are no other studies in this area. Furthermore, considering the antibiofilm effect of Nisin on S. epidermidis, it can be suggested that Nisin and L. rhamnosus GG could be viable and safe treatment options for controlling and preventing infections associated with S. epidermidis in the future.

CONCLUSION

Here, we have demonstrated a possible mechanism for the inhibitory impact of Nisin and L. rhamnosus GG on S. epidermidis biofilm formation by directly dampening the expression of genes involved in biofilm formation. Based on these findings, Nisin and L. rhamnosus GG could be utilized as new therapeutic alternatives or as a complement in combination with classical antibiotics for treating bacterial skin infections or systemic infections. Moreover, Nisin and L. rhamnosus GG could also be effective inhibitors of biofilms that form on biomedical implants or hospital equipment.

ACKNOWLEDGEMENTS

The authors would like to thank to all colleagues in Applied Microbiology Research Center, Systems Biology and Poisonings Institute, Baqiyatallah University of Medical Sciences for their kind help.

REFERENCES

  • 1.Namvar AE, Bastarahang S, Abbasi N, Ghehi GS, Farhadbakhtiarian S, Arezi P, et al. Clinical characteristics of Staphylococcus epidermidis: a systematic review. GMS Hyg Infect Control 2014; 9: Doc23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Skovdal M, Khayinza Sorensen ON, Muchemwa D, Nyamwanza RP, Maswera R, Svendsen MN, et al. “It will not be easy to accept”: Parents conflicting attitudes towards pre-exposure prophylaxis for HIV prevention amongst adolescent girls and young women. Res Social Adm Pharm 2023; 19: 266–271. [DOI] [PubMed] [Google Scholar]
  • 3.Lou Q, Zhu T, Hu J, Ben H, Yang J, Yu F, et al. Role of the SaeRS two-component regulatory system in Staphylococcus epidermidis autolysis and biofilm formation. BMC Microbiol 2011; 11: 146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kant R, Rintahaka J, Yu X, Sigvart-Mattila P, Paulin L, Mecklin JP, et al. A comparative pan-genome perspective of niche-adaptable cell-surface protein phenotypes in Lactobacillus rhamnosus. PLoS One 2014; 9(7): e102762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Mathipa-Mdakane MG, Thantsha MS. Lacticaseibacillus rhamnosus: a suitable Candidate for the construction of novel bioengineered probiotic strains for targeted pathogen control. Foods 2022; 11: 785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Segers ME, Lebeer S. Towards a better understanding of Lactobacillus rhamnosus GG--host interactions. Microb Cell Fact 2014; 13 Suppl 1(Suppl 1): S7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Doron S, Snydman DR, Gorbach SL. Lactobacillus GG: bacteriology and clinical applications. Gastroenterol Clin North Am 2005; 34: 483–98, ix. [DOI] [PubMed] [Google Scholar]
  • 8.Martin R, Chamignon C, Mhedbi-Hajri N, Chain F, Derrien M, Escribano-Vazquez U, et al. The potential probiotic Lactobacillus rhamnosus CNCM I-3690 strain protects the intestinal barrier by stimulating both mucus production and cytoprotective response. Sci Rep 2019; 9: 5398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Spacova I, O’Neill C, Lebeer S. Lacticaseibacillus rhamnosus GG inhibits infection of human keratinocytes by Staphylococcus aureus through mechanisms involving cell surface molecules and pH reduction. Benef Microbes 2020; 11: 703–715. [DOI] [PubMed] [Google Scholar]
  • 10.Szajewska H, Wanke M, Patro B. Meta-analysis: the effects of Lactobacillus rhamnosus GG supplementation for the prevention of healthcare-associated diarrhoea in children. Aliment Pharmacol Ther 2011; 34: 1079–1087. [DOI] [PubMed] [Google Scholar]
  • 11.Yun B, Ryu S, Kang M, Lee J, Yoo J, Kim Y, et al. Probiotic Lacticaseibacillus rhamnosus GG increased longevity and resistance against foodborne pathogens in Caenorhabditis elegans by regulating MicroRNA miR-34. Front Cell Infect Microbiol 2022; 11: 819328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Slykerman RF, Hood F, Wickens K, Thompson JMD, Barthow C, Murphy R, et al. Effect of Lactobacillus rhamnosus HN001 in pregnancy on postpartum symptoms of depression and anxiety: a randomised double-blind placebo-controlled trial. EBioMedicine 2017; 24: 159–165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Boonma P, Spinler JK, Venable SF, Versalovic J, Tumwasorn S. Lactobacillus rhamnosus L34 and Lactobacillus casei L39 suppress Clostridium difficile-induced IL-8 production by colonic epithelial cells. BMC Microbiol 2014; 14: 177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Liu J, Huang R, Song Q, Xiong H, Ma J, Xia R, et al. Combinational antibacterial activity of Nisin and 3-Phenyllactic acid and their co-production by engineered Lactococcus lactis. Front Bioeng Biotechnol 2021; 9: 612105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.de Arauz LJ, Jozala AF, Mazzola PG, Penna TCV. Nisin biotechnological production and application: a review. Trends Food Sci Tech 2009; 20: 146–154. [Google Scholar]
  • 16.Shin JM, Gwak JW, Kamarajan P, Fenno JC, Rickard AH, Kapila YL. Biomedical applications of nisin. J Appl Microbiol 2016; 120: 1449–1465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Barbosa AAT, Mantovani HC, Jain S. Bacteriocins from lactic acid bacteria and their potential in the preservation of fruit products. Crit Rev Biotechnol 2017; 37: 852–864. [DOI] [PubMed] [Google Scholar]
  • 18.Ceotto-Vigoder H, Marques SLS, Santos INS, Alves MDB, Barrias ES, Potter A, et al. Nisin and lysostaphin activity against preformed biofilm of Staphylococcus aureus involved in bovine mastitis. J Appl Microbiol 2016; 121: 101–114. [DOI] [PubMed] [Google Scholar]
  • 19.Field D, O’Connor R, Cotter PD, Ross RP, Hill C. In vitro activities of Nisin and Nisin derivatives alone and in combination with antibiotics against Staphylococcus biofilms. Front Microbiol 2016; 7: 508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mottaghiyan Z, Aghazadeh M, Hosseini HM, Fooladi AAI. Evaluation of antibacterial activity of Zataria multiflora against the expression of icaADB and aap Gene and biofilm formation in Staphylococcus epidermidis. Arch Clin Infect Dis 2019; 14: e65321. [Google Scholar]
  • 21.Merritt JH, Kadouri DE, O’Toole GA. Growing and analyzing static biofilms. Curr Protoc Microbiol 2005; Chapter 1:Unit 1B.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pintens V, Massonet C, Merckx R, Vandecasteele S, Peetermans WE, Knobloch JK, et al. The role of sigmaB in persistence of Staphylococcus epidermidis foreign body infection. Microbiology (Reading) 2008; 154: 2827–2836. [DOI] [PubMed] [Google Scholar]
  • 23.Twomey E, Hill C, Field D, Begley M. Bioengineered Nisin derivative M17Q has enhanced activity against Staphylococcus epidermidis. Antibiotics (Basel) 2020; 9: 305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pimentel-Filho Nde J, Martins MC, Nogueira GB, Mantovani HC, Vanetti MC. Bovicin HC5 and nisin reduce Staphylococcus aureus adhesion to polystyrene and change the hydrophobicity profile and Gibbs free energy of adhesion. Int J Food Microbiol 2014; 190: 1–8. [DOI] [PubMed] [Google Scholar]
  • 25.Mahdavi M, Jalali M, Kermanshahi RK. The effect of nisin on biofilm forming foodborne bacteria using microtiter plate method. Res Pharma Sci 2009; 2: 113–118. [Google Scholar]
  • 26.Saidi N, Saderi H, Owlia P, Soleimani M. Anti-biofilm potential of Lactobacillus casei and Lactobacillus rhamnosus cell-free supernatant extracts against Staphylococcus aureus. Adv Biomed Res 2023; 12: 50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Soderling EM, Marttinen AM, Haukioja AL. Probiotic lactobacilli interfere with Streptococcus mutans biofilm formation in vitro. Curr Microbiol 2011; 62: 618–622. [DOI] [PubMed] [Google Scholar]
  • 28.Lee S-H, Kim Y-J. A comparative study of the effect of probiotics on cariogenic biofilm model for preventing dental caries. Arch Microbiol 2014; 196: 601–609. [DOI] [PubMed] [Google Scholar]
  • 29.Petrova MI, Imholz NC, Verhoeven TL, Balzarini J, Van Damme EJ, Schols D, et al. Lectin-like molecules of Lactobacillus rhamnosus GG inhibit pathogenic Escherichia coli and Salmonella biofilm formation. PLoS One 2016; 11(8): e0161337. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Microbiology are provided here courtesy of Tehran University of Medical Sciences

RESOURCES