Raw Inonotus obliquus polysaccharide counteracts Alzheimer’s disease in a transgenic mouse model by activating the ubiquitin-proteosome system

Abstract

BACKGROUND/OBJECTIVES

Inonotus obliquus has been used as antidiabetic herb around the world, especially in the Russian and Scandinavian countries. Diabetes is widely believed to be a key factor in Alzheimer’s disease (AD), which is widely considered to be type III diabetes. To investigate whether I. obliquus can also ameliorate AD, it would be interesting to identify new clues for AD treatment. We tested the anti-AD effects of raw Inonotus obliquus polysaccharide (IOP) in a mouse model of AD (3×Tg-AD transgenic mice).

MATERIALS/METHODS

SPF-grade 3×Tg-AD mice were randomly divided into three groups (Control, Metformin, and raw IOP groups, n = 5 per group). β-Amyloid deposition in the brain was analyzed using immunohistochemistry for AD characterization. Gene and protein expression of pertinent factors of the ubiquitin-proteasome system (UPS) was determined using real-time quantitative polymerase chain reaction and Western blotting.

RESULTS

Raw IOP significantly reduced the accumulation of amyloid aggregates and facilitated UPS activity, resulting in a significant reduction in AD-related symptoms in an AD mouse model. The presence of raw IOP significantly enhanced the expression of ubiquitin, E1, and Parkin (E3) at both the mRNA and protein levels in the mouse hippocampus. The mRNA level of ubiquitin carboxyl-terminal hydrolase isozyme L1, a key factor involved in UPS activation, also increased by approximately 50%.

CONCLUSIONS

Raw IOP could contribute to AD amelioration via the UPS pathway, which could be considered as a new potential strategy for AD treatment, although we could not exclude other mechanisms involved in counteracting AD processing.

INTRODUCTION

Alzheimer’s disease (AD) is a neurodegenerative disease characterized by neuronal death and cognitive impairment, accompanied by progressive memory loss, disorientation, impaired self-care, and personality changes. It accounts for approximately 60% of all dementia cases [1]. Currently, no effective drugs are available for AD. Histopathological hallmarks of AD are intracellular neurofibrillary tangles and extracellular formation of senile plaques composed of the amyloid-beta peptide (Aβ) in aggregated form along with metal ions such as copper, iron, or zinc [2]. Although AD has a complex pathological mechanism, which is still not fully understood, the amyloid cascade hypothesis is widely accepted as a pathological explanation [3]. According to the amyloid cascade hypothesis, abnormally elevated Aβ level in the brain outside the neuronal cells may lead to the formation of fibrils rich in β-folded structures and Aβ aggregation, and then induce neurotoxicity and neurodegeneration [4]. The precursor of Aβ (amyloid precursor protein, APP) is a protein wrongly modulated after translation; however, under a powerful cellular protein quality control system, toxic or harmful coded peptides or proteins are recycled. The ubiquitin-proteasome system (UPS) is one of the major pathways of intracellular proteolysis, providing the fundamental molecular machinery for short-lived protein degradation and helping maintain overall proteostas in eukaryotic cells. Although UPS signaling is complicated and far from completely understood, one key function of the UPS is to recognize and degrade ubiquitinated and generally misfolded proteins [5]. Studies have shown that the accumulation of abnormal protein aggregates in the progressive development of AD can seriously interfere with normal protein homeostasis and the normal function of UPS, thus affecting the degradation of Aβ and leading to the formation of amyloid plaques [6,7,8], and the UPS was also found to ameliorate misfolded proteins in other neurodegenerative diseases.

Inonotus obliquus is a perennial macrofungus of the Polyporaceae family, with an irregular cone shape and a coke-like appearance. It is found predominantly in the cold northern regions of the Holarcticin the Northern Hemisphere [9]. It is now widely used in China, Russia, Japan, and the Nordic countries because of its active components and pharmacological effects [10]. Inonotus obliquus polysaccharide (IOP), the primary constituent of I. obliquus, has been found to have multiple functions such as anti-tumor, anti-inflammatory, anti-oxidation, anti-apoptosis, regulatory hypoglycemic/hypolipidemic effects, and neuroprotective properties [11,12,13,14,15,16,17,18,19,20]. However, it is unclear whether IOP can alleviate AD symptoms or slow down the neurodegenerative process, which has rarely been reported to date. Clarifying the beneficial effects of IOP on AD and investigating the mechanisms underlying this process would contribute to the understanding of AD progression and might contribute to the selection of new candidates for AD treatment. In this study, we investigated how raw IOP affected the physiological and biochemical indicators of triple-transgenic mouse model of AD (3×Tg-ADmouse), and our study showed that the raw IOP could effectively counteract to the symptoms in AD mice, by stimulating UPS pathway and enhanced the clearance of Aβ amyloid.

MATERIALS AND METHODS

Extraction and characterization of IOP

I. obliquus fruiting bodies collected from the Diancang Mountains (Dali, China) were extracted 3 times in 15-fold double distilled water at 70°C during a 3 h period and replaced with fresh petroleum ether for 1.5 h [21]. Extractions were combined and concentrated to an appropriate volume, deproteinized by the Sevage method (chloroform:n-butanol = 4:1, polysaccharide solution:Sevage solution = 4:1, thoroughly mixed, and deproteinized 5 times). The phenol-sulfuric acid method was used to determine the polysaccharide content of the I. obliquus water extract [22].

The homogeneity and molecular weight of various fractions were measured using SEC-MALLS-RI. The weight and number-average molecular weight (Mw and Mn) and polydispersity index (Mw/Mn) of various fractions in 0.1 M NaNO₃ aqueous solution containing 0.02% NaN₃ (or dimethyl sulfoxide [DMSO] solution containing 0.5% LiBr) were measured on a DAWN HELEOS-II laser photometer (Wyatt Technology Co., Santa Barbara, CA, USA) equipped with three tandem columns (300 × 8 mm, Shodex OH-pak SB-805, 804 and 803; Showa Denko K.K., Tokyo, Japan) which was held at 45°C or 60°C using a model column heater by Sanshu Biotech. Co. LTD (Shanghai, China). The flow rate was set to 0.4 mL/min (or 0.3 mL/min). A differential refractive index detector (Optilab T-rEX; Wyatt Technology Co.) was simultaneously connected to obtain the concentration of the fractions and dn/dc value. The dn/dc value of the fractions in 0.1 M NaNO₃ aqueous solution containing 0.02% NaN₃ was determined to be 0.141 mL/g, and in DMSO solution was determined to be 0.07 mL/g.

Animal and experimental design

Fifteen 12-month-old 3×Tg-AD and five C57/BL6 SPF-grade mice were obtained from the Teacher’s Laboratory of Gong Zhiting, School of Basic Medical Science, Dali University (animal production license number: SYXK [Yunnan] 2018-0002). All mice were housed in cages (5 mice per cage), with constant temperature (25 ± 2°C) and light (7 AM to 7 PM) conditions. Food and water were provided to all mice throughout the study. The mice were randomly divided into 3 groups after one week of acclimatization (5 mice per group). Three groups of mice were assigned as follows: positive control group (Ctrl), metformin group (3 mg/kg/d, Met), and raw Inonotus obliquus polysaccharide group (6.8 g/kg/d, IOP; Ningshan Guosheng Biotechnology Co., Ltd, Shanghai, China). The mice were intragastrically administered once daily for 15 days. The C57/BL6 group was used as the control group to ensure that the mice were administered the same daily gavage volume of sterile saline. After 15 days of treatment, the mice were fasted overnight and sacrificed. Brain tissue was subsequently collected for further studies, including immunohistochemical experiments and mRNA expression analyses.

DNA extraction and identification

Total DNA was extracted from the tails of 3×Tg-AD mice using the Blood/Cell/Tissue Genome DNA Extraction Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The DNA purity was determined using an ultraviolet-visible spectrophotometer (Mio Instrument Co., Ltd, Hangzhou, China). Polymerase chain reaction (PCR) was performed using Gold Mix (green) (Tsingke Biotechnology Co., Ltd., Beijing, China) and primers were synthesized by Shanghai Sangon (Shanghai, China). PCR primers were designed using the Primer3 software. The primer sequences were used as follows: Psenl, forward: AGGCAGGAAGATCACGTGTTCAAGTAC, reverse: CACACGCACACTCTGACATGCACAGGC; APP, forward: ACCCACTGATGGTAATGCT, reverse: TCTCTCTCGGGGTGCTTGG; tau, forward: TCGCAGTCACCGCCACCAC, reverse: TGTCATCGCTTCCAGTCCCGTC. The PCR products were analyzed by 1.5% agarose gel electrophoresis and observed under ultraviolet light.

Immunohistochemical experiments

Initially, the brains were removed, fixed in 4% paraformaldehyde solution at 4°C overnight, then dehydrated with 30% sucrose solution, and embedded in optimal cutting temperature compound. Brain sections of 30 µm thickness were sliced using a cryostat (Thermo Fisher Scientific, Waltham, MA, USA). Sections were selected from each brain and incubated overnight with a mouse anti-Aβ₄₂ antibody (1:200, sc28365; Santa Cruz Biotechnology, Santa Cruz, CA, USA). They were then incubated with a biotinylated mouse secondary antibody (1:250, Immunohistochemistry SABC kit [BL733A]) for another 0.5 h, followed by staining with streptavidin-biotin complex/horseradish peroxidase (HRP). Finally, antigen-antibody complexes were detected using the avidin-biotin peroxidase method with diaminobenzidine (DAB) as a chromogenic substrate (Vectastain ABC kit, Vector Laboratories, Burlingame, CA, USA). Subsequently, the tissue samples were counterstained with hematoxylin (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China), dehydrated with a gradient of alcohol (75% ethanol, 95% ethanol, and absolute ethanol), sealed with neutral resin, and observed under a microscope (Olympus Optical Co., Tokyo, Japan). The integrated optical density (IOD) of the positively stained areas was quantified and analyzed using the ImageJ software.

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from the mouse brain tissue using the Total Fast Pure Cell/Tissue RNA Isolation Kit and immediately reverse transcribed to cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). In addition, we determined the mRNA transcript levels of ubiquitin, E1, Parkin, ubiquitin carboxyl-terminal hydrolase isozyme L1 (UCHL1), and Aβ₄₂ from each group using RT-qPCR assay. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer sequences are listed in Table 1. The real-time PCR conditions were composed of a pre-denaturation cycle at 95°C for 30 s, followed by 40 cycles, each cycle consisting of 95°C for 25 s, and 60°C for 30 s. Dissociation curve analysis was performed for each reaction to guarantee amplification specificity. The 2^−ΔΔCt method was used to determine the relative gene expressions and the results displayed using histograms drawn with GraphPad Prism 8 software.

Table 1. Primers sequences for real-time quantitative polymerase chain reaction.

Gene	Size (bp)	Prim sequence (5′-3′)
Ubiquitin	151	F: TTAACGGACGCTTAACCGAT
		R: TTCACGTTCTCGATGGTGTC
E1	192	F: AGTACAGGGCATGATCCAAC
		R: ACAAAGTCAGGCTCTACCAG
Parkin	86	F: TTCCGAATCACCTGACGGTT
		R: ATGACTTCTCCTCCGTGGT
UCHL1	186	F: TGCTTGTTTCTGCTCCCGTCT
		R: CACTTTGTTCAGCATCTCGGGGTT
Aβ42	109	F: GATGCAGAATTCCGACATG
		R: CCACCATGAGTCCAATGAT
GAPDH	186	F: CAACTCCCACTCTTCCACCT
		R: CTTGCTCAGTGTCCTTGCTG

E1, ubiquitin-activated enzyme; UCHL1, ubiquitin carboxyl-terminal hydrolase 1; Aβ, amyloid-β protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

Mouse brain tissue was lysed using ice-cold RIPA lysis buffer (Solarbio, Beijing, China), and the homogenate was centrifuged at 4°C for 15 min. Protein concentration was evaluated using a BCA Protein Assay Kit (P0012; Shanghai Biyuntian Bioengineering Co., Ltd., Shanghai, China). Protein lysates were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The membranes were blocked and then incubated with primary antibody, β-actin (1:5,000) (AC004, mouse mAb, ABclonal, Woburn, MA, USA), Parkin (1:1,000) (A0968, rabbit mAb; ABclonal), UCHL1 (1:1,000) (sc-271639, mouse mAb; Santa Cruz Biotechnology), overnight at 4°C. The membranes were subsequently incubated with secondary antibodies, HRP-conjugated anti-mouse (HA1006, mouse pAb; HuaBio, Woburn, MA, USA) and anti-rabbit antibody (AS014, rabbit pAb; ABclonal) for 1 h at room temperature, and developed with ECL chemiluminescent detection reagent subsequently (Yisheng Biotechnology Co., Ltd, Shangha, China), β-actin was taken as loading control, the Image J software was served for quantification analysis.

Statistical analysis

The experimental data obtained from three independent experiments are presented as the mean ± standard error of the mean (SEM), and GraphPad Prism 8 software was used to calculate the P value. The Kolmogorov-Smirnov test was performed to test variables for normality, in which P > 0.05 indicated normally distributed data. The t-test was used for comparison between 2 groups, and the variation in multiple groups was analyzed using a one-way analysis of variance (Bonferroni method).

RESULTS

The extraction and characterization of raw IOP

The IOP extraction rate was 11.2%. The polysaccharides were subsequently precipitated using 75% alcohol, resulting in a yield of 73.8%. The average molecular weight of IOP was 2.23 × 10⁴ Da (Fig. 1A) and was composed of Fuc, Rha, Ara, Gal, Glc, Xyl, Man, and Glc-UA at 12.25%, 1.90%, 0.93%, 26.35%, 43.06%, 0.87%, 7.37%, and 7.28%, respectively (Fig. 1B).

Fig. 1. The extraction and characterization of raw IOP.

(A) Molecular weight of various fractions was measured using SEC-MALLS-RI. (B) The extracts were analyzed by high-performance anion-exchange chromatography on a CarboPac PA-20 anion-exchange column to determine the composition of IOP.

IOP, Inonotus obliquus polysaccharide; LS, light scattering; RI, refractive index.

Aβ deposited in 3×Tg-AD mouse model

The Aβ deposition is one of the most important hallmarks of AD in the hippocampus of 3×Tg-AD mice (Fig. 2A and B), while the deposition of Aβ and phosphorylated tau protein triggers a series of reactions, including gliosis and synaptic dysfunction, resulting in neurodegeneration [23]. In 3×Tg-AD mice compared with C57/BL6 control mice (Fig. 2A), the level of Aβ₄₂ in the hippocampus was significantly increased in the positive control group (P < 0.001), which was approximately 6 times higher than that in control mice (Fig. 2C), as depicted in Fig. 2A-C. The 3×Tg-AD transgenic mice were characterized as an animal model of AD with high brain amyloid deposits and genotype-related changes.

Fig. 2. Raw IOP could ameliorate the amyloid-beta deposition in AD mice.

(A) The deposition of Aβ₄₂ in the hippocampus of C57/BL6 mice (×20) as normal control. (B) Aβ₄₂ deposition (indicated by black arrow) in the hippocampus of 3×Tg-AD mice (×20). (C) Quantitative analysis of neuroinflammatory plaques in A and B. The C57/BL6 mice were taken as a normal control to 3×Tg-AD mice, ^***P< 0.001. (D) The deposition of Aβ₄₂ in the hippocampus of mice in Ctrl group. (E) The deposition of Aβ₄₂ in the hippocampus of mice in Met group. (F) The deposition of Aβ₄₂ in the hippocampus of mice in IOP group. (G) Quantitative analysis of neuroinflammatory plaques in A, B and C. ^***P< 0.001, compared with Ctrl group.

Three groups of mice were assigned as follows: positive control group (Ctrl), metformin group (Met), and raw Inonotus obliquus polysaccharide group (IOP).

IOP, Inonotus obliquus polysaccharide; AD, Alzheimer’s disease; Aβ, amyloid-beta peptide; ns, not significant.

Raw IOP ameliorated the deposition of Aβ₄₂ on hippocampus in 3×Tg-AD mice

To verify the efficacy of raw IOP as a potential therapeutic candidate for AD, we conducted the in vivo study using 3×Tg-AD transgenic mice gavaged with distilled water, metformin (3 mg/kg/d), or raw IOP(6.8 g/kg/d) for 15 days. The expression of Aβ₄₂ levels in the brain tissues of 3×Tg-AD mice were analyzed by immunofluorescence staining. As shown in Fig. 2D-G, immunohistochemistry analysis of the Aβ₄₂ by antibody shows brown deposits in the cytoplasm under microscopy (Fig. 2D). Compared with the blank control group without intervention, hippocampal positive neurons were slightly lighter stained and sparser in the Met and IOP groups (P < 0.001) (Fig. 2E and F). Therefore, our results indicated that raw IOP feeding could improve Aβ₄₂ deposition in the brain tissue of the 3×Tg-AD mouse model. The ameliorative effects of IOP on Aβ amyloidosis were similar to those of metformin, a typical antidiabetic medicine used in the clinic (Fig. 2G).

UPS impairments detected in 3×Tg-AD mice

A previous study revealed that UPS impairment occurs long before the formation of β-amyloid plaques, suggesting that the formation of senile plaques may be a progressive process and that neuropathological alterations may take longer than previously thought [24]. To further examine whether the UPS was impaired in brain regions of 3×Tg-AD mice, we performed RT-qPCR analysis of the mRNA levels of UPS-related genes. As shown in Fig. 3A-D, compared with the blank control group, the mRNA expression levels of ubiquitin, UCHL1, E1 and Parkin (E3) were significantly downregulated in the 3×Tg-AD group (P < 0.05). This also indicated that the UPS was impaired or dysfunctional in the brain tissue of the 3×Tg-AD mouse model.

Fig. 3. Raw IOP could ameliorate the UPS impairment in AD mice.

(A) The mRNA level of ubiquitin in mice. (B) The mRNA level of E1 in mice. (C) The mRNA level of Parkin in mice. (D) The mRNA level of UCHL1 in mice (E) The mRNA level of ubiquitin in mice. (F) The mRNA level of E1 in mice. (G) The mRNA level of Parkin in mice. (H) The mRNA level of UCHL1 in mice.

Three groups of mice were assigned as follows: positive control group (Ctrl), metformin group (Met), and raw Inonotus obliquus polysaccharide group (IOP).

IOP, Inonotus obliquus polysaccharide; UPS, ubiquitin-proteasome system; AD, Alzheimer’s disease; UCHL1, ubiquitin carboxyl-terminal hydrolase isozyme L1; ns, not significant.

^*P < 0.05, ^**P < 0.01, ^***P < 0.001, compared with Ctrl group.

Raw IOP counter acted to UPS impairment by recovering the mRNA expression of UPS related genes in mouse hippocampus

The UPS degrades Aβ and has a significant effect on Aβ toxicity [7]. The expression levels of key enzymes and proteins, such as E2-25K, HRD1, Parkin, and UCHL1, may be involved in counteracting AD [25,26,27]. Therefore, in our study, under treatment with raw IOP, as expected, as shown in Fig. 3E-H, compared with the blank control group, the mRNA expression levels of ubiquitin, E1, and Parkin (E3) were significantly elevated, while the mRNA expression levels of UCHL1 were also increased by approximately 50% in the IOP group (P < 0.05). Met showed the same effects on UPS stimulation by upregulating mRNA expression as the positive control, suggesting that metformin is a clinical candidate for AD treatment. The elevation of the aforementioned factors showed similar trends in UPS activation following treatment with Met and IOP. The difference between the IOP and control groups was statistically significant (P < 0.05). Taken together, the impairment of key factors involved in UPS regulation, such as Parkin, HRD1, and UCHL1, may affect Aβ production, whereas raw IOP promotes the expression of UPS-related genes at the gene level, thereby improving UPS function.

The effect of raw IOP on the expression of key proteins regulating UPS pathway

In addition, we detected key proteins involved in the UPS pathway in the hippocampus of 3×Tg-AD mice by western blotting, as shown in Fig. 4. Compared with the blank control group, the expression levels of UCHL1 and Parkin (E3) in the Met group were significantly increased (P < 0.05), the expression levels of E3 in the IOP group were increased (P < 0.05), and UCHL1 showed an increasing trend. Thus, raw IOP promoted the expression of UPS-related proteins, further illustrating its stimulatory effects on UPS function.

Fig. 4. The effect of raw IOP on the expression of key proteins regulating UPS pathway.

(A) The expression of UCHL1 and Parkin in mice. (B) The quantitative analysis of Parkin in mice hippocampus. (C) The quantitative analysis of UCHL1 in mice hippocampus.

Three groups of mice were assigned as follows: positive control group (Ctrl), metformin group (Met), and raw Inonotus obliquus polysaccharide group (IOP).

IOP, Inonotus obliquus polysaccharide; UPS, ubiquitin-proteasome system; UCHL1, ubiquitin carboxyl-terminal hydrolase isozyme L1; ns, not significant.

^*P < 0.05, ^**P < 0.01, compared with Ctrl group.

We also tested the mRNA levels of previously studied markers, including ubiquitin, E1, Parkin, and UCHL1. If significant variations in these markers could be found in AD, it would be meaningful to consider these markers for clinical diagnostic practice. Therefore, blood samples from the AD and control groups were collected for mRNA analysis. However, no significant differences were detected in the mRNA levels of ubiquitin, E1, Parkin, and UCHL1 (Fig. 5).

Fig. 5. The UPS regulating factors were not changed in AD mice.

Blood samples were collected and applied for UPS regulating factor analysis including ubiquitin (A), E1 (B), Parkin (C), and UCHL1 (D) by real-time quantitative polymerase chain reaction analysis under AD and IOP intervention.

Three groups of mice were assigned as follows: positive control group (Ctrl), metformin group (Met), and raw Inonotus obliquus polysaccharide group (IOP).

UPS, ubiquitin-proteasome system; AD, Alzheimer’s disease; UCHL1, ubiquitin carboxyl-terminal hydrolase isozyme L1; IOP, Inonotus obliquus polysaccharide; ns, not significant.

In summary, according to our study, the key factors responsible for UPS regulation, including ubiquitin, E1, Parkin, and UCHL1, were down regulated in AD at both the mRNA and protein levels. Both Met and raw IOP ameliorated UPS impairment by up regulating the expression of these factors. This study introduced a new approach to using antidiabetic herbs and functional foods to help patients with AD.

DISCUSSION

The prevention and treatment of AD remains a serious global challenge, and despite rapidly expanding efforts, no effective treatment is yet available for AD [28]. Fungal species, which contain many nutrients and bioactive compounds, are underutilized as potential candidate agents for AD treatment. In particular, IOP has gained wide acceptance in Europe and is considered by the medical community an effective source for cancer prevention and alleviating cerebrovascular diseases and diabetes [29,30]. Recent studies have suggested that endocrine abnormalities, especially diabetes, are common in AD, and AD is even regarded as type 3 diabetes [31]. Therefore, we speculated that IOP exerts positive therapeutic effects on AD, although the exact mechanism has not yet been elucidated [13]. A previous study by Han et al. [13] showed that IOP could significantly ameliorate oxidative stress induced in AD mice and that the application of IOP in AD mice could counteract apoptosis. Their study also supported our hypothesis that IOP could ameliorate the accumulation of Aβ amyloid. However, this study did not explain the mechanisms by which oxidative stress was induced. Our study indicated a dysfunction of the UPS and could explain how these findings were induced in AD mice. Oxidative stress is caused by dysfunction of the ubiquitin-proteasome system, leading to harmful effects on cholinergic cells, and has been reported in other neurodegenerative diseases, including AD [32]. Therefore, we suspect that targeting the prevention of UPS dysfunction in AD is a valuable therapeutic strategy. Although IOP is traditionally used as an antidiabetic herb, we have reported its beneficial effects on the UPS in AD mouse models. Additionally, considering the beneficial effects of IOP as a functional food or herb, a thorough purification of IOP might be costly or even overqualified for functional food application; therefore, we used raw IOP in this study rather than purified IOP as reported by Han et al. [13], and similar beneficial effects of raw IOP were observed.

In this study, APP/PS1/tau triple-transgenic mice overexpressing mutant APP (APPSWE), PS1 (PS1M146V), or tau (tauP301L) were used to investigate the effect of raw IOP on 3×Tg-AD. The 3×Tg-AD mouse model of AD progressively develops both Aβ plaques and neurofibrillary tangles with a temporal and spatial distribution that closely mimics AD in humans [33]. Recent studies suggested that intracellular Aβ accumulation plays an important role in the pathogenesis of AD. Intracellular Aβ₄₂ accumulation occurs in the pyramidal neurons of the hippocampus and entorhinal cortex long before the emergence of Aβ plaques and paired helical filaments in the brains of AD patients [34]. Reducing or eliminating the production of Aβ is an important strategy for treatment, at least hindering the progression of Alzheimer’s [35]. In our study, compared with the control group, the number of positively stained amyloid plaques was significantly decreased in both the Met and raw IOP groups as shown by immunohistochemical staining tests, which indicated that IOP could ameliorate the formation of toxic species of Aβ and hinder the accumulation of misfolded proteins in the brains of 3×Tg-AD mice, which was supported by the results of Garcia-Alloza et al. [36] and Ringman et al. [37]. At the meanwhile, growing evidence shows that impaired Aβ clearance appears to be one of the major causes of Aβ accumulation in late-onset sporadic AD, which accounts for over 95% of cases [38]. Therefore, it is not difficult to associate the UPS, a major intracellular proteolytic pathway that promotes the degradation of normal cellular proteins as well as the clearance of misfolded proteins [39]. The accumulations of Aβ and the hyperphosphorylation of tau, as well as neurodegeneration in AD, are closely connected with UPS dysfunction [40]. Evidence suggests that proteasome activity decreases in the brains of patients with AD [41,42]. Furthermore, a recent study showed that deficiency in UCHL1, a ubiquitin hydrolysis, induced behavioral deficits in APP-overexpressing mice [43], highlighting the importance of UPS impairments in AD mouse models. Therefore, we were interested in whether the UPS was damaged in the 3×Tg-AD mouse model, and this hypothesis was supported by the results of this study. We found that proteasome activity was impaired in the 3×Tg-AD mice. However, it remains unclear whether the accumulation of Aβ was induced by the dysfunction of UPS or the dysfunction of UPS was caused by Aβ aggregation, which is still a subject of debate relating to the pathogenesis of AD [44]. Considering the unknown correlation between Aβ and the function of UPS in AD, we hypothesized that the formation of amyloid plaques in AD mice may be a product of ubiquitin-mediated protein degradation defects. Raw IOP may play a pivotal role in Aβ clearance via the UPS pathway, thereby contributing to AD treatment.

The effective activation of the UPS has been shown to be beneficial for many diseases, especially those induced and/or tightly related to protein misfolding and aggregation, such as AD, Huntington’s disease, Parkinson’s disease, and various spinocerebellar ataxias [45,46,47]. Therefore, we suspect that the stimulation of the UPS could be a potential strategy for AD treatment. Many natural products could be beneficial for AD; however, the exact underlying mechanisms are unclear, and it would be difficult to improve the treatment effects to fulfill clinical practice in the future. Increased IOP has been reported to counteract diabetes, which can also contribute to AD release as Met did. Therefore, in this study, Met was used as a positive control for its neuroprotective effects. We used RT-qPCR and western blotting analysis to verify that IOP exerted beneficial effects on AD via the activation of the UPS pathways. The E3 Ub protein ligases play a pivotal role in the ubiquitination reaction because they mainly determine the substrate specificity of the Ub conjugation reaction, a key regulatory process for the ubiquitination of aggregated substrates, which includes Parkin, HRD1, and UCHL-1 [48]. Lonskaya et al. [49] revealed that the intracellular aggregation of Aβ and damaged proteasome activity could be restored by the activation of Parkin. Furthermore, Parkin showed the capability to protect neurons, by enhancing the ubiquitination and clearance of misfolding Aβ, and it also reverses behavioral aberrations of the AD model mouse by reversing the deleterious effects of Aβ via proteosome system [50]. UCHL1 is an E3 ligase that is mainly expressed in neurons and functions as a deubiquitinating enzyme. The down regulation of both UCHL1 mRNA and UCHL1 protein has been detected in AD [26]. UCHL1 is an attractive drug target for AD; besides reducing Aβ production, UCHL1 has also been found to play an essential role in synaptic plasticity [51]. Our results showed that the expression of almost all E3 ligases, including ubiquitin, E1, and Parkin (E3), was upregulated, as was the expression of UCHL1, under Met and IOP treatment, which was supported by other studies conducted by Solano et al [52] and Zhang et al. [53]. The functions of multiple E3 ligases involved in Aβ clearance are shown in Fig. 6.

Fig. 6. Potential intervention mechanism of raw Inonotus obliquus polysaccharide on UPS in AD mice.

UPS, ubiquitin-proteasome system; AD, Alzheimer’s disease; Ub, ubiquitin; E1, ubiquitin-activated enzyme; E2, ubiquitin-conjugating-enzyme; E3, ubiquitin–protein ligase; UCHL1, ubiquitin carboxyl-terminal hydrolase 1; APP, amyloid precursor protein; Aβ, amyloid-β protein.

Although the therapeutic effect of metformin in this experiment was slightly better than that of the raw IOP extract in the mouse model, this might be due to the impurities of IOP and the unoptimized dose used in this study, which will be further studied in the future. Furthermore, the relationship between the neuroprotective properties and specific ingredients of raw IOP remains unclear and requires a detailed systematic investigation. Our results provide experimental evidence supporting further investigation of IOP as a potential therapeutic candidate for AD, in addition to its beneficial function in type 2 diabetes mellitus. In conclusion, we successfully confirmed that raw IOP showed beneficial effects in vivo for AD treatment by promoting the intracellular degradation of Aβ via the UPS pathway.