Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma

Lizhi Pang; Songlin Guo; Fatima Khan; Madeline Dunterman; Heba Ali; Yang Liu; Yuyun Huang; Peiwen Chen

doi:10.1016/j.xcrm.2023.101238

. 2023 Oct 18;4(11):101238. doi: 10.1016/j.xcrm.2023.101238

Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma

Lizhi Pang ^1,², Songlin Guo ^1,², Fatima Khan ^1,², Madeline Dunterman ¹, Heba Ali ¹, Yang Liu ¹, Yuyun Huang ¹, Peiwen Chen ^1,^3,^∗

PMCID: PMC10694605 PMID: 37858339

Summary

Glioblastoma (GBM) is a hypoxic and “immune-cold” tumor containing rich stromal signaling molecules and cell populations, such as proteases and immunosuppressive tumor-associated macrophages (TAMs). Here, we seek to profile and characterize the potential proteases that may contribute to GBM immunosuppression. Legumain (LGMN) emerges as the key protease that is highly enriched in TAMs and transcriptionally upregulated by hypoxia-inducible factor 1-alpha (HIF1α). Functionally, the increased LGMN promotes TAM immunosuppressive polarization via activating the GSK-3β-STAT3 signaling pathway. Inhibition of macrophage HIF1α and LGMN reduces TAM immunosuppressive polarization, impairs tumor progression, enhances CD8⁺ T cell-mediated anti-tumor immunity, and synergizes with anti-PD1 therapy in GBM mouse models. Thus, LGMN is a key molecular switch connecting two GBM hallmarks of hypoxia and immunosuppression, providing an actionable therapeutic intervention for this deadly disease.

Keywords: glioblastoma, hypoxia, immunosuppression, macrophages, protease, LGMN, immunotherapy

Graphical abstract

Highlights

•
LGMN is specifically expressed in TAMs and regulated by HIF1α
•
LGMN promotes TAM immunosuppressive polarization via the GSK-3β-STAT3 pathway
•
Inhibition of macrophage HIF1α and LGMN impairs GBM progression
•
Blockade of the HIF1a-LGMN axis synergizes with anti-PD1 therapy in GBM

Pang et al. show that LGMN is highly enriched in TAMs and transcriptionally regulated by HIF1α. LGMN promotes TAM immunosuppressive polarization via activating the GSK-3β-STAT3 signaling pathway. Disrupting the HIF1α-LGMN signaling axis inhibits tumor growth, activates anti-tumor immunity, and synergizes with anti-PD1 therapy in GBM mouse models.

Introduction

Glioblastoma (GBM) is the most prevalent and lethal form of primary brain tumor in adults with a 5-year survival rate of only about 10%.¹^,² The current standard of care only offers modest relief for GBM patients and even worse is that the tumors eventually recur.³ Recent advances on tumor microenvironment (TME) have revealed its importance in driving GBM heterogeneity and treatment resistance.⁴^,⁵ The GBM TME harbors various myeloid cell populations, which include tumor-associated macrophages (TAMs), dendritic cells (DCs), myeloid-derived suppressor cells (MDSCs), and neutrophils.⁶ Notably, TAMs are the most prominent population of stromal cells in the GBM TME, accounting for up to 50% of total cells in the whole tumor mass.⁷^,⁸ Our prior work has demonstrated that PTEN deficiency in GBM cells upregulates lysyl oxidase to trigger macrophage infiltration into the TME. Consequently, these infiltrating macrophages support GBM cell survival, generating a functional tumor-macrophage symbiosis.⁹ Moreover, GBM TAMs are usually polarized toward an immunosuppressive phenotype to suppress T cell activity, resulting in promoting tumor progression, immunosuppression, and therapy resistance.⁸^,⁹ These findings expand our understanding of how cell-cell symbiotic interactions contribute to GBM progression. Although many therapeutic strategies have been proposed to target the symbiosis,⁶^,¹⁰ single-cell profiling of immune cells in GBM suggests that TAMs are a population of heterogeneous and plastic cells that can easily adapt to environmental changes and therapeutic interventions.⁵^,⁸ Therefore, continued research focusing on developing therapeutic strategies targeting the context-dependent codependency is desirable for improving GBM patient outcome.

Proteases are associated with tumor progression across cancer types. Initially, they were considered as proteolytic enzymes that promote tumor invasion due to their tumor-associated proteolytic activity on degrading extracellular matrix (ECM). However, increasing evidence shows that proteases have more fundamental roles in multiple processes, including migration, adhesion, apoptosis, proliferation, senescence, autophagy, and angiogenesis.¹¹^,¹² Unfortunately, clinical trials using broad-range protease inhibitors have failed to improve cancer patient outcome¹³^,¹⁴ and multiple anti-tumor proteases have also been identified.¹⁵^,¹⁶^,¹⁷ These studies highlight the multifaceted nature of tumor-associated proteases and the necessity of targeting context-dependent proteases. In GBM, the expression of several arginine-specific proteases, such as mucosa-associated lymphoid tissue 1 (MALT1), matrix metalloproteinase 2 (MMP2), and MMP9, is higher than that in low-grade glioma and normal brain.¹²^,¹⁸ Genetic and pharmacologic inhibition of these proteases suppresses tumor growth in GBM mouse models.¹²^,¹⁸ Similarly, knockdown cysteine protease inhibitor serpin family B member 3 (SerpinB3) and zinc-dependent proteinase ADAM-like decysin-1 (ADAMDEC1) disrupts the maintenance of glioma stem cells (GSCs) and inhibits GBM growth.¹⁹^,²⁰ These findings support a critical role of proteases in regulating GBM biology. However, their interrelationships and relevance to GBM immunosuppressive TME are poorly understood. Therefore, we conducted a screen of proteases that may regulate the biology of immunosuppressive TME in GBM. In this screen, legumain (LGMN) emerged as the top hit that might contribute to TAM immunosuppression.

LGMN cleaves peptide bonds on the C-terminal side of asparagine residues and participants in various cellular processes, such as osteoclast formation, antigen processing, kidney function, and brain development.²¹^,²² Since LGMN could cleave amyloid precursor protein and tau, it has been considered as a therapeutic target for Alzheimer’s disease.²³^,²⁴ LGMN is widely distributed in different types of cancers, such as breast cancer, colon cancer, lung cancer, gastric cancer, lymphoma, melanoma, and brain cancer, and its expression in tumors correlates with worse prognosis.²⁵^,²⁶^,²⁷^,²⁸^,²⁹^,³⁰ Here, we identify TAMs as the key source of LGMN, reveal the role of LGMN in connecting two GBM hallmarks of hypoxia and immunosuppression, and uncover LGMN as a potential therapeutic target for improving anti-PD1 therapy efficiency in GBM.

Results

LGMN is highly expressed in TAMs in GBM

To explore the potential role of proteases in regulating GBM TME, we first screened the expression pattern of 202 protease-encoding genes in GBM cells and tumor-associated immune cells (e.g., macrophages, microglia, neutrophils, CD4⁺ T cells, and CD8⁺ T cells) isolated from human GBM tumors.³¹ As a result, we identified six protease genes (e.g., LGMN, CTSD, HM13, ST14, USP53, and ADAM17) that were highly expressed in macrophages and microglia compared with CD45⁻ GBM cells and other immune cells (Figure 1A). Next, we analyzed RNA-seq data of GBM-associated bone marrow-derived macrophages (BMDMs) and microglia isolated from tumors of GL261 and RCAS (a genetically engineered mouse model with Pdgfb induction and Trp53 knockdown) models³² and found that LGMN and CTSD were enhanced in GBM-associated BMDMs compared with blood-derived monocytes (Figure 1B). However, this enhancement was not present in GBM-associated microglia compared with normal brain microglia (Figure S1A). Further analysis on microarray data³³ from TAMs and blood-derived monocytes isolated from GBM patients demonstrated that LGMN, but not other proteases, was enhanced in TAMs with respect to monocytes (Figure 1C). Single-cell RNA-seq analysis on GBM patient tumors³⁴ confirmed that LGMN was preferentially expressed in CD68⁺ macrophages (Figures 1D and 1E). To solidify the TAM-LGMN connection, the expression pattern of myeloid cell markers and LGMN was analyzed in mouse and human GBM tumor samples. Flow cytometry demonstrated that CD11b⁺CD45^hiCD68⁺ macrophages isolated from CT2A and QPP7 tumors showed higher LGMN expression than that in primary mouse BMDMs (Figures 1F, 1G, S1B, and S1C). Within the tumor-associated myeloid cells, CD11b⁺CD45^hiCD68⁺ macrophages exhibited higher LGMN expression compared with CD11b⁺CD45^lowCX3CR1⁺ microglia and CD11b⁺CD45^hiCD11c⁺ DCs. Specifically, CD11b⁺CD45^hiCD68⁺CD206⁺ immunosuppressive macrophages showed the highest LGMN expression among myeloid cell populations in CT2A and QPP7 tumors (Figures 1H, 1I, S1D, and S1E). In addition, immunofluorescence staining demonstrated that LGMN was mainly expressed in CD206⁺ TAMs of various GBM experimental models (e.g., CT2A, 005 GSC, GL261, and QPP7) and GBM patients (Figures 1J–1L, S1F, and S1G). Together, these findings highlight that protease LGMN is preferentially expressed in immunosuppressive TAMs of mouse and human GBMs, prompting exploration of a potential role of LGMN in macrophage and GBM immune biology.

LGMN is highly expressed in immunosuppressive TAMs in GBM

(A) The expression of protease-encoding genes in CD45⁻ tumor cells and tumor-associated immune cells, including microglia, macrophage, neutrophil, CD4⁺ T cells, and CD8⁺ T cells. Yellow signal indicates higher expression, and blue signal denotes lower expression.

(B) Heatmap representation of six protease genes in normal monocytes, GL261 tumor-associated bone marrow-derived macrophages (BMDMs), and RCAS tumor-associated BMDMs. Yellow and black signals indicate higher and lower gene expression, respectively.

(C) Heatmap representation of six proteases genes in blood-derived monocytes and tumor-associated macrophages (TAMs) from GBM patients. Yellow signal indicates higher expression and blue signal denotes lower expression.

(D) High-resolution uniform manifold approximation and projection (UMAP) dimensional reduction of cells from GBM patient tumors. Macrophages were highlighted based on the expression pattern of macrophage marker CD68.

(E) Pattern representing single-cell gene expression of *LGMN*.

(F and G) Representative (F) and quantification (G) of flow cytometry analysis for LGMN expression in CD11b⁺CD45^hiCD68⁺ macrophages isolated from bone marrow (BMDM) and CT2A tumor (TAM). n = 3 biological replicates.

(H and I) Representative (H) and quantification (I) of flow cytometry analysis for LGMN expression in CD11b⁺CD45^hiCD68⁺ macrophages (total Mφ), CD11b⁺CD45^hiCD68⁺CD206⁺ macrophages (CD206⁺ Mφ), CD11b⁺CD45^hiCD68⁺CD206⁻ macrophages (CD206⁻ Mφ), CD11b⁺CD45^loCX3CR1⁺ microglia (total MG), CD11b⁺CD45^loCX3CR1⁺CD206⁺ microglia (CD206⁺ MG), CD11b⁺CD45^loCX3CR1⁺CD206⁻ microglia (CD206⁻ MG), and CD11b⁺CD45^hiCD11c⁺ dendritic cells (DC) isolated from CT2A tumors. n = 3 biological replicates.

(J–L) Co-immunofluorescence staining for LGMN (red) and CD206 (green) in GBM tumors from CT2A (J) and 005 GSC (K) models implanted in C57BL/6 mice, and from GBM patients (L). Scale bar, 50 μm. Data from multiple replicates are presented as mean ± SEM. ∗∗p < 0.01, ∗∗∗p < 0.001, Student’s t test (G), one-way ANOVA test (I).

HIF1α upregulates LGMN expression in macrophages

Given that hypoxia is a key GBM hallmark exhibiting a critical role in regulating macrophage biology³⁵ and LGMN is a potential downstream signal of HIF1α in GSCs,³⁶ we hypothesized that hypoxia may upregulate LGMN expression in macrophages. Correlation analysis on GBM patient tumors from The Cancer Genome Atlas (TCGA) dataset demonstrated that LGMN expression was correlated positively with hallmark hypoxia signature (Figure S2A). Compared with the normoxic condition, 2% oxygen or CoCl₂-stimulated hypoxia significantly increased Lgmn expression in Raw264.7 macrophages and primary mouse BMDMs (Figures 2A and 2B). Since HIF1α is a master hypoxia-regulated transcriptional factor, we further investigated whether LGMN is regulated by HIF1α in macrophages. Bioinformatics analyses demonstrated that LGMN was correlated positively with HIF1A in the TCGA GBM dataset (Figure S2B). Analysis of the JASPAR database showed that putative HIF1A-binding elements were aligned with LGMN promoter and were evolutionarily conserved across different species, including human and mouse (Figures S2C and S2D). Chromatin immunoprecipitation (ChIP)-PCR on THP1 macrophages and BMDMs demonstrated that HIF1A bound to the LGMN promoter and that the binding was abolished by HIF1α depletion (Figures 2C and 2D). To further validate the relationship between HIF1α and LGMN in macrophages, HIF1α macrophage-specific knockout (HIF1α-mKO) mice were generated by crossing HIF1α^flox mice with Lysozyme-Cre (LyzCre) mice. Compared with BMDMs isolated from wild-type (WT) mice, BMDMs from HIF1α-mKO mice exhibited lower Lgmn expression (Figure 2E). Similarly, short hairpin RNA (shRNA)-mediated depletion of HIF1α or treatment with HIF1α inhibitor acriflavine (ACF) dramatically reduced Lgmn mRNA level in Raw264.7 macrophages (Figures 2F and 2G). Similarly, genetic and pharmacologic inhibition of HIF1α reduced LGMN protein levels in BMDMs and Raw264.7 macrophages (Figures 2H–2J). In summary, these data highlight HIF1α as the upstream signaling of LGMN that directly regulates LGMN expression in macrophages.

HIF1α promotes LGMN expression in macrophages

(A) RT-qPCR shows the expression of *Lgmn* in Raw264.7 macrophages cultured in normoxia condition or hypoxic conditions with 2% oxygen (O₂) or hypoxia-mimetic agent CoCl₂ (100 μM) treatment. n = 6 biological replicates.

(B) RT-qPCR shows the expression of *Lgmn* in mouse primary bone marrow-derived macrophages (BMDMs) cultured in control or hypoxic condition with 2% O₂. n = 6 biological replicates.

(C) Quantification of HIF1A ChIP-PCR in the *LGMN* promoter of THP1 macrophages. Immunoglobulin (Ig)G was used as the control. n = 6 biological replicates.

(D) Quantification of *Hif1a* ChIP-PCR in the *Lgmn* promoter of BMDMs isolated from wild-type (WT) and HIF1α macrophage-specific knockout (HIF1α-mKO) mice. IgG was used as the control. n = 6 biological replicates.

(E) Relative mRNA expression of *Lgmn* in BMDMs isolated from WT and HIF1α-mKO mice. n = 6 biological replicates.

(F) RT-qPCR shows the expression of *Lgmn* in shRNA control (shC) and *Hif1a* shRNAs (shHif1a)-transfected Raw264.7 macrophages. n = 6 biological replicates.

(G) RT-qPCR for *Lgmn* in lysates of Raw264.7 macrophages treated with HIF1α inhibitor acriflavine (ACF) at indicated concentrations. n = 6 biological replicates.

(H–J) Immunoblots for LGMN in lysates of Raw264.7 macrophages expressing shC and shHif1a (H), WT and HIF1α-mKO BMDMs (I), and Raw264.7 macrophages treated with ACF at indicated concentrations (J). Data from multiple replicates are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, Student’s t test (B and E), one-way ANOVA test (A, C, D, F, and G).

LGMN is essential for macrophage immunosuppressive polarization in GBM

TAMs are usually polarized toward an immunosuppressive phenotype in GBM.⁷^,⁸ Bioinformatics analyses revealed that the immunosuppressive macrophage signature was positively correlated with LGMN and enriched in LGMN-high TCGA GBM patient tumors (Figures 3A and 3B), suggesting a potential role of LGMN in macrophage immunosuppressive polarization. We next examined the expression of immunosuppressive markers (e.g., ARG1, VEGFA, and CD206) in macrophages treated with or without LGMN recombinant protein or LGMN inhibitors RR-11a and C11. RT-qPCR demonstrated that LGMN recombinant protein treatment upregulated ARG1 and VEGFA expression in U937 macrophages, Raw264.7 macrophages, and mouse primary BMDMs (Figures 3C–3E, S3A, and S3B), whereas LGMN inhibitor RR-11a showed an opposite effect (Figures 3F, 3G, S3C, and S3D). Flow cytometry analyses in mouse primary BMDMs showed that the percentage of CD206⁺ and ARG1⁺ cells was enhanced by LGMN recombinant protein but reduced by LGMN inhibitor RR-11a or C11 (Figures 3H–3K). Similarly, shRNA-mediated depletion of LGMN decreased the percentage of CD206⁺ and ARG1⁺ cells in Raw264.7 macrophages (Figures 3L–3O and S3E). To confirm these findings in vivo, we treated CT2A and 005 GSC tumor-bearing mice with C11, which has a desirable ability to cross the blood-brain barrier (BBB)²³ and analyzed the change of macrophage population in tumor tissues using flow cytometry (Figure S3F). As expected, C11 treatment in tumor-bearing mice reduced CD45^hiCD11b⁺CD68⁺CD206⁺ immunosuppressive macrophages (Figures 3P, 3Q, S3G, and S3H) and CD45^loCD11b⁺CX3CR1⁺CD206⁺ immunosuppressive microglia (Figures S3I–S3L) in CT2A and 005 GSC models. Moreover, immunofluorescence staining demonstrated that Mac-2⁺CD206⁺ and Mac-2⁺ARG1⁺ immunosuppressive TAMs were significantly reduced in C11-treated tumors (Figures 3R–3U). Together, these findings demonstrate that LGMN promotes macrophage immunosuppressive polarization in GBM.

LGMN promotes macrophage immunosuppressive polarization

(A) Correlation of *LGMN* and immunosuppressive macrophage signature in TCGA GBM patients. R and p values are shown.

(B) GSEA shows the enrichment of immunosuppressive macrophage signature in *LGMN*-high patient tumors compared with *LGMN*-low patient tumors. The normalized enrichment score (NES) and false discovery rate (FDR) q value of correlation are shown.

(C–E) RT-qPCR shows the expression of *ARG1* in U937 macrophages (C), Raw264.7 macrophages (D), and mouse primary BMDMs (E) treated with or without LGMN recombinant protein (20 ng/mL). n = 6–8 biological replicates.

(F and G) RT-qPCR shows the expression of *ARG1* in control and RR-11a-treated U937 (F) and Raw264.7 macrophages (G). n = 3–7 biological replicates.

(H and I) Representative images (H) and quantification (I) of flow cytometry for the percentage of ARG1⁺ cells in mouse primary BMDMs treated with or without LGMN recombinant (20 ng/mL) protein or LGMN inhibitors RR-11a (20 nmol/L) and C11 (1 μmol/L). n = 6–9 biological replicates.

(J and K) Representative images (J) and quantification (K) of flow cytometry for the percentage of CD206⁺ cells in mouse primary BMDMs treated with or without LGMN recombinant (20 ng/mL) protein or LGMN inhibitors RR-11a (20 nmol/L) and C11 (1 μmol/L). n = 6–9 biological replicates.

(L and M) Representative images (L) and quantification (M) of flow cytometry for the percentage of ARG1⁺ Raw264.7 macrophages expressing shRNA control (shC) and *Lgmn* shRNAs (shLgmn). n = 3–6 biological replicates.

(N and O) Representative images (N) and quantification (O) of flow cytometry for the percentage of CD206⁺ Raw264.7 macrophages expressing shC and shLgmn. n = 3–6 biological replicates.

(P and Q) Representative images (P) and quantification (Q) of flow cytometry for the percentage of intratumoral CD45^hiCD11b⁺CD68⁺CD206⁺ macrophages in size-matched tumors from the 005 GSC model treated with or without C11 (10 mg/kg, intraperitoneally [i.p.], daily). n = 3 biological replicates.

(R and S) Co-immunofluorescence (R) and quantification (S) of relative CD206⁺Mac2⁺ cells in tumors from the 005 GSC model treated with or without C11 (10 mg/kg, i.p., daily). Scale bar, 25 μm. n = 3 biological replicates.

(T and U) Co-immunofluorescence (T) and quantification (U) of relative Arg1⁺Mac2⁺ cells in tumors from the 005 GSC model treated with or without C11 (10 mg/kg, i.p., daily). Scale bar, 25 μm. n = 3 biological replicates. Data from multiple replicates are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, one-way ANOVA test (I, K, M, and O) and Student’s t test (C–G, Q, S, and U).

LGMN regulates macrophage immunosuppressive polarization by activating the GSK-3β-STAT3 pathway

To identify the potential downstream pathways that can mediate LGMN-induced macrophage immunosuppressive polarization, we performed an unbiased study using the Phospho-Kinase Array on THP1 macrophages treated with or without LGMN recombinant protein. We observed a potential increase of P-GSK-3β, P-STAT6, and P-STAT3 in THP1 macrophages upon LGMN treatment (Figure 4A). Western blotting validations demonstrated that LGMN recombinant protein treatment upregulated P-GSK-3β and P-STAT3 in THP1 macrophages, mouse primary BMDMs, and U937 macrophages (Figures 4B, 4C, and S4A). In contrast, inhibition of LGMN using RR-11a and C11 showed an opposite effect in THP1 macrophages and BMDMs (Figures 4D, 4E, S4B, and S4C). However, P-STAT6 was not affected by the treatment with LGMN recombinant protein or LGMN inhibitors RR-11a and C11 in THP1 macrophages, U937 macrophages, and BMDMs (Figures S4D–S4H). Consistent with previous studies showing that GSK-3β can modulate macrophage activity by affecting STAT3,³⁷ we found that LGMN-induced STAT3 activation was impaired by inhibition of GSK-3β in macrophages (Figure S4I). However, inhibition of STAT3 did not affect LGMN-induced GSK-3β activation in macrophages (Figure S4J). To investigate whether LGMN-induced macrophage immunosuppressive polarization is regulated by the GSK-3β-STAT3 pathway, we performed flow cytometry analyses on macrophages treated with LGMN in the presence or absence of GSK-3β inhibitor (AR-A014418) or STAT3 inhibitor (WP1066). The results showed that inhibition of GSK-3β or STAT3 significantly impaired LGMN-induced upregulation of ARG1 (Figures 4F–4I) and CD206 (Figures 4J–4M) in Raw264.7 and THP1 macrophages. Together, these findings support a critical role of the GSK-3β-STAT3 signaling pathway in mediating LGMN-directed macrophage immunosuppressive polarization.

LGMN promotes macrophage migration and immunosuppressive polarization via activating GSK-3β and STAT3 signaling

(A) Representative images of human phospho-kinase antibody array in THP1 macrophages treated with or without LGMN recombinant protein (20 ng/mL). Dots representing P-GSK-3β, P-STAT6, and P-STAT3 in control and LGMN-treated groups are indicated.

(B and C) Immunoblots for GSK-3β, P-GSK-3β, STAT3, and P-STAT3 in cell lysates from THP1 macrophages (B) and mouse primary BMDMs (C) treated with or without LGMN recombinant protein (20 ng/mL).

(D and E) Immunoblots for GSK-3β, P-GSK-3β, STAT3, and P-STAT3 in THP1 macrophages (D) and mouse primary BMDMs (E) treated with or without LGMN inhibitor C11 at indicated concentrations.

(F and G) Representative images (F) and quantification (G) of flow cytometry for the percentage of Arg1⁺ cells in Raw264.7 macrophages after stimulation with LGMN recombinant protein (20 ng/mL) in the presence or absence of WP1066 (20 nmol/L) or AR-A014418 (100 nmol/L). n = 3 biological replicates.

(H and I) Representative images (H) and quantification (I) of flow cytometry for the percentage of Arg1⁺ cells in THP1 macrophages after stimulation with LGMN recombinant protein (20 ng/mL) in the presence or absence of WP1066 (20 nmol/L) or AR-A014418 (100 nmol/L). n = 3 biological replicates.

(J and K) Representative images (J) and quantification (K) of flow cytometry for the percentage of CD206⁺ cells in Raw264.7 macrophages after stimulation with LGMN recombinant protein (20 ng/mL) in the presence or absence of WP1066 (20 nmol/L) or AR-A014418 (100 nmol/L). n = 3 biological replicates.

(L and M) Representative images (L) and quantification (M) of flow cytometry for the percentage of CD206⁺ cells in THP1 macrophages after stimulation with LGMN recombinant protein (20 ng/mL) in the presence or absence of WP1066 (20 nmol/L) or AR-A014418 (100 nmol/L). n = 3 biological replicates. Data from multiple replicates are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, one-way ANOVA test.

Inhibition of the HIF1α-LGMN axis in macrophages impairs GBM progression

To further confirm that LGMN is regulated by HIF1α during macrophage immunosuppressive polarization, we performed experiments in HIF1α-mKO BMDMs treated with or without LGMN recombinant protein. The results showed that genetic depletion of HIF1α reduced CD206⁺ and Arg1⁺ immunosuppressive macrophages, an effect that was rescued by addition of LGMN recombinant protein (Figures 5A–5C, S5A, and S5B). Given the critical pro-tumor effect of immunosuppressive TAMs, we further investigated the impact of macrophage HIF1α and LGMN on GBM growth. First, we established GBM orthotopic mouse models by intracranial injection of CT2A and GL261 cells into WT and HIF1α-mKO mice. A significant survival extension was observed in HIF1α-mKO mice compared with WT mice in both models (Figures 5D and 5E). Flow cytometry analysis and immunofluorescence staining showed that CD45^hiCD11b⁺CD68⁺CD206⁺ immunosuppressive macrophages (Figures 5F and 5G) and LGMN expression in CD206⁺ macrophages (Figures 5H, 5I, S5C, and S5D) were dramatically reduced in tumors from HIF1α-mKO mice compared with WT mice. Moreover, the impaired tumor growth in HIF1α-mKO mice was partially prevented by administration of LGMN recombinant protein in the CT2A model (Figure 5J). Next, we investigated the role of macrophage LGMN in GBM tumor growth via co-implantation of CT2A and immunosuppressive macrophages harboring shC or shLgmn. The results showed that depletion of LGMN in immunosuppressive macrophages significantly extended mouse survival (Figure 5K). Furthermore, we performed bone marrow transplantation experiments via transferring shC and shLgmn bone marrow cells (Figure S5E) into irradiated WT mice to obtain control and Lgmn myeloid cell-specific knockdown (Lgmn-mKD) mice. As expected, Lgmn-mKD mice showed significant survival extension compared with control mice (Figure 5L). Finally, we investigated the anti-tumor effect of pharmacologic inhibition of LGMN in the GBM mouse model with results showing that C11 treatment extended the survival of CT2A-bearing mice (Figure 5M). To confirm that TAM is the critical target of C11 in vivo, we compared the anti-tumor effect of C11 and BLZ945 (a CSF-1R inhibitor) in CT2A-bearing mice. Each agent equally inhibited tumor growth and their combined use did not show additional survival benefit (Figure 5M). To further exclude the direct effect of C11 on GBM cells, we performed several lines of in vitro studies and found that C11 did not alter GBM cell proliferation (Figures S5F and S5G), stemness (Figures S5H–S5J), and survival (Figures S5K–S5N). Together, these findings highlight the importance of the TAM-specific HIF1α-LGMN axis in promoting GBM progression.

Targeting HIF1α-LGMN axis improves the efficacy of anti-PD1 therapy in GBM

Since TAM immunosuppressive polarization is regulated by the HIF1α-LGMN axis, we hypothesized that inhibition of this axis in macrophages can restore T cell-mediated anti-tumor immunity in GBM. RT-qPCR and western blotting experiments demonstrated that LGMN recombinant protein treatment upregulated PD-L1 expression, and LGMN inhibitors RR-11a and C11 showed an opposite effect in Raw264.7 macrophages, THP1 macrophages, and mouse primary BMDMs (Figures 6A–6E and S6A), suggesting a potential benefit of combining LGMN inhibitors and anti-PD1 therapy for GBM. Flow cytometry of spleens from CT2A and 005 GSC tumor-bearing mice demonstrated that C11 treatment significantly increased CD3⁺ (CD45⁺CD3⁺) and CD8⁺ (CD45⁺CD3⁺CD8⁺CD4⁻) T cell populations (Figures 6F–6I and S6B–S6E). CD4⁺ (CD45⁺CD3⁺CD4⁺CD8⁻) T cells were also upregulated in the spleen of the CT2A model (Figure 6J), but not in the 005 GSC model (Figure S6F). Furthermore, activated CD8⁺ T cells (CD45⁺CD3⁺CD8⁺CD4⁻CD69⁺), but not activated CD4⁺ T cells (CD45⁺CD3⁺CD4⁺CD8⁻CD69⁺), were increased in the spleen of CT2A and 005 GSC tumor-bearing mice upon C11 treatment (Figures 6K and S6G–S6M). The enhanced frequency of CD8⁺ and activated CD8⁺ T cells was confirmed by immunofluorescence staining in C11-treated 005 GSC tumors (Figures 6L and 6M). Similarly, the spleen and tumor from HIF1α-mKO mice showed an increase of CD3⁺, CD8⁺, CD4⁺, and activated CD8⁺ T cells (Figures 6N–6S and S6N–S6P). However, activated CD4⁺ T cells were not affected in HIF1α-mKO mice compared with WT mice (Figures S6Q and S6R). These findings prompted us to hypothesize that inhibition of the HIF1α-LGMN axis can enhance the effectiveness of anti-PD1 therapy in GBM mouse models. The results showed that C11, but not anti-PD1, extended the survival of CT2A and 005 GSC tumor-bearing mice. Notably, the anti-tumor effect was augmented when these two treatment strategies were combined (Figures 6T and 6U). Moreover, depletion of macrophage HIF1α in HIF1α-mKO mice synergized with anti-PD1 therapy to suppress tumor progression in the CT2A model (Figure 6V). In summary, we conclude that inhibition of the HIF1α-LGMN axis in macrophages holds a potential to restore CD8⁺ T cell activity and synergize with anti-PD1 therapy in GBM mouse models.

Inhibition of the HIF1α-LGMN axis in macrophages activates anti-tumor immune response and synergizes with anti–PD-1 therapy

(A and B) RT-qPCR shows the expression of *PD-L1* in Raw264.7 macrophages treated with or without LGMN recombinant protein (20 ng/mL, A) or LGMN inhibitor RR-11a (20 nmol/L, B). n = 3–4 biological replicates.

(C) Immunoblots for PD-L1 in THP1 macrophages treated with or without LGMN recombinant protein (20 ng/mL).

(D and E) Immunoblots for PD-L1 in mouse primary BMDMs treated with or without RR-11a (D) and C11 (E) at indicated concentrations.

(F and G) Representative images (F) and quantification (G) of flow cytometry for the percentage of splenic CD45⁺CD3⁺ T cells in CT2A tumor-bearing mice treated with or without LGMN inhibitor C11 (10 mg/kg, i.p., daily). n = 3 biological replicates.

(H–K) Representative images (H) and quantification of flow cytometry for the percentage of splenic CD45⁺CD3⁺CD8⁺ T cells (I), CD45⁺CD3⁺CD4⁺ T cells (J), and CD45⁺CD3⁺CD8⁺CD4⁻CD69⁺ T cells (K) in CT2A tumor-bearing mice treated with or without C11 (10 mg/kg, i.p., daily). n = 3 biological replicates.

(L and M) Co-immunofluorescence (L) and quantification (M) of relative CD8⁺CD69⁺ cells in tumors from the 005 GSC model treated with or without C11 (10 mg/kg, i.p., daily). Scale bar, 25 μm. n = 3 biological replicates.

(N–Q) Quantification of flow cytometry for the percentage of splenic CD45⁺CD3⁺ T cells (N), CD45⁺CD3⁺CD8⁺ T cells (O), CD45⁺CD3⁺CD4⁺ T cells (P) and CD45⁺CD3⁺CD8⁺CD4⁻CD69⁺ T cells (Q) in WT and HIF1α-mKO mice implanted with CT2A cells. n = 3 biological replicates.

(R and S) Co-immunofluorescence (R) and quantification (S) of relative CD8⁺CD69⁺ cells in tumors from WT and HIF1α-mKO mice implanted with CT2A cells. Scale bar, 50 μm. n = 3 biological replicates.

(T and U) Survival curves of C57BL/6 mice implanted with CT2A cells (T) or 005 GSCs (U). Mice were treated with C11 (10 mg/kg, i.p., daily) on day 7, and then received the treatment with anti-PD1 (10 mg/kg, i.p.) on days 11, 14, and 17.

(V) Survival curves of WT and HIF1α-mKO mice implanted with CT2A cells. Mice were treated with anti-PD1 (10 mg/kg, i.p.) on days 11, 14, and 17. Data from multiple replicates are presented as mean ± SEM. n.s., not significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, Student’s t test (A, B, G, I–K, M–Q, and S), and log-rank test (T–V). Splenic CD45⁺CD3⁺CD4⁺CD69⁺ T cells in WT and HIF1α-mKO mice implanted with CT2A cells. n = 3 biological replicates. Data from multiple replicates are presented as mean ± SEM. n.s., not significant, ∗p < 0.05, ∗∗p < 0.01, Student’s t test.

Discussion

In this study, we identified LGMN as a key protease that is highly expressed in TAMs and transcriptionally upregulated by HIF1α under the hypoxic TME, a hallmark of GBM.³⁸ We revealed that the increased LGMN is essential for TAM immunosuppressive polarization and demonstrated that inhibition of the HIF1α-LGMN axis impairs tumor growth, reduces immunosuppressive TAMs, enhances CD8⁺ T cell infiltration and activation, and improves the anti-tumor response of anti-PD1 therapy in GBM mouse models. The critical role of the HIF1α-LGMN axis in regulating immunosuppression illuminates potential therapeutic targets to improve the effectiveness of immunotherapy in GBM.

It is well known that proteases play an important role in cancer progression and are associated with all stages of cancer development.¹¹^,³⁹^,⁴⁰^,⁴¹ Depending on their cellular localization, tumor-associated proteases are divided into extracellular and intracellular subgroups.¹¹ Early studies have mainly focused on extracellular proteases, of which most members (e.g., MMPs) have been identified as pro-tumor enzymes⁴²^,⁴³ involved in degrading ECM and promoting tumor invasion.¹¹ On the contrary, intracellular proteases (e.g., caspases) are essential for activating apoptosis in cancer cells,⁴⁴ thus exhibiting anti-tumor properties. However, it should be noted that there are exceptions to this pattern. For example, neutrophil- and macrophage-derived extracellular proteases MMP8 and MMP12 exhibit anti-tumor effect in breast and lung cancer,¹¹^,⁴⁵^,⁴⁶ and intracellular protease cathepsin E shows a pro-tumor effect in pancreatic cancer.⁴⁷ These studies highlight the functional diversity of proteases in regulating cancer progression. LGMN is a cysteine protease primarily expressed in the lysosome, but also can be secreted into the TME.⁴⁸ Tumor-derived LGMN participates in cancer cell migration, survival, and propagation through regulating MMP2/9 and PI3K/AKT signaling and interacting with integrin RGD motifs.²⁶^,⁴⁸^,⁴⁹ These findings suggest a cell-autonomous mechanism of LGMN on cancer cells. On the other hand, increasing evidence suggests a critical role of LGMN in mediating the tumor-TME crosstalk. For example, macrophage-derived LGMN can promote breast tumor growth⁵⁰ and GSC-derived LGMN could affect microglia biology in GBM.³⁶ In the current study, we identified that TAMs are the dominant source of LGMN in the GBM, where LGMN shows an autocrine effect to promote macrophage immunosuppressive polarization. Together, our work reinforces a TME-educated expression pattern of LGMN and its immunosuppressive function in macrophages, the most prominent cell population in GBM,⁷^,⁸ and highlights LGMN as a promising therapeutic target for this deadly disease.

Our work shows that LGMN upregulation in macrophages is triggered by the hypoxic GBM TME. Consistent with previous studies showing that hypoxia and LGMN play a critical role in promoting TAM immunosuppressive polarization in GBM³⁵^,⁵¹ and breast cancer and melanoma,⁵⁰ respectively, our study further reveals LGMN as the key molecule connecting hypoxia and macrophage immunosuppression in GBM. Given that macrophages are the predominant immune cells in the hypoxic TME by outnumbering microglia in GBM,⁵ hypoxia-triggered LGMN in macrophages may be an actionable target. Our previous study proposed to inhibit microglia infiltration by blocking CLOCK-regulated LGMN in GBM patients with CLOCK amplification, which only occurred in approximately 5% of GBM cases.³⁶^,⁵² However, findings of the current study gain added significance, as hypoxia is one of the most significant GBM hallmarks and an early GBM tumor recurrence sign.⁵³^,⁵⁴^,⁵⁵ Therefore, targeting the macrophage-specific HIF1α-LGMN axis may expand the clinical benefit of this therapeutic strategy with a broader patient population.

Our work showing that LGMN is essential for macrophage immunosuppressive polarization aligns with previous studies observed in breast cancer and melanoma.⁵⁰ LGMN has been shown to regulate several downstream signaling pathways in distinct model systems, such as activating integrin αvβ3 to inhibit vascular smooth muscle cell differentiation,⁵⁶ activating TGF-β1 to induce pancreatic fibrosis,⁵⁷ and inhibiting JAK1/STAT1 to activate TAMs.⁵⁰ In the current study, an unbiased phospho-kinase array study followed by functional validations identified GSK-3β and STAT3 as the downstream pathways of LGMN that are responsible for LGMN-induced macrophage immunosuppressive polarization. The role of STAT3 is consistent with previous studies showing that STAT3 is crucial for macrophage immunosuppressive polarization across cancer types, including GBM.⁵⁸^,⁵⁹ It is worth pointing out that GSK-3β can modulate macrophage polarization by affecting the STAT family members, including STAT3,³⁷ which is consistent with our findings. Together, our study reveals that the GSK-3β-STAT3 pathway is responsible for LGMN-induced macrophage immunosuppressive polarization in GBM.

Recent advances in cancer immunotherapies, such as the treatment with anti-PD1, have transformed the management of many solid tumors.⁶⁰^,⁶¹ However, these immunotherapy approaches have not demonstrated a desired clinical benefit for GBM patients,⁶²^,⁶³ largely because GBM tumors are robustly infiltrated with immunosuppressive TAMs.⁶^,⁶² The identification of HIF1α-LGMN axis as a driver for macrophage immunosuppressive polarization, coupled with increased anti-tumor immunity observed in GBM mouse models harboring HIF1α-LGMN axis inhibition, provides guidance for clinical assessment of blocking TAM immunosuppressive polarization as a strategy for improving immunotherapy efficiency in vivo. In exploring the link between LGMN and immune checkpoint molecules in macrophages, we observed that PD-L1 is upregulated by LGMN recombinant protein but downregulated by LGMN inhibitors, consistent with our previous work in microglia.³⁶ Together, these findings highlight macrophages as the key TME component in blunting anti-PD1 responses in GBM, which is reinforced by the current research and other studies showing that blocking macrophage immunosuppressive polarization can synergize with anti-PD1 therapy in GBM.⁶^,⁸^,¹⁰ Given the critical connection between intratumoral CD8⁺ T cells and macrophages, and its role in regulating anti-PD1 clinical responses,⁶⁴ it is fascinating to highlight our findings that LGMN inhibition enhances the infiltration and activation of CD8⁺ T cells, but not CD4⁺ T cells, in GBM-bearing mice. Together, our study supports that targeting macrophage HIF1α-LGMN axis is a promising path to improve immunotherapy efficiency for GBM patients.

Limitations of the study

Although we report the critical role of LGMN in mediating macrophage immunosuppressive polarization via activating the GSK-3β-STAT3 pathway, the detailed mechanism for how LGMN activates the GSK-3β-STAT3 signaling pathway in macrophages is still unknown. Moreover, further studies are needed to investigate whether inhibition of the GSK-3β-STAT3 pathway will abolish LGMN-induced macrophage immunosuppressive polarization and tumor growth in vivo. We report that LGMN is regulated by HIF1α in TAMs. However, we do not understand why LGMN is specifically enriched TAMs compared with other types of immune cells. Given the fact that macrophages are highly enriched in the hypoxic niche of GBM tumors,⁵^,³⁸ deep mechanistic studies are needed to validate whether the specific LGMN upregulation in macrophages is because of the connection between TAMs and the hypoxic niche in GBM. Although we found that LGMN inhibitor C11 does not affect tumor cell biology in vitro, it will be very interesting to validate this conclusion in GBM mouse models. We developed tumor cell and macrophage co-implantation and Lgmn-mKD models to reveal the role of macrophage LGMN in GBM progression but were not able to include Lgmn macrophage-specific knockout (Lmgn-mKO) mice for such in vivo studies. Recent exciting findings demonstrate that MDSCs and T cells can regulate GBM tumor growth and anti-tumor immunity in a sex-specific manner.⁶⁵^,⁶⁶ In this study, we validated the role of the HIF1α-LGMN axis in tumor growth and anti-tumor immunity in the female GBM mouse models. Further efforts are needed to determine whether this working mechanism also appears in male GBM models.

STAR★Methods

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

HIF-1α	Cell Signaling	Cat#14179S; RRID:AB_2622225
P-STAT6	Abcam	Cat#ab28829; RRID:AB_778116
STAT6	Cell Signaling	Cat#9362; RRID:AB_2271211
P-STAT3	Cell Signaling	Cat#9145S; RRID:AB_2491009
STAT3	Cell Signaling	Cat#9139; RRID:AB_331757
GSK-3β	Cell Signaling	Cat#12456S; RRID:AB_2636978
P-GSK-3β	Cell Signaling	Cat#5558S; RRID:AB_10013750
β-ACTIN	Cell Signaling	Cat# 3700S; RRID:AB_2242334
LGMN	Cell Signaling	Cat#93627S; RRID:AB_2800205
PD-L1	Cell Signaling	Cat#64988S; RRID:AB_2799672
Anti-mouse IgG, HRP-Linked	Cell Signaling	Cat#7076S; RRID:AB_330924
Anti-rabbit IgG, HRP-linked	Cell Signaling	Cat#7074S; RRID:AB_2099233
Anti-rabbit IgG, Alexa Fluor® 594 Conjugate	Cell Signaling	Cat#8889S; RRID:AB_2716249
Anti-rabbit IgG, Alexa Fluor ® 488 Conjugate	Cell Signaling	Cat#4412S; RRID:AB_1904025
Anti-mouse IgG, Alexa Fluor® 594 Conjugate	Cell Signaling	Cat#8890S; RRID:AB_2714182
Anti-rat IgG, Alexa Fluor ® 647	Thermo Fisher Scientific	Cat#A-21247; RRID:AB_141778
F4/80	Cell Signaling	Cat#70076S; RRID:AB_2799771
CD206	R&D Systems	Cat#AF2535; RRID:AB_2063012

Biological samples

Human patient tumor samples from surgically resected IDH-WT GBMs	Northwestern Central Nervous System Tissue Bank	N/A

Chemicals, peptides, and recombinant proteins

Phorbol 12-myristate 13-acetate (PMA)	Sigma–Aldrich	Cat#16140071
LGMN recombinant protein	BioVision	Cat#7481-10
Delta-Secretase inhibitor (C11)	Biosynth	Cat#SIB96418
RR-11a analogue	MedChemExpress	Cat#HY-112205A
BLZ945	Selleck Chemicals	S7725
anti–PD-1	Bio X Cell	Cat#BE0146

Critical commercial assays

BCA protein assay kit	Thermo Fisher Scientific	Cat#23225
Pierce ™ Magnetic ChIP Kit	Thermo Fisher Scientific	Cat# 26157
Proteome Profiler Human Phospho-Kinase Array Kit	Bio-Techne	Cat# ARY003C
RNeasy Mini Kit	Qiagen	Cat# 74106

Deposited data

ChIP–seq data	Dong et al.⁶⁷	GSE134974
Gene expression microarray data	Chen et al.⁵²	GEO, GSE140409
Single-cell sequencing data	Darmanis et al.³⁴	GEO, GSE84465
TCGA and CGGA expression and survival data	http://gliovis.bioinfo.cnio.es/	N/A

Experimental models: Cell lines

293T	ATCC	Cat#CRL-11268; RRID:CVCL_1926
QPP7	Laboratory of Dr. Jian Hu (MDACC)	N/A
U937	ATCC	Cat#CRL-1593.2; RRID:CVCL_0007
RAW264.7	ATCC	Cat#TIB-71; RRID:CVCL_0493
CT2A	Seyfried et al. (68)	N/A
GL261	NCI-DTP	Cat# Glioma 261, RRID:CVCL_Y003
THP1	ATCC	Cat#TIB-202; RRID:CVCL_0006
GSC005	Laboratory of Dr. Samuel D. Rabkin (Massachusetts General Hospital)	N/A

Experimental models: Organisms/strains

Mouse C57BL/6	Jackson Laboratory	0000664
Mouse HIF1α-flox	Jackson Laboratory	007561
Mouse LyzCre	Jackson Laboratory	004781

Oligonucleotides

Primers for RT-qPCR	This paper	See STAR Methods for details
LGMN primer #1(human)-F (ChIP-qPCR)	This paper	AGTCTCCCCTTACCCCACAG
LGMN primer #1(human)-R (ChIP-qPCR)	This paper	CCCATCTGTGAAATCGTGAAGG
LGMN primer #2(human)-F (ChIP-qPCR)	This paper	CGCGATTCCGTCATGCTACT
LGMN primer #2(human)-R (ChIP-qPCR)	This paper	GTCAACTGCGGCCTGAAAAT
Lgmn primer #1(mouse)-F (ChIP-qPCR)	This paper	ACAGCAGTAAAAAGGAATGGAGT
Lgmn primer #1(mouse)-R (ChIP-qPCR)	This paper	TAGCACTTGGCTTCAATTGGC
Lgmn primer #2(mouse)-F (ChIP-qPCR)	This paper	GGGCAATACTGTAAACAGCAGTAAA
Lgmn primer #2(mouse)-R (ChIP-qPCR)	This paper	GCACTTGGCTTCAATTGGCTT

Recombinant DNA

psPAX2	Addgene	Cat#12260
pMD2.G	Addgene	Cat#12259
pLKO.1	Sigma Aldrich	Cat#SHC001
pLKO.1-mouse-Lgmn shRNA #4	Sigma-Aldrich	TRCN0000029256
pLKO.1-mouse-Lgmn shRNA #5	Sigma-Aldrich	TRCN0000276301
pLKO.1-mouse-Hif1a shRNA #2	Sigma-Aldrich	TRCN0000232221
pLKO.1-mouse-Hif1a shRNA #3	Sigma-Aldrich	TRCN0000232222

Software and algorithms

Prism GraphPad 9	Prism	https://www.graphpad.com/scientific-software/prism/
DESeq2 v 1.30.0	Bioconductor	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Image Lab	Bio-Rad	https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z
Integrative Genomics Viewer (IGV)	Broad Institute	http://software.broadinstitute.org/software/igv/
Transcriptome Analysis Console	Affymetrix	https://www.thermofisher.com/us/en/home/life-science/microarray-analysis/microarray-analysis-instruments-software-services/microarray-analysis-software.html
Data Visualization Tools for Brain Tumor Datasets	Bowman et al.⁶⁸	http://gliovis.bioinfo.cnio.es/
GSEA-4.1.0	Broad Institute	http://software.broadinstitute.org/gsea/index.jsp
R package	The R Project for Statistical Computing	https://www.r-project.org/
ImageJ	Fiji Image	https://imagej.net/Fiji

Open in a new tab

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Peiwen Chen (peiwen.chen@northwestern.edu).

Materials availability

This study did not generate new unique reagents.

Experimental model and subject details

Cell culture

THP1, U937, Raw264.7, and GL261 cells were cultured in RPMI 1640 medium (RPMI), containing 10% fetal bovine serum (FBS, Fisher Scientific, #16140071) and 1:100 antibiotic-antimycotic (Gibco, #15140-122). Monocytes were differentiated into macrophages by adding a 200 ng/mL phorbol 12-myristate 13-acetate (PMA, Sigma–Aldrich, #P8139) for 24 h. CT2A cells and 293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco, #11995-065) with 10% FBS and 1:100 antibiotic-antimycotic. 005 GSCs and QPP7 GSCs were cultured in neural stem cell (NSC) proliferation media (Millipore, #SCM005) containing 20 ng/mL epidermal growth factor (EGF; PeproTech, #AF-100-15) and basic fibroblast growth factor (bFGF; PeproTech, #100-18B). QPP7 and 005 GSCs were provided by Dr. Jian Hu (The University of Texas MD Anderson Cancer Center) and Dr. Samuel D. Rabkin (Massachusetts General Hospital), respectively. All cells were confirmed to be mycoplasma-free and were maintained at 37°C and 5% CO₂.

Mice and intracranial xenograft tumor models

Female C57BL/6 (#0000664) mice were purchased from the Jackson Laboratory. HIF1α-mKO mice were provided by the laboratory of Michael A. Curran (The University of Texas MD Anderson Cancer Center), which were generated by crossing HIF1α^flox mice (Jackson Lab, #007561) with LyzCre mice (Jackson Lab, #004781). All animals were grouped by 5 mice per cage and maintained in a pathogen-free IVC System (San Diego, CA) for a week before the experiment. All animal experiments in this study were performed with the approval of the Institutional Animal Care and Use Committee (IACUC) at Northwestern University. The intracranial xenograft tumor models were established as we described previously.⁵²^,⁶⁷ In brief, ketamine (100 mg/kg) and xylazine (20 mg/kg) or isoflurane were used for anesthetizing mice through intraperitoneal injection or IMPAC6 Anesthesia System, respectively. A small hole in the skull with 1.2 mm anterior and 3.0 mm lateral to the bregma was made by a dental drill. Using a 10 μL Hamilton syringe with an unbeveled 30-gauge needle, we slowly injected a total volume of 5 μL GL261 cells, 005 GSCs, QPP7 GSCs, or CT2A cells in FBS-free culture medium into the right caudate nucleus 3 mm below the surface of the brain. A total of three doses of meloxicam (20 mg/kg) were subcutaneously injected for pain relief. Mice were then returned to the cage and monitored for survival. During the treatment, any mice exhibiting neurological deficits or moribund appearance were sacrificed according to the IACUC protocol. At the end of the experiment, we isolated the brains from tumor-bearing mice after transcardiac perfusion with PBS and 4% paraformaldehyde (PFA). The brains were preserved in 4% PFA till processing for paraffin-embedded blocks or cryosectioning.

Human samples

Patient tumor Formalin-Fixed Paraffin-Embedded (FFPE) tissue specimens from surgically-resected IDH-WT GBMs were obtained from the Northwestern Central Nervous System Tissue Bank (NSTB). Patients were diagnosed according to the WHO diagnostic criteria by neuropathologist at NSTB. According to The George Washington University Institutional Review Board and based on the guidelines from the Office of Human Research Protection, the conducted research meets the criteria for exemption #4 (45 CFR 46.101(b) Categories of Exempt Human Subjects Research) and does not constitute human research.

Method details

Isolation of BMDMs

Female C57BL/6 mice were euthanized by CO₂ inhalation followed by cervical dislocation. To avoid contamination, mice were soaked with 70% ethanol. The skin and muscle were removed as much as possible to maintain the purity of bone marrow-derived progenitor cells. We then isolated femur and tibia from each leg by cutting Achilles tendon, fibula, and knee joint. Femur and tibia were soaked with 70% ethanol followed washing with PBS for 5 min on ice. The epiphyses of femur and tibia were carefully removed by ophthalmic scissors. Bone marrow was washed from the opened femur and tibia into a 50 mL tube by slowly injecting approximately 5 mL RPMI with 2% FBS and 1% antibiotic-antimycotic per bone using a 23G needle with 10 mL syringe. After collecting all the bone marrows into the 50 mL tube, cells were filtered through a 100 μm cell strainer and centrifuged at 300 × g, 5 min at 4°C. Bone marrow pellets were resuspended in RPMI (10% FBS and 1% antibiotic-antimycotic) containing 20 ng/mL M-CSF and seeded into 6-well plates for five days. Then, fresh medium was added to the plates for BMDM expansion. The differentiated BMDMs were collected as adherent cells and confirmed by flow cytometry analysis.

Plasmids and viral transfections

shRNAs targeting mouse Lgmn and Hif1a in the pLKO.1 vector (Sigma, #SHC001) were used in this study. Lentiviral particles (8 μg) were generated by transfecting 293T cells with the packaging vectors psPAX2 (4 μg; Addgene, #12260) and pMD2.G (2 μg; Addgene, #12259). Lentiviral particles were collected at 48 h after transfection into 293T cells. Macrophages were infected with viral supernatant containing 10 μg/mL polybrene (Millipore, #TR-1003-G). After 48 h, infected cells were selected using puromycin (2 μg/mL; Millipore, #540411) and assessed for the expression of LGMN and HIF1α by immunoblots. The following shRNA sequence: Lgmn: #4: TRCN0000029256 and #5: TRCN0000276301; Hif1a: #2: TRCN0000232221 and #3: TRCN0000232222 were selected for further use following validation.

Bone marrow chimera generation

Bone marrow cells from wild-type C57BL/6 donor mice were isolated as mentioned above. Bone marrow cells were then transfected with lentivirus harboring shC or shLgmn. Recipient Mice at least 6 weeks of age received 1100 cGy radiation with a Gammacell 40 Exactor irradiator (Theratronics). After 24 h, recipient mice were injected with donor-derived shC or shLgmn bone marrow cells intravenously. To avoid infection during the bone marrow reconstitution, Baytril was added into drinking water.

Proliferation assay

CT2A cells or 005 GSCs were seeded in a 96-well plate (Corning, #3599) for culturing overnight. Cells were then treated with C11 at different concentrations right before reading in the IncuCyte Zoom Live cell analysis system (Sartorius). The cell proliferating rate was calculated by using the following formula: (Cell confluency at indicated time–Cell confluency at 0 h)/Cell confluency at 0 h. The cells were monitored in the IncuCyte system for 48 h.

Apoptosis analysis

Apoptosis of CT2A cells and 005 GSCs were evaluated using Apotracker Green (BioLegend, #427402) as described previously.⁶⁷ Briefly, C11-treated CT2A cells or 005 GSCs were incubated with Apotracker (1:10 dilution, FITC) for labeling apoptosis, followed by Propidium iodide (PI) solution (BioLegend, # 421301) for labeling late apoptotic and necrotic cells. FITC and PI signals were analyzed in BD FACSymphony flow cytometer.

Tumorsphere formation assay

The tumorsphere formation assay was performed as previously described.⁵² Briefly, CT2A cells and 005 GSCs were treated with different concentrations of LGMN inhibitor C11. Cells were seeded into a 96-wells plate at 100 cells/well with NSC media (Millipore, #SCM005). Tumorsphere numbers in each well were imaged and quantified after 2 weeks.

Immunofluorescence

Immunofluorescence analysis was performed using a standard protocol as we previously described.⁶⁷ Briefly, the paraffin sections were baked at 65°C for 2 h prior to staining. Sections were then subjected to xylene and ethanol in gradient concentrations as 100% ethanol for 2 × 5 min, 95% ethanol for 5 min, 80% ethanol for 3 min, 70% ethanol for 5 min, and 50% for 5 min for deparaffinization and rehydration. Slides were washed in water and three times in PBS. For cryosections, slides were kept at room temperature for 30 min and fixed in 10% PFA for 30 min prior to permeabilization. 0.3% (v/v) Triton X-100 in PBS was added for 30 min at room temperature to permeabilize the cell membrane. Antigen retrieval was conducted by boiling sections four times in the sodium citrate buffer (0.01 M, pH = 6) in a microwave. After washing three times in PBS, sections were blocked by 5% goat serum for 30 min. Specimens were incubated with primary antibody for 1 h at room temperature and then overnight at 4°C. Unbound primary antibodies were washed out by three times PBS for 3 min each. Corresponding secondary antibody cocktails were prepared and added to the sections for 1 h. Cell nuclear was counterstained with DAPI/anti-fade mounting medium (Vector Laboratories, #H-1200-10). Immunofluorescence images were captured using Nikon AX/AX R Confocal Microscope System with an apo 60 1.40 Oil 160/0.17 objective in the Center for Advanced Microscopy (CAM) at Northwestern University. The relative intensity of the protein signal was determined by ImageJ.

Quantitative real-time PCR (RT-qPCR)

RNA of cells was isolated using the RNeasy Mini Kit (Qiagen, #74106), as we previously described.³⁶^,⁶⁷ RNA was quantified by the NanoDrop spectrophotometers. All-In-One 5X RT MasterMix (Applied Biological Materials, #G592) was used to reverse-transcribe RNA samples into cDNA in T100 Thermal Cycler (Bio-Rad). RT-qPCR was performed using the SYBR Green PCR Master Mix (Bio-Rad, #1725275) in CFX Connect Real-Time PCR Detection System (Bio-Rad). The expression of each gene was normalized to housekeeping genes ACTB. RT-qPCR primers include:

Actin-F: GGCTGTATTCCCCTCCATCG; Actin-R: CCAGTTGGTAACAATGCCATGT

ACTIN-F: CATGTACGTTGCTATCCAGGC; ACTIN-R: CTCCTTAATGTCACGCACGAT

Arg1-F: TTGGGTGGATGCTCACACTG; Arg1-R: GTACACGATGTCTTTGGCAGA

ARG1-F: TGGACAGACTAGGAATTGGCA; ARG1-R: CCAGTCCGTCAACATCAAAACT

Cd2741-F: GCTCCAAAGGACTTGTACGTG; Cd274-R: TGATCTGAAGGGCAGCATTTC

Lgmn-F: TGGACGATCCCGAGGATGG; Lgmn-R: GTGGATGATCTGGTAGGCGT

Vegfa-F: CTTGTTCAGAGCGGAGAAAGC; Vegfa-R: ACATCTGCAAGTACGTTCGTT

VEGFA-F: AGCGCAGAATCATCACGAAGT, VEGFA-R: AGGGTCTCGATTGGATGGCA

ChIP-PCR

ChIP-PCR was performed using the commercial PierceTM Magnetic CHIP kit (ThermoFisher, #26157) as we described previously.⁶⁷ Briefly, macrophages were cross-linked with 1% PFA for 10 min. Glycine solution was used to quench the reaction. Cells were then lysed with ChIP lysis buffer for 30 min on ice. Cell lysate was sonicated to generate chromatin fragmentation. IgG or antibody was incubated with solubilized chromatin and Dynabeads (Life Technologies) overnight at 4°C. Immune complexes were then washed with RIPA buffer three times, once with RIPA-500, and once with LiCl wash buffer. Direct elution buffer containing proteinase K (20 mg/mL) was added to the sample for elution and reverse-crosslinking at 65°C overnight. Eluted DNA was purified using AMPure beads (Beckman-Coulter) and then used to perform qPCR. The LGMN primers were designed according to the E-box of human or mouse LGMN gene.

LGMN #1_F: AGTCTCCCCTTACCCCACAG; LGMN #1_R: CCCATCTGTGAAATCGTGAAGG

LGMN #2_F: CGCGATTCCGTCATGCTACT; LGMN #2_R: GTCAACTGCGGCCTGAAAAT

Lgmn #1_F:ACAGCAGTAAAAAGGAATGGAGT; Lgmn #1_R: TAGCACTTGGCTTCAATTGGC

Lgmn #2_F:GGGCAATACTGTAAACAGCAGTAAA; Lgmn #2_R: GCACTTGGCTTCAATTGGCTT

Human phospho-kinase array

After PMA-mediated differentiation, human THP1 cells were washed with PBS and incubated in FBS-free fresh RPMI for 24 h. After starvation, cells were treated with 20 ng/mL LGMN for 1 h in an incubator. Protein lysis of LGMN-treated THP1 cells and control cells were prepared separately according to the instruction of Proteome Profiler Human Phospho-Kinase Array Kit (Bio-Techne, #ARY003C). Briefly, 400 μg protein in 300 μL lysis buffer from each group was mixed with Array Buffer and incubated with both membranes A and B overnight at 4°C. Membranes were then washed in wash buffer and incubated with Detection Antibody Cocktail A or B for 2 h at room temperature, respectively. After washing, membranes were placed in the 8-Well Multi-dish containing the diluted Streptavidin-HRP for 30 min on a rocking platform shaker. Chemi Reagent Mix was prepared and added to membranes. Signal was determined using the ChemiDoc Imaging System (Bio-Rad).

Immunoblotting

The protein expression in cells was evaluated by Western blotting analysis in a standard protocol as we described previously.³⁶^,⁶⁷ Briefly, RIPA lysis buffer (Thermo Scientific, #89900) containing Protease Inhibitor Cocktail (Thermo Scientific, #78429) was used to extract protein from the palleted cells. The protein concentration was measured using the BCA Protein Assay Kit (Thermo Fisher Scientific, #PI23225). The cell lysate was mixed with the 4 x Leammli sample buffer and boiled at 95°C before loading to SurePAGE gels (GenScript, #M00653). The gels were run at a constant voltage of 60 or 80 V and then transferred to 0.2 μm nitrocellulose (NC) membrane (Bio-Rad, #1620112) using a preprogrammed standard protocol for 30 min in the Trans-Blot Turbo system (Bio-Rad). NC membrane was blocked using 5% dry milk in TBST for 1 h at room temperature. Primary antibodies, including LGMN (Cell Signaling Technology, #93627S), HIF1α (Cell Signaling Technology, #14179S), PD-L1 (Cell Signaling Technology, #64988S), P-STAT6 (Abcam, #ab28829), STAT6 (Cell Signaling Technology, #9362), P-STAT3 (Cell Signaling Technology, #9145S), STAT3 (Cell Signaling Technology, #9139), GSK-3β (Cell Signaling Technology, #12456S), and P-GSK-3β (Cell Signaling Technology, #5558S) were incubated with the membrane overnight at 4°C. Membrane was washed three times in PBS for removing residual primary antibody. HRP-linked, anti-mouse (Cell Signaling Technology, #7076) or anti-rabbit (Cell Signaling Technology, #7074S) secondary antibodies were then added to the nitrocellulose membrane accordingly. Membrane was incubated with ECL substrate and imaged under ChemiDoc Imaging System (Bio-Rad).

Flow cytometry

For in vitro experiments, single-cell suspensions were made by directly scarping cells from the 6-well plate. Tumor-derived immune cells from GBM mouse models were extracted using the Percoll density gradient cell separation method as we previously described.³⁶ Briefly, the harvested brain was homogenized on ice with pre-cold HBSS. Cells were spun down at 1,500 rpm for 10 min at 4°C, and then resuspended in 30% Percoll (GE Healthcare, #17-0891-01). The solution was gently laid on top of the 70% Percoll and centrifuged at 1,200 g for 30 min at 4°C with accelerator 7 and breaker 0. After removing myelin and debris, the interphase was collected, and then tumor-derived immune cells were resuspended for further analysis. For isolating cells from the spleen, tissue was homogenized on ice with pre-cold RPMI 2% FBS. ACK buffer (Thermo Fisher Scientific, #A1049201) was added to the cell suspensions to lyse red blood cells. Complete RPMI was used to stop the reaction. Spleenic cells were collected after centrifugation.

For membrane protein staining, the single-cell suspensions were incubated with fixable viability dye (Invitrogen, #5211229035) on ice for 10 min. Following washing with PBS, cells were incubated with the TruStain FcX (anti-mouse CD16/32) Antibody (BioLegend, #103132) and True-Stain Monocyte Blocker (BioLegend, #426102) to block Fc receptors and non-specific binding of the cyanine acceptor fluorophores for 30 min on ice. Different antibody cocktails, including Percp/Cy5.5 anti-mouse CD45 (BioLegend, #103132), BUV395 anti-mouse CD4 (BD Bioscience, #740208), PE anti-mouse CD68 (BD Bioscience, #566386), AF488 anti-mouse CD3 (BioLegend, #100210), BV421 anti-mouse CX3CR1 (BD Bioscience, #567531), BV711 anti-mouse CD8 (BioLegend, #100747), PE/Cy7 anti-mouse/human CD11b (BioLegend, #101216), PE anti-mouse PD1 (BioLegend, #135205), AF647 anti-mouse CD206 (BD Bioscience, #565250), and PE/Cy7 anti-mouse CD69 (BioLegend, #104512) were added to the samples and incubated for 30 min on ice. Intracellular protein staining was performed followed by cell surface marker staining. After washing with PBS, cells were incubated with fixation buffer (BioLegend, # 420801) for 20 min. Cells were then permeabilized by permeabilization buffer (0.1% Triton X-100 in PBS). FITC anti-human/mouse ARG1 (BioLegend, #IC5868F) antibody or LGMN primary antibody (Cell Signaling Technology, #93627S) was added to cell suspension for 1 h on ice, followed by incubation of goat anti-rabbit IgG cross-adsorbed secondary antibody (AF594) for 30 min. Cells were again fixed in fixation buffer overnight. Samples were readthrough the BD FACSymphony or BD LSRFortessa flow cytometer and analyzed in FlowJo v10.8.1.

Computational analysis of human GBM datasets

The TCGA GBM dataset (Agilent-4502A) or other available datasets from GlioVis (http://gliovis.bioinfo.cnio.es/) were enrolled for gene (including gene signature) expression, correlation, and GSEA analyses. Single-cell sequencing data of GSE84465 ³⁴ was used for analyzing LGMN expression in TAMs. CD68 was used to identify TAM population. The average expression of CD68 and LGMN was represented by color (low to high was shown as blue to gray).

Quantification and statistical analysis

Statistical analysis was performed using GraphPad Prism 10 (GraphPad Software, USA). All the measurement data were presented as the means ± SEM. Correlation analysis was conducted using the Pearson test to determine the Pearson correlation coefficient (R value) and p-value. The survival analysis for animal models was determined by conducting Log rank (Mantel-Cox) test. Comparison between two groups was determined using Student’s t-test, and comparisons among multiple groups were evaluated using a one-way ANOVA test in Tukey’s method. Differences with a minimum of p < 0.05 were indicated as statistically significant.

Acknowledgments

We thank Drs. Samuel D. Rabkin and Jian Hu for providing 005 GSCs and QPP7 GSC, respectively, Dr. Michael A. Curran for the help of developing HIF1α-mKO mice, and Wen-Hao Hsu for the help with single-cell sequencing data analysis. This work was supported in part by NIH R00 CA240896 (P.C.), NIH R01 NS124594 (P.C.), NIH R01 NS127824 (P.C.), DoD Career Development Award W81XWH-21-1-0380 (P.C.), Cancer Research Foundation Young Investigator Award (P.C.), Lynn Sage Scholar Award (P.C.), American Cancer Society Institutional Research Grant IRG-21-144-27 (P.C.), NIH P50 CA221747 (to P.C., Brain Cancer SPORE CEP Award), philanthropic donation from Mindy Jacobson and the Bill Bass Foundation (P.C.), Northwestern University start-up funds (P.C.), and the Northwestern Medicine Malnati Brain Tumor Insitute of the Robert H. Lurie Comprehensive Cancer Center (P.C.). Imaging and flow cytometry work was performed at the Northwestern University Center for Advanced Microscopy and Flow Cytometry Core Facility supported by NCI CCSG P30 CA060553. IncuCyte analysis was performed in the Analytical bioNanoTechnology Core (ANTEC) Facility supported by the Soft and Hybrid Nanotechnology Experimental (SHyNE) Resource (NSF ECCS-2025633).

Author contributions

L.P. and S.G. performed most experiments. F.K. performed all the experiments related to HIF1α. M.D., H.A., Y.L., and Y.H. helped to perform ChIP-PCR, flow cytometry, immunofluorescence, and some in vivo experiments. P.C. conceived the project. L.P. and P.C. wrote the manuscript. All authors participated in editing the manuscript.

Declaration of interests

The authors declare no competing interests.

Published: October 18, 2023

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2023.101238.

Supplemental information

Document S1. Figures S1–S6

mmc1.pdf^{(1.1MB, pdf)}

Document S2. Article plus supplemental information

mmc2.pdf^{(9.3MB, pdf)}

Data and code availability

•
This paper analyses publicly available data. The references for these datasets are listed within the relevant results sections.
•
This study does not report original code.
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

References

1.Wen P.Y., Weller M., Lee E.Q., Alexander B.M., Barnholtz-Sloan J.S., Barthel F.P., Batchelor T.T., Bindra R.S., Chang S.M., Chiocca E.A., et al. Glioblastoma in adults: a Society for Neuro-Oncology (SNO) and European Society of Neuro-Oncology (EANO) consensus review on current management and future directions. Neuro Oncol. 2020;22:1073–1113. doi: 10.1093/neuonc/noaa106. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Tykocki T., Eltayeb M. Ten-year survival in glioblastoma. A systematic review. J. Clin. Neurosci. 2018;54:7–13. doi: 10.1016/j.jocn.2018.05.002. [DOI] [PubMed] [Google Scholar]
3.Kotecha R., Odia Y., Khosla A.A., Ahluwalia M.S. JCO Oncology Practice; 2023. Key Clinical Principles in the Management of Glioblastoma. OP.22.00476. [DOI] [PubMed] [Google Scholar]
4.Van Hove H., Martens L., Scheyltjens I., De Vlaminck K., Pombo Antunes A.R., De Prijck S., Vandamme N., De Schepper S., Van Isterdael G., Scott C.L., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nat. Neurosci. 2019;22:1021–1035. doi: 10.1038/s41593-019-0393-4. [DOI] [PubMed] [Google Scholar]
5.Pombo Antunes A.R., Scheyltjens I., Lodi F., Messiaen J., Antoranz A., Duerinck J., Kancheva D., Martens L., De Vlaminck K., Van Hove H., et al. Single-cell profiling of myeloid cells in glioblastoma across species and disease stage reveals macrophage competition and specialization. Nat. Neurosci. 2021;24:595–610. doi: 10.1038/s41593-020-00789-y. [DOI] [PubMed] [Google Scholar]
6.Pang L., Khan F., Heimberger A.B., Chen P. Mechanism and therapeutic potential of tumor-immune symbiosis in glioblastoma. Trends Cancer. 2022;8:839–854. doi: 10.1016/j.trecan.2022.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Xuan W., Lesniak M.S., James C.D., Heimberger A.B., Chen P. Context-Dependent Glioblastoma-Macrophage/Microglia Symbiosis and Associated Mechanisms. Trends Immunol. 2021;42:280–292. doi: 10.1016/j.it.2021.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Khan F., Pang L., Dunterman M., Lesniak M.S., Heimberger A.B., Chen P. Macrophages and microglia in glioblastoma: heterogeneity, plasticity, and therapy. J. Clin. Invest. 2023;133 doi: 10.1172/JCI163446. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Chen P., Zhao D., Li J., Liang X., Li J., Chang A., Henry V.K., Lan Z., Spring D.J., Rao G., et al. Symbiotic Macrophage-Glioma Cell Interactions Reveal Synthetic Lethality in PTEN-Null Glioma. Cancer Cell. 2019;35:868–884.e6. doi: 10.1016/j.ccell.2019.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Pang L., Khan F., Dunterman M., Chen P. Pharmacological targeting of the tumor–immune symbiosis in glioblastoma. Trends Pharmacol. Sci. 2022;43:686–700. doi: 10.1016/j.tips.2022.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.López-Otín C., Matrisian L.M. Emerging roles of proteases in tumour suppression. Nat. Rev. Cancer. 2007;7:800–808. doi: 10.1038/nrc2228. [DOI] [PubMed] [Google Scholar]
12.Rao J.S. Molecular mechanisms of glioma invasiveness: the role of proteases. Nat. Rev. Cancer. 2003;3:489–501. doi: 10.1038/nrc1121. [DOI] [PubMed] [Google Scholar]
13.Coussens L.M., Fingleton B., Matrisian L.M. Matrix Metalloproteinase Inhibitors and Cancer—Trials and Tribulations. Science. 2002;295:2387–2392. doi: 10.1126/science.1067100. [DOI] [PubMed] [Google Scholar]
14.Overall C.M., López-Otín C. Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat. Rev. Cancer. 2002;2:657–672. doi: 10.1038/nrc884. [DOI] [PubMed] [Google Scholar]
15.Cui C., Chakraborty K., Tang X.A., Zhou G., Schoenfelt K.Q., Becker K.M., Hoffman A., Chang Y.-F., Blank A., Reardon C.A., et al. Neutrophil elastase selectively kills cancer cells and attenuates tumorigenesis. Cell. 2021;184:3163–3177.e21. doi: 10.1016/j.cell.2021.04.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Jiang L., Wang Y.-J., Zhao J., Uehara M., Hou Q., Kasinath V., Ichimura T., Banouni N., Dai L., Li X., et al. Direct Tumor Killing and Immunotherapy through Anti-SerpinB9 Therapy. Cell. 2020;183:1219–1233.e18. doi: 10.1016/j.cell.2020.10.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Wang T., Zhou Y., Zhou Z., Zhang P., Yan R., Sun L., Ma W., Zhang T., Shen S., Liu H., et al. Secreted protease PRSS35 suppresses hepatocellular carcinoma by disabling CXCL2-mediated neutrophil extracellular traps. Nat. Commun. 2023;14:1513. doi: 10.1038/s41467-023-37227-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Jacobs K.A., André-Grégoire G., Maghe C., Thys A., Li Y., Harford-Wright E., Trillet K., Douanne T., Alves Nicolau C., Frénel J.S., et al. Paracaspase MALT1 regulates glioma cell survival by controlling endo-lysosome homeostasis. EMBO J. 2020;39 doi: 10.15252/embj.2019102030. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Lauko A., Volovetz J., Turaga S.M., Bayik D., Silver D.J., Mitchell K., Mulkearns-Hubert E.E., Watson D.C., Desai K., Midha M., et al. SerpinB3 drives cancer stem cell survival in glioblastoma. Cell Rep. 2022;40 doi: 10.1016/j.celrep.2022.111348. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Jimenez-Pascual A., Hale J.S., Kordowski A., Pugh J., Silver D.J., Bayik D., Roversi G., Alban T.J., Rao S., Chen R., et al. ADAMDEC1 Maintains a Growth Factor Signaling Loop in Cancer Stem Cells. Cancer Discov. 2019;9:1574–1589. doi: 10.1158/2159-8290.CD-18-1308. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Maehr R., Hang H.C., Mintern J.D., Kim Y.-M., Cuvillier A., Nishimura M., Yamada K., Shirahama-Noda K., Hara-Nishimura I., Ploegh H.L. Asparagine Endopeptidase Is Not Essential for Class II MHC Antigen Presentation but Is Required for Processing of Cathepsin L in Mice1. J. Immunol. 2005;174:7066–7074. doi: 10.4049/jimmunol.174.11.7066. [DOI] [PubMed] [Google Scholar]
22.Watts C., Matthews S.P., Mazzeo D., Manoury B., Moss C.X. Asparaginyl endopeptidase: case history of a class II MHC compartment protease. Immunol. Rev. 2005;207:218–228. doi: 10.1111/j.0105-2896.2005.00312.x. [DOI] [PubMed] [Google Scholar]
23.Zhang Z., Obianyo O., Dall E., Du Y., Fu H., Liu X., Kang S.S., Song M., Yu S.-P., Cabrele C., et al. Inhibition of delta-secretase improves cognitive functions in mouse models of Alzheimer’s disease. Nat. Commun. 2017;8 doi: 10.1038/ncomms14740. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Zhang Z., Song M., Liu X., Kang S.S., Kwon I.-S., Duong D.M., Seyfried N.T., Hu W.T., Liu Z., Wang J.-Z., et al. Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer’s disease. Nat. Med. 2014;20:1254–1262. doi: 10.1038/nm.3700. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Liu C., Sun C., Huang H., Janda K., Edgington T. Overexpression of Legumain in Tumors Is Significant for Invasion/Metastasis and a Candidate Enzymatic Target for Prodrug Therapy1. Cancer Res. 2003;63:2957–2964. [PubMed] [Google Scholar]
26.Liu C., Wang J., Zheng Y., Zhu Y., Zhou Z., Liu Z., Lin C., Wan Y., Wen Y., Liu C., et al. Autocrine pro-legumain promotes breast cancer metastasis via binding to integrin αvβ3. Oncogene. 2022;41:4091–4103. doi: 10.1038/s41388-022-02409-4. [DOI] [PubMed] [Google Scholar]
27.Wang Y., Zhang S., Wang H., Cui Y., Wang Z., Cheng X., Li W., Hou J., Ji Y., Liu T. High Level of Legumain Was Correlated With Worse Prognosis and Peritoneal Metastasis in Gastric Cancer Patients. Front. Oncol. 2020;10:966. doi: 10.3389/fonc.2020.00966. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Toss M.S., Miligy I.M., Gorringe K.L., McCaffrey L., AlKawaz A., Abidi A., Ellis I.O., Green A.R., Rakha E.A. Legumain is an independent predictor for invasive recurrence in breast ductal carcinoma in situ. Mod. Pathol. 2019;32:639–649. doi: 10.1038/s41379-018-0180-x. [DOI] [PubMed] [Google Scholar]
29.Murthy R.V., Arbman G., Gao J., Roodman G.D., Sun X.-F. Legumain Expression in Relation to Clinicopathologic and Biological Variables in Colorectal Cancer. Clin. Cancer Res. 2005;11:2293–2299. doi: 10.1158/1078-0432.CCR-04-1642. [DOI] [PubMed] [Google Scholar]
30.Chen B., Wang M., Huang R., Liao K., Wang T., Yang R., Zhang W., Shi Z., Ren L., Lv Q., et al. Circular RNA circLGMN facilitates glioblastoma progression by targeting miR-127-3p/LGMN axis. Cancer Lett. 2021;522:225–237. doi: 10.1016/j.canlet.2021.09.030. [DOI] [PubMed] [Google Scholar]
31.Klemm F., Maas R.R., Bowman R.L., Kornete M., Soukup K., Nassiri S., Brouland J.-P., Iacobuzio-Donahue C.A., Brennan C., Tabar V., et al. Interrogation of the Microenvironmental Landscape in Brain Tumors Reveals Disease-Specific Alterations of Immune Cells. Cell. 2020;181:1643–1660.e17. doi: 10.1016/j.cell.2020.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Bowman R.L., Klemm F., Akkari L., Pyonteck S.M., Sevenich L., Quail D.F., Dhara S., Simpson K., Gardner E.E., Iacobuzio-Donahue C.A., et al. Macrophage Ontogeny Underlies Differences in Tumor-Specific Education in Brain Malignancies. Cell Rep. 2016;17:2445–2459. doi: 10.1016/j.celrep.2016.10.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Gabrusiewicz K., Rodriguez B., Wei J., Hashimoto Y., Healy L.M., Maiti S.N., Thomas G., Zhou S., Wang Q., Elakkad A., et al. Glioblastoma-infiltrated innate immune cells resemble M0 macrophage phenotype. JCI Insight. 2016;1 doi: 10.1172/jci.insight.85841. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Darmanis S., Sloan S.A., Croote D., Mignardi M., Chernikova S., Samghababi P., Zhang Y., Neff N., Kowarsky M., Caneda C., et al. Single-Cell RNA-Seq Analysis of Infiltrating Neoplastic Cells at the Migrating Front of Human Glioblastoma. Cell Rep. 2017;21:1399–1410. doi: 10.1016/j.celrep.2017.10.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Leblond M.M., Gérault A.N., Corroyer-Dulmont A., MacKenzie E.T., Petit E., Bernaudin M., Valable S. Hypoxia induces macrophage polarization and re-education toward an M2 phenotype in U87 and U251 glioblastoma models. OncoImmunology. 2016;5 doi: 10.1080/2162402X.2015.1056442. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Xuan W., Hsu W.-H., Khan F., Dunterman M., Pang L., Wainwright D.A., Ahmed A.U., Heimberger A.B., Lesniak M.S., Chen P. Circadian Regulator CLOCK Drives Immunosuppression in Glioblastoma. Cancer Immunol. Res. 2022;10:770–784. doi: 10.1158/2326-6066.CIR-21-0559. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Patel S., Werstuck G.H. Macrophage Function and the Role of GSK3. Int. J. Mol. Sci. 2021;22:2206. doi: 10.3390/ijms22042206. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Hambardzumyan D., Bergers G. Glioblastoma: Defining Tumor Niches. Trends Cancer. 2015;1:252–265. doi: 10.1016/j.trecan.2015.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Nouri K., Feng Y., Schimmer A.D. Mitochondrial ClpP serine protease-biological function and emerging target for cancer therapy. Cell Death Dis. 2020;11:841–912. doi: 10.1038/s41419-020-03062-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Kim S. TMPRSS4, a type II transmembrane serine protease, as a potential therapeutic target in cancer. Exp. Mol. Med. 2023;55:716–724. doi: 10.1038/s12276-023-00975-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Li Q., Ye C., Tian T., Jiang Q., Zhao P., Wang X., Liu F., Shan J., Ruan J. The emerging role of ubiquitin-specific protease 20 in tumorigenesis and cancer therapeutics. Cell Death Dis. 2022;13:434–511. doi: 10.1038/s41419-022-04853-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Fischer A. Mechanism of the Proteolytic Activity of Malignant Tissue Cells. Nature. 1946;157:442. doi: 10.1038/157442c0. [DOI] [PubMed] [Google Scholar]
43.Park K.C., Dharmasivam M., Richardson D.R. The Role of Extracellular Proteases in Tumor Progression and the Development of Innovative Metal Ion Chelators That Inhibit Their Activity. Int. J. Mol. Sci. 2020;21:6805. doi: 10.3390/ijms21186805. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Hernandez L., Kim M.K., Noonan A.M., Sagher E., Kohlhammer H., Wright G., Lyle L.T., Steeg P.S., Anver M., Bowtell D.D., et al. A dual role for Caspase8 and NF-κB interactions in regulating apoptosis and necroptosis of ovarian cancer, with correlation to patient survival. Cell Death Discov. 2015;1:15053–15111. doi: 10.1038/cddiscovery.2015.53. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Montel V., Kleeman J., Agarwal D., Spinella D., Kawai K., Tarin D. Altered Metastatic Behavior of Human Breast Cancer Cells after Experimental Manipulation of Matrix Metalloproteinase 8 Gene Expression. Cancer Res. 2004;64:1687–1694. doi: 10.1158/0008-5472.CAN-03-2047. [DOI] [PubMed] [Google Scholar]
46.Houghton A.M., Grisolano J.L., Baumann M.L., Kobayashi D.K., Hautamaki R.D., Nehring L.C., Cornelius L.A., Shapiro S.D. Macrophage Elastase (Matrix Metalloproteinase-12) Suppresses Growth of Lung Metastases. Cancer Res. 2006;66:6149–6155. doi: 10.1158/0008-5472.CAN-04-0297. [DOI] [PubMed] [Google Scholar]
47.Cruz-Monserrate Z., Abd-Elgaliel W.R., Grote T., Deng D., Ji B., Arumugam T., Wang H., Tung C.-H., Logsdon C.D. Detection of pancreatic cancer tumours and precursor lesions by cathepsin E activity in mouse models. Gut. 2012;61:1315–1322. doi: 10.1136/gutjnl-2011-300544. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Khan S.U., Khan I.M., Khan M.U., Ud Din M.A., Khan M.Z., Khan N.M., Liu Y. Role of LGMN in tumor development and its progression and connection with the tumor microenvironment. Front. Mol. Biosci. 2023;10 doi: 10.3389/fmolb.2023.1121964. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Qi Q., Obianyo O., Du Y., Fu H., Li S., Ye K. Blockade of Asparagine Endopeptidase Inhibits Cancer Metastasis. J. Med. Chem. 2017;60:7244–7255. doi: 10.1021/acs.jmedchem.7b00228. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Shen L., Kang L., Wang D., Xun J., Chen C., Du L., Zhang M., Gong J., Mi X., Yue S., et al. Legumain-deficient macrophages promote senescence of tumor cells by sustaining JAK1/STAT1 activation. Cancer Lett. 2020;472:40–49. doi: 10.1016/j.canlet.2019.12.013. [DOI] [PubMed] [Google Scholar]
51.Guo X., Xue H., Shao Q., Wang J., Guo X., Chen X., Zhang J., Xu S., Li T., Zhang P., et al. Hypoxia promotes glioma-associated macrophage infiltration via periostin and subsequent M2 polarization by upregulating TGF-beta and M-CSFR. Oncotarget. 2016;7:80521–80542. doi: 10.18632/oncotarget.11825. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Chen P., Hsu W.-H., Chang A., Tan Z., Lan Z., Zhou A., Spring D.J., Lang F.F., Wang Y.A., DePinho R.A. Circadian Regulator CLOCK Recruits Immune-Suppressive Microglia into the GBM Tumor Microenvironment. Cancer Discov. 2020;10:371–381. doi: 10.1158/2159-8290.CD-19-0400. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Stadlbauer A., Kinfe T.M., Eyüpoglu I., Zimmermann M., Kitzwögerer M., Podar K., Buchfelder M., Heinz G., Oberndorfer S., Marhold F. Tissue Hypoxia and Alterations in Microvascular Architecture Predict Glioblastoma Recurrence in Humans. Clin. Cancer Res. 2021;27:1641–1649. doi: 10.1158/1078-0432.CCR-20-3580. [DOI] [PubMed] [Google Scholar]
54.Wälchli T., Bisschop J., Carmeliet P., Zadeh G., Monnier P.P., De Bock K., Radovanovic I. Shaping the brain vasculature in development and disease in the single-cell era. Nat. Rev. Neurosci. 2023:1–28. doi: 10.1038/s41583-023-00684-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Chen Z., Han F., Du Y., Shi H., Zhou W. Hypoxic microenvironment in cancer: molecular mechanisms and therapeutic interventions. Sig Transduct Target Ther. 2023;8 doi: 10.1038/s41392-023-01332-8. 70-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Pan L., Bai P., Weng X., Liu J., Chen Y., Chen S., Ma X., Hu K., Sun A., Ge J. Legumain Is an Endogenous Modulator of Integrin αvβ3 Triggering Vascular Degeneration, Dissection, and Rupture. Circulation. 2022;145:659–674. doi: 10.1161/CIRCULATIONAHA.121.056640. [DOI] [PubMed] [Google Scholar]
57.Ren Y.-C., Zhao Q., He Y., Li B., Wu Z., Dai J., Wen L., Wang X., Hu G. Legumain promotes fibrogenesis in chronic pancreatitis via activation of transforming growth factor β1. J. Mol. Med. 2020;98:863–874. doi: 10.1007/s00109-020-01911-0. [DOI] [PubMed] [Google Scholar]
58.Gabrusiewicz K., Li X., Wei J., Hashimoto Y., Marisetty A.L., Ott M., Wang F., Hawke D., Yu J., Healy L.M., et al. Glioblastoma stem cell-derived exosomes induce M2 macrophages and PD-L1 expression on human monocytes. OncoImmunology. 2018;7 doi: 10.1080/2162402X.2017.1412909. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Rébé C., Ghiringhelli F. STAT3, a Master Regulator of Anti-Tumor Immune Response. Cancers. 2019;11:1280. doi: 10.3390/cancers11091280. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Boussiotis V.A. Molecular and Biochemical Aspects of the PD-1 Checkpoint Pathway. N. Engl. J. Med. 2016;375:1767–1778. doi: 10.1056/NEJMra1514296. [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Patsoukis N., Wang Q., Strauss L., Boussiotis V.A. Revisiting the PD-1 pathway. Sci. Adv. 2020;6 doi: 10.1126/sciadv.abd2712. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Khasraw M., Reardon D.A., Weller M., Sampson J.H. PD-1 Inhibitors: Do they have a Future in the Treatment of Glioblastoma? Clin. Cancer Res. 2020;26:5287–5296. doi: 10.1158/1078-0432.CCR-20-1135. [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Reardon D.A., Brandes A.A., Omuro A., Mulholland P., Lim M., Wick A., Baehring J., Ahluwalia M.S., Roth P., Bähr O., et al. Effect of Nivolumab vs Bevacizumab in Patients With Recurrent Glioblastoma: The CheckMate 143 Phase 3 Randomized Clinical Trial. JAMA Oncol. 2020;6:1003–1010. doi: 10.1001/jamaoncol.2020.1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Peranzoni E., Lemoine J., Vimeux L., Feuillet V., Barrin S., Kantari-Mimoun C., Bercovici N., Guérin M., Biton J., Ouakrim H., et al. Macrophages impede CD8 T cells from reaching tumor cells and limit the efficacy of anti–PD-1 treatment. Proc. Natl. Acad. Sci. USA. 2018;115:E4041–E4050. doi: 10.1073/pnas.1720948115. [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Lee J., Nicosia M., Hong E.S., Silver D.J., Li C., Bayik D., Watson D.C., Lauko A., Kay K.E., Wang S.Z., et al. Sex-Biased T-cell Exhaustion Drives Differential Immune Responses in Glioblastoma. Cancer Discov. 2023;13:2090–2105. doi: 10.1158/2159-8290.CD-22-0869. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Bayik D., Zhou Y., Park C., Hong C., Vail D., Silver D.J., Lauko A., Roversi G., Watson D.C., Lo A., et al. Myeloid-Derived Suppressor Cell Subsets Drive Glioblastoma Growth in a Sex-Specific Manner. Cancer Discov. 2020;10:1210–1225. doi: 10.1158/2159-8290.CD-19-1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Pang L., Dunterman M., Xuan W., Gonzalez A., Lin Y., Hsu W.-H., Khan F., Hagan R.S., Muller W.A., Heimberger A.B., Chen P. Circadian regulator CLOCK promotes tumor angiogenesis in glioblastoma. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112127. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Bowman R.L., Wang Q., Carro A., Verhaak R.G.W., Squatrito M. GlioVis data portal for visualization and analysis of brain tumor expression datasets. Neuro-Oncology. 2017;19:139–141. doi: 10.1093/neuonc/now247. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S6

mmc1.pdf^{(1.1MB, pdf)}

Document S2. Article plus supplemental information

mmc2.pdf^{(9.3MB, pdf)}

Data Availability Statement

•
This paper analyses publicly available data. The references for these datasets are listed within the relevant results sections.
•
This study does not report original code.
•
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

[bib1] 1.Wen P.Y., Weller M., Lee E.Q., Alexander B.M., Barnholtz-Sloan J.S., Barthel F.P., Batchelor T.T., Bindra R.S., Chang S.M., Chiocca E.A., et al. Glioblastoma in adults: a Society for Neuro-Oncology (SNO) and European Society of Neuro-Oncology (EANO) consensus review on current management and future directions. Neuro Oncol. 2020;22:1073–1113. doi: 10.1093/neuonc/noaa106. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib2] 2.Tykocki T., Eltayeb M. Ten-year survival in glioblastoma. A systematic review. J. Clin. Neurosci. 2018;54:7–13. doi: 10.1016/j.jocn.2018.05.002. [DOI] [PubMed] [Google Scholar]

[bib3] 3.Kotecha R., Odia Y., Khosla A.A., Ahluwalia M.S. JCO Oncology Practice; 2023. Key Clinical Principles in the Management of Glioblastoma. OP.22.00476. [DOI] [PubMed] [Google Scholar]

[bib4] 4.Van Hove H., Martens L., Scheyltjens I., De Vlaminck K., Pombo Antunes A.R., De Prijck S., Vandamme N., De Schepper S., Van Isterdael G., Scott C.L., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nat. Neurosci. 2019;22:1021–1035. doi: 10.1038/s41593-019-0393-4. [DOI] [PubMed] [Google Scholar]

[bib5] 5.Pombo Antunes A.R., Scheyltjens I., Lodi F., Messiaen J., Antoranz A., Duerinck J., Kancheva D., Martens L., De Vlaminck K., Van Hove H., et al. Single-cell profiling of myeloid cells in glioblastoma across species and disease stage reveals macrophage competition and specialization. Nat. Neurosci. 2021;24:595–610. doi: 10.1038/s41593-020-00789-y. [DOI] [PubMed] [Google Scholar]

[bib6] 6.Pang L., Khan F., Heimberger A.B., Chen P. Mechanism and therapeutic potential of tumor-immune symbiosis in glioblastoma. Trends Cancer. 2022;8:839–854. doi: 10.1016/j.trecan.2022.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib7] 7.Xuan W., Lesniak M.S., James C.D., Heimberger A.B., Chen P. Context-Dependent Glioblastoma-Macrophage/Microglia Symbiosis and Associated Mechanisms. Trends Immunol. 2021;42:280–292. doi: 10.1016/j.it.2021.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib8] 8.Khan F., Pang L., Dunterman M., Lesniak M.S., Heimberger A.B., Chen P. Macrophages and microglia in glioblastoma: heterogeneity, plasticity, and therapy. J. Clin. Invest. 2023;133 doi: 10.1172/JCI163446. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib9] 9.Chen P., Zhao D., Li J., Liang X., Li J., Chang A., Henry V.K., Lan Z., Spring D.J., Rao G., et al. Symbiotic Macrophage-Glioma Cell Interactions Reveal Synthetic Lethality in PTEN-Null Glioma. Cancer Cell. 2019;35:868–884.e6. doi: 10.1016/j.ccell.2019.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib10] 10.Pang L., Khan F., Dunterman M., Chen P. Pharmacological targeting of the tumor–immune symbiosis in glioblastoma. Trends Pharmacol. Sci. 2022;43:686–700. doi: 10.1016/j.tips.2022.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib11] 11.López-Otín C., Matrisian L.M. Emerging roles of proteases in tumour suppression. Nat. Rev. Cancer. 2007;7:800–808. doi: 10.1038/nrc2228. [DOI] [PubMed] [Google Scholar]

[bib12] 12.Rao J.S. Molecular mechanisms of glioma invasiveness: the role of proteases. Nat. Rev. Cancer. 2003;3:489–501. doi: 10.1038/nrc1121. [DOI] [PubMed] [Google Scholar]

[bib13] 13.Coussens L.M., Fingleton B., Matrisian L.M. Matrix Metalloproteinase Inhibitors and Cancer—Trials and Tribulations. Science. 2002;295:2387–2392. doi: 10.1126/science.1067100. [DOI] [PubMed] [Google Scholar]

[bib14] 14.Overall C.M., López-Otín C. Strategies for MMP inhibition in cancer: innovations for the post-trial era. Nat. Rev. Cancer. 2002;2:657–672. doi: 10.1038/nrc884. [DOI] [PubMed] [Google Scholar]

[bib15] 15.Cui C., Chakraborty K., Tang X.A., Zhou G., Schoenfelt K.Q., Becker K.M., Hoffman A., Chang Y.-F., Blank A., Reardon C.A., et al. Neutrophil elastase selectively kills cancer cells and attenuates tumorigenesis. Cell. 2021;184:3163–3177.e21. doi: 10.1016/j.cell.2021.04.016. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib16] 16.Jiang L., Wang Y.-J., Zhao J., Uehara M., Hou Q., Kasinath V., Ichimura T., Banouni N., Dai L., Li X., et al. Direct Tumor Killing and Immunotherapy through Anti-SerpinB9 Therapy. Cell. 2020;183:1219–1233.e18. doi: 10.1016/j.cell.2020.10.045. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib17] 17.Wang T., Zhou Y., Zhou Z., Zhang P., Yan R., Sun L., Ma W., Zhang T., Shen S., Liu H., et al. Secreted protease PRSS35 suppresses hepatocellular carcinoma by disabling CXCL2-mediated neutrophil extracellular traps. Nat. Commun. 2023;14:1513. doi: 10.1038/s41467-023-37227-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib18] 18.Jacobs K.A., André-Grégoire G., Maghe C., Thys A., Li Y., Harford-Wright E., Trillet K., Douanne T., Alves Nicolau C., Frénel J.S., et al. Paracaspase MALT1 regulates glioma cell survival by controlling endo-lysosome homeostasis. EMBO J. 2020;39 doi: 10.15252/embj.2019102030. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib19] 19.Lauko A., Volovetz J., Turaga S.M., Bayik D., Silver D.J., Mitchell K., Mulkearns-Hubert E.E., Watson D.C., Desai K., Midha M., et al. SerpinB3 drives cancer stem cell survival in glioblastoma. Cell Rep. 2022;40 doi: 10.1016/j.celrep.2022.111348. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib20] 20.Jimenez-Pascual A., Hale J.S., Kordowski A., Pugh J., Silver D.J., Bayik D., Roversi G., Alban T.J., Rao S., Chen R., et al. ADAMDEC1 Maintains a Growth Factor Signaling Loop in Cancer Stem Cells. Cancer Discov. 2019;9:1574–1589. doi: 10.1158/2159-8290.CD-18-1308. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib21] 21.Maehr R., Hang H.C., Mintern J.D., Kim Y.-M., Cuvillier A., Nishimura M., Yamada K., Shirahama-Noda K., Hara-Nishimura I., Ploegh H.L. Asparagine Endopeptidase Is Not Essential for Class II MHC Antigen Presentation but Is Required for Processing of Cathepsin L in Mice1. J. Immunol. 2005;174:7066–7074. doi: 10.4049/jimmunol.174.11.7066. [DOI] [PubMed] [Google Scholar]

[bib22] 22.Watts C., Matthews S.P., Mazzeo D., Manoury B., Moss C.X. Asparaginyl endopeptidase: case history of a class II MHC compartment protease. Immunol. Rev. 2005;207:218–228. doi: 10.1111/j.0105-2896.2005.00312.x. [DOI] [PubMed] [Google Scholar]

[bib23] 23.Zhang Z., Obianyo O., Dall E., Du Y., Fu H., Liu X., Kang S.S., Song M., Yu S.-P., Cabrele C., et al. Inhibition of delta-secretase improves cognitive functions in mouse models of Alzheimer’s disease. Nat. Commun. 2017;8 doi: 10.1038/ncomms14740. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib24] 24.Zhang Z., Song M., Liu X., Kang S.S., Kwon I.-S., Duong D.M., Seyfried N.T., Hu W.T., Liu Z., Wang J.-Z., et al. Cleavage of tau by asparagine endopeptidase mediates the neurofibrillary pathology in Alzheimer’s disease. Nat. Med. 2014;20:1254–1262. doi: 10.1038/nm.3700. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib25] 25.Liu C., Sun C., Huang H., Janda K., Edgington T. Overexpression of Legumain in Tumors Is Significant for Invasion/Metastasis and a Candidate Enzymatic Target for Prodrug Therapy1. Cancer Res. 2003;63:2957–2964. [PubMed] [Google Scholar]

[bib26] 26.Liu C., Wang J., Zheng Y., Zhu Y., Zhou Z., Liu Z., Lin C., Wan Y., Wen Y., Liu C., et al. Autocrine pro-legumain promotes breast cancer metastasis via binding to integrin αvβ3. Oncogene. 2022;41:4091–4103. doi: 10.1038/s41388-022-02409-4. [DOI] [PubMed] [Google Scholar]

[bib27] 27.Wang Y., Zhang S., Wang H., Cui Y., Wang Z., Cheng X., Li W., Hou J., Ji Y., Liu T. High Level of Legumain Was Correlated With Worse Prognosis and Peritoneal Metastasis in Gastric Cancer Patients. Front. Oncol. 2020;10:966. doi: 10.3389/fonc.2020.00966. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib28] 28.Toss M.S., Miligy I.M., Gorringe K.L., McCaffrey L., AlKawaz A., Abidi A., Ellis I.O., Green A.R., Rakha E.A. Legumain is an independent predictor for invasive recurrence in breast ductal carcinoma in situ. Mod. Pathol. 2019;32:639–649. doi: 10.1038/s41379-018-0180-x. [DOI] [PubMed] [Google Scholar]

[bib29] 29.Murthy R.V., Arbman G., Gao J., Roodman G.D., Sun X.-F. Legumain Expression in Relation to Clinicopathologic and Biological Variables in Colorectal Cancer. Clin. Cancer Res. 2005;11:2293–2299. doi: 10.1158/1078-0432.CCR-04-1642. [DOI] [PubMed] [Google Scholar]

[bib30] 30.Chen B., Wang M., Huang R., Liao K., Wang T., Yang R., Zhang W., Shi Z., Ren L., Lv Q., et al. Circular RNA circLGMN facilitates glioblastoma progression by targeting miR-127-3p/LGMN axis. Cancer Lett. 2021;522:225–237. doi: 10.1016/j.canlet.2021.09.030. [DOI] [PubMed] [Google Scholar]

[bib31] 31.Klemm F., Maas R.R., Bowman R.L., Kornete M., Soukup K., Nassiri S., Brouland J.-P., Iacobuzio-Donahue C.A., Brennan C., Tabar V., et al. Interrogation of the Microenvironmental Landscape in Brain Tumors Reveals Disease-Specific Alterations of Immune Cells. Cell. 2020;181:1643–1660.e17. doi: 10.1016/j.cell.2020.05.007. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib32] 32.Bowman R.L., Klemm F., Akkari L., Pyonteck S.M., Sevenich L., Quail D.F., Dhara S., Simpson K., Gardner E.E., Iacobuzio-Donahue C.A., et al. Macrophage Ontogeny Underlies Differences in Tumor-Specific Education in Brain Malignancies. Cell Rep. 2016;17:2445–2459. doi: 10.1016/j.celrep.2016.10.052. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib33] 33.Gabrusiewicz K., Rodriguez B., Wei J., Hashimoto Y., Healy L.M., Maiti S.N., Thomas G., Zhou S., Wang Q., Elakkad A., et al. Glioblastoma-infiltrated innate immune cells resemble M0 macrophage phenotype. JCI Insight. 2016;1 doi: 10.1172/jci.insight.85841. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib34] 34.Darmanis S., Sloan S.A., Croote D., Mignardi M., Chernikova S., Samghababi P., Zhang Y., Neff N., Kowarsky M., Caneda C., et al. Single-Cell RNA-Seq Analysis of Infiltrating Neoplastic Cells at the Migrating Front of Human Glioblastoma. Cell Rep. 2017;21:1399–1410. doi: 10.1016/j.celrep.2017.10.030. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib35] 35.Leblond M.M., Gérault A.N., Corroyer-Dulmont A., MacKenzie E.T., Petit E., Bernaudin M., Valable S. Hypoxia induces macrophage polarization and re-education toward an M2 phenotype in U87 and U251 glioblastoma models. OncoImmunology. 2016;5 doi: 10.1080/2162402X.2015.1056442. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib36] 36.Xuan W., Hsu W.-H., Khan F., Dunterman M., Pang L., Wainwright D.A., Ahmed A.U., Heimberger A.B., Lesniak M.S., Chen P. Circadian Regulator CLOCK Drives Immunosuppression in Glioblastoma. Cancer Immunol. Res. 2022;10:770–784. doi: 10.1158/2326-6066.CIR-21-0559. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib37] 37.Patel S., Werstuck G.H. Macrophage Function and the Role of GSK3. Int. J. Mol. Sci. 2021;22:2206. doi: 10.3390/ijms22042206. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib38] 38.Hambardzumyan D., Bergers G. Glioblastoma: Defining Tumor Niches. Trends Cancer. 2015;1:252–265. doi: 10.1016/j.trecan.2015.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib39] 39.Nouri K., Feng Y., Schimmer A.D. Mitochondrial ClpP serine protease-biological function and emerging target for cancer therapy. Cell Death Dis. 2020;11:841–912. doi: 10.1038/s41419-020-03062-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib40] 40.Kim S. TMPRSS4, a type II transmembrane serine protease, as a potential therapeutic target in cancer. Exp. Mol. Med. 2023;55:716–724. doi: 10.1038/s12276-023-00975-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib41] 41.Li Q., Ye C., Tian T., Jiang Q., Zhao P., Wang X., Liu F., Shan J., Ruan J. The emerging role of ubiquitin-specific protease 20 in tumorigenesis and cancer therapeutics. Cell Death Dis. 2022;13:434–511. doi: 10.1038/s41419-022-04853-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib42] 42.Fischer A. Mechanism of the Proteolytic Activity of Malignant Tissue Cells. Nature. 1946;157:442. doi: 10.1038/157442c0. [DOI] [PubMed] [Google Scholar]

[bib43] 43.Park K.C., Dharmasivam M., Richardson D.R. The Role of Extracellular Proteases in Tumor Progression and the Development of Innovative Metal Ion Chelators That Inhibit Their Activity. Int. J. Mol. Sci. 2020;21:6805. doi: 10.3390/ijms21186805. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib44] 44.Hernandez L., Kim M.K., Noonan A.M., Sagher E., Kohlhammer H., Wright G., Lyle L.T., Steeg P.S., Anver M., Bowtell D.D., et al. A dual role for Caspase8 and NF-κB interactions in regulating apoptosis and necroptosis of ovarian cancer, with correlation to patient survival. Cell Death Discov. 2015;1:15053–15111. doi: 10.1038/cddiscovery.2015.53. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib45] 45.Montel V., Kleeman J., Agarwal D., Spinella D., Kawai K., Tarin D. Altered Metastatic Behavior of Human Breast Cancer Cells after Experimental Manipulation of Matrix Metalloproteinase 8 Gene Expression. Cancer Res. 2004;64:1687–1694. doi: 10.1158/0008-5472.CAN-03-2047. [DOI] [PubMed] [Google Scholar]

[bib46] 46.Houghton A.M., Grisolano J.L., Baumann M.L., Kobayashi D.K., Hautamaki R.D., Nehring L.C., Cornelius L.A., Shapiro S.D. Macrophage Elastase (Matrix Metalloproteinase-12) Suppresses Growth of Lung Metastases. Cancer Res. 2006;66:6149–6155. doi: 10.1158/0008-5472.CAN-04-0297. [DOI] [PubMed] [Google Scholar]

[bib47] 47.Cruz-Monserrate Z., Abd-Elgaliel W.R., Grote T., Deng D., Ji B., Arumugam T., Wang H., Tung C.-H., Logsdon C.D. Detection of pancreatic cancer tumours and precursor lesions by cathepsin E activity in mouse models. Gut. 2012;61:1315–1322. doi: 10.1136/gutjnl-2011-300544. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib48] 48.Khan S.U., Khan I.M., Khan M.U., Ud Din M.A., Khan M.Z., Khan N.M., Liu Y. Role of LGMN in tumor development and its progression and connection with the tumor microenvironment. Front. Mol. Biosci. 2023;10 doi: 10.3389/fmolb.2023.1121964. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib49] 49.Qi Q., Obianyo O., Du Y., Fu H., Li S., Ye K. Blockade of Asparagine Endopeptidase Inhibits Cancer Metastasis. J. Med. Chem. 2017;60:7244–7255. doi: 10.1021/acs.jmedchem.7b00228. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib50] 50.Shen L., Kang L., Wang D., Xun J., Chen C., Du L., Zhang M., Gong J., Mi X., Yue S., et al. Legumain-deficient macrophages promote senescence of tumor cells by sustaining JAK1/STAT1 activation. Cancer Lett. 2020;472:40–49. doi: 10.1016/j.canlet.2019.12.013. [DOI] [PubMed] [Google Scholar]

[bib51] 51.Guo X., Xue H., Shao Q., Wang J., Guo X., Chen X., Zhang J., Xu S., Li T., Zhang P., et al. Hypoxia promotes glioma-associated macrophage infiltration via periostin and subsequent M2 polarization by upregulating TGF-beta and M-CSFR. Oncotarget. 2016;7:80521–80542. doi: 10.18632/oncotarget.11825. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib52] 52.Chen P., Hsu W.-H., Chang A., Tan Z., Lan Z., Zhou A., Spring D.J., Lang F.F., Wang Y.A., DePinho R.A. Circadian Regulator CLOCK Recruits Immune-Suppressive Microglia into the GBM Tumor Microenvironment. Cancer Discov. 2020;10:371–381. doi: 10.1158/2159-8290.CD-19-0400. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib53] 53.Stadlbauer A., Kinfe T.M., Eyüpoglu I., Zimmermann M., Kitzwögerer M., Podar K., Buchfelder M., Heinz G., Oberndorfer S., Marhold F. Tissue Hypoxia and Alterations in Microvascular Architecture Predict Glioblastoma Recurrence in Humans. Clin. Cancer Res. 2021;27:1641–1649. doi: 10.1158/1078-0432.CCR-20-3580. [DOI] [PubMed] [Google Scholar]

[bib54] 54.Wälchli T., Bisschop J., Carmeliet P., Zadeh G., Monnier P.P., De Bock K., Radovanovic I. Shaping the brain vasculature in development and disease in the single-cell era. Nat. Rev. Neurosci. 2023:1–28. doi: 10.1038/s41583-023-00684-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib55] 55.Chen Z., Han F., Du Y., Shi H., Zhou W. Hypoxic microenvironment in cancer: molecular mechanisms and therapeutic interventions. Sig Transduct Target Ther. 2023;8 doi: 10.1038/s41392-023-01332-8. 70-23. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib56] 56.Pan L., Bai P., Weng X., Liu J., Chen Y., Chen S., Ma X., Hu K., Sun A., Ge J. Legumain Is an Endogenous Modulator of Integrin αvβ3 Triggering Vascular Degeneration, Dissection, and Rupture. Circulation. 2022;145:659–674. doi: 10.1161/CIRCULATIONAHA.121.056640. [DOI] [PubMed] [Google Scholar]

[bib57] 57.Ren Y.-C., Zhao Q., He Y., Li B., Wu Z., Dai J., Wen L., Wang X., Hu G. Legumain promotes fibrogenesis in chronic pancreatitis via activation of transforming growth factor β1. J. Mol. Med. 2020;98:863–874. doi: 10.1007/s00109-020-01911-0. [DOI] [PubMed] [Google Scholar]

[bib58] 58.Gabrusiewicz K., Li X., Wei J., Hashimoto Y., Marisetty A.L., Ott M., Wang F., Hawke D., Yu J., Healy L.M., et al. Glioblastoma stem cell-derived exosomes induce M2 macrophages and PD-L1 expression on human monocytes. OncoImmunology. 2018;7 doi: 10.1080/2162402X.2017.1412909. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib59] 59.Rébé C., Ghiringhelli F. STAT3, a Master Regulator of Anti-Tumor Immune Response. Cancers. 2019;11:1280. doi: 10.3390/cancers11091280. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib60] 60.Boussiotis V.A. Molecular and Biochemical Aspects of the PD-1 Checkpoint Pathway. N. Engl. J. Med. 2016;375:1767–1778. doi: 10.1056/NEJMra1514296. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib61] 61.Patsoukis N., Wang Q., Strauss L., Boussiotis V.A. Revisiting the PD-1 pathway. Sci. Adv. 2020;6 doi: 10.1126/sciadv.abd2712. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib62] 62.Khasraw M., Reardon D.A., Weller M., Sampson J.H. PD-1 Inhibitors: Do they have a Future in the Treatment of Glioblastoma? Clin. Cancer Res. 2020;26:5287–5296. doi: 10.1158/1078-0432.CCR-20-1135. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib63] 63.Reardon D.A., Brandes A.A., Omuro A., Mulholland P., Lim M., Wick A., Baehring J., Ahluwalia M.S., Roth P., Bähr O., et al. Effect of Nivolumab vs Bevacizumab in Patients With Recurrent Glioblastoma: The CheckMate 143 Phase 3 Randomized Clinical Trial. JAMA Oncol. 2020;6:1003–1010. doi: 10.1001/jamaoncol.2020.1024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib64] 64.Peranzoni E., Lemoine J., Vimeux L., Feuillet V., Barrin S., Kantari-Mimoun C., Bercovici N., Guérin M., Biton J., Ouakrim H., et al. Macrophages impede CD8 T cells from reaching tumor cells and limit the efficacy of anti–PD-1 treatment. Proc. Natl. Acad. Sci. USA. 2018;115:E4041–E4050. doi: 10.1073/pnas.1720948115. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib65] 65.Lee J., Nicosia M., Hong E.S., Silver D.J., Li C., Bayik D., Watson D.C., Lauko A., Kay K.E., Wang S.Z., et al. Sex-Biased T-cell Exhaustion Drives Differential Immune Responses in Glioblastoma. Cancer Discov. 2023;13:2090–2105. doi: 10.1158/2159-8290.CD-22-0869. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib66] 66.Bayik D., Zhou Y., Park C., Hong C., Vail D., Silver D.J., Lauko A., Roversi G., Watson D.C., Lo A., et al. Myeloid-Derived Suppressor Cell Subsets Drive Glioblastoma Growth in a Sex-Specific Manner. Cancer Discov. 2020;10:1210–1225. doi: 10.1158/2159-8290.CD-19-1355. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib67] 67.Pang L., Dunterman M., Xuan W., Gonzalez A., Lin Y., Hsu W.-H., Khan F., Hagan R.S., Muller W.A., Heimberger A.B., Chen P. Circadian regulator CLOCK promotes tumor angiogenesis in glioblastoma. Cell Rep. 2023;42 doi: 10.1016/j.celrep.2023.112127. [DOI] [PMC free article] [PubMed] [Google Scholar]

[bib68] 68.Bowman R.L., Wang Q., Carro A., Verhaak R.G.W., Squatrito M. GlioVis data portal for visualization and analysis of brain tumor expression datasets. Neuro-Oncology. 2017;19:139–141. doi: 10.1093/neuonc/now247. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Hypoxia-driven protease legumain promotes immunosuppression in glioblastoma

Lizhi Pang

Songlin Guo

Fatima Khan

Madeline Dunterman

Heba Ali

Yang Liu

Yuyun Huang

Peiwen Chen

Summary

Graphical abstract

Highlights

Introduction

Results

LGMN is highly expressed in TAMs in GBM

Figure 1.

HIF1α upregulates LGMN expression in macrophages

Figure 2.

LGMN is essential for macrophage immunosuppressive polarization in GBM

Figure 3.

LGMN regulates macrophage immunosuppressive polarization by activating the GSK-3β-STAT3 pathway

Figure 4.

Inhibition of the HIF1α-LGMN axis in macrophages impairs GBM progression

Figure 5.

Targeting HIF1α-LGMN axis improves the efficacy of anti-PD1 therapy in GBM

Figure 6.

Discussion

Limitations of the study

STAR★Methods

Key resources table

Resource availability

Lead contact

Materials availability

Experimental model and subject details

Cell culture

Mice and intracranial xenograft tumor models

Human samples

Method details

Isolation of BMDMs

Plasmids and viral transfections

Bone marrow chimera generation

Proliferation assay

Apoptosis analysis

Tumorsphere formation assay

Immunofluorescence

Quantitative real-time PCR (RT-qPCR)

ChIP-PCR

Human phospho-kinase array

Immunoblotting

Flow cytometry

Computational analysis of human GBM datasets

Quantification and statistical analysis

Acknowledgments

Author contributions

Declaration of interests

Footnotes

Supplemental information

Data and code availability

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases