Improved Culture Methods for Human Coronaviruses HCoV-OC43, HCoV-229E, and HCoV-NL63

Abstract

HCoV-OC43, HCoV-229E, HCoV-NL63, and HCoV-HKU1 are four of the seven known human coronaviruses (HCoVs) and, unlike the highly pathogenic SARS-CoV, MERS-CoV, and SARS-CoV-2, these four so-called seasonal HCoVs generally causemild upper-respiratory-tract illness. As Biosafety Level 2 (BSL-2) pathogens, the seasonal HCoVs are more accessible and can be used as surrogates for studying the highly pathogenic HCoVs. However, scientists have for many years found these difficult to study because of the lack of a universal culture system and the inability of typical culture methods to yield high-titer infectious stocks. We have developed assays to grow and quantify infectious virus and viral RNA for HCoV-OC43, -229E, and -NL63. We identified which immortalized cell lines should be used to optimize the replication of HCoV-OC43, -229E, and -NL63 in order to generate high titers (Vero E6, Huh-7, and LLC-MK2 cells, respectively). Here we present protocols for improved propagation and quantification of each seasonal HCoV.

Basic Protocol 1: Growth of HCoVs

Basic Protocol 2: Quantification of HCoV by Plaque Assay

Basic Protocol 3: Quantification of HCoV RNA Products of Replication

Basic Protocol 4: Concentrating HCoVs via Ultracentrifugation

INTRODUCTION:

Human coronaviruses (HCoVs) are important human respiratory pathogens that were first identified as circulating in the human population during the 1960s (Weiss & Leibowitz, 2011). HCoV-229E and -OC43 were the first two HCoVs identified, followed by the highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) in 2002 (Bucknall et al., 1972). Later, two more HCoVs were identified, HCoV-NL63 in 2004 and HCoV-HKU1 the following year (Van Der Hoek et al., 2004; Woo et al., 2005). Of these five HCoVs, SARS-CoV was the only highly pathogenic HCoV until theemergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 and then SARS-CoV-2, the causative agent of coronavirus disease 2019 (COVID-19), in late 2019 (Li et al., 2021; Otter et al., 2023). Unlike SARS-CoV, MERS-CoV, and SARSCoV-2, which are associated with severe respiratory disease, HCoV-229E, -OC43, -NL63, and -HKU1 generally cause mild to moderate upper-respiratory-tract disease, though they can also cause more severe disease in at-risk populations, such as the elderly, the immunocompromised, and young children (Liu et al., 2020). Collectively, HCoV-229E, -OC43, -NL63, and -HKU1 are referred to as the seasonal HCoVs.

For many years, the common HCoVs were neglected due to their low pathogenicity and poor replication in immortalized cell lines, as well as the lack of a universal culture system. To date, HCoV-HKU1 remains very difficult to grow in tissue culture (Liu et al., 2020). The recent emergence of SARS-CoV-2 highlighted the importance of understanding the pathogenesis of HCoVs, including the seasonal HCoVs. Due to their less pathogenic nature, the seasonal HCoVs serve as comparators for the highly pathogenic HCoVs, such as SARS-CoV-2, to facilitate our understanding of what common or unique factors contribute to virulence. Research utilizing the seasonal HCoVs is more accessible as they have been categorized as Biosafety Level-2 (BSL-2) pathogens, not requiring the use of high-containment facilities.

Seasonal HCoV research has remained primarily restricted to prevalence and disease association studies because current virus culture systems often do not produce sufficient virus for in vitro assays. The ability to produce high-viral-titer stocks of seasonal HCoVs would facilitate the investigation of common HCoVs. Culture methods and quantification protocols for HCoV-OC43, -229E, and -NL63 have been described. Many of these reports recommend performing assays involving the seasonal HCoVs at 37°C and using alternative cell lines not discussed here (Bracci et al., 2020; Woo et al., 2005).

We have optimized the parameters for the growth of each seasonal HCoV at 33°C, the temperature of the human upper airway, resulting in high viral yields. We have recently reported that infections conducted at 33°C vs. 37°C, reflective of temperatures in the upper and lower airway, revealed that replication of HCoV-NL63 and -229E is significantly attenuated at 37°C (Otter et al., 2023). Additionally, the seasonal HCoVs were isolated at temperatures lower than 37°C (Bucknall et al., 1972; Liu et al., 2020; van der Hoek et al., 2006). Here, we describe optimized methods for growing (Basic Protocol 1), quantifying (Basic Protocols 2 and 3), and concentrating (Basic Protocol 4) HCoV-OC43, -229E, and -NL63 in vitro.

CAUTION: HCoV-OC43, −229E, and -NL63 are Biosafety Level 2 (BSL-2) pathogens. Follow all appropriate guidelines and regulations for the use and handling of pathogenic microorganisms.

BASIC PROTOCOL 1

Basic protocol title:

Growth of HCoVs

Introductory paragraph:

Viral stocks of HCoV-OC43, −229E, or -NL63 to be used for in vitro assays are typically produced via the infection of cell lines and collection of supernatants. Figure 1A is a schematic figure of the workflow for this protocol. HCoV-OC43, −229E, and -NL63 productively infect Vero E6, Huh-7, and LLC-MK2 cells, respectively (Nguyen et al., 2022; Otter et al., 2023). The observation of cytopathic effect (CPE) and/or morphological changes indicate infectious virus growth (Thomas Albrecht, 1996). Figure 1B depicts the expected CPE for HCoV-OC43, −229E, and - NL63.

Figure 1.

Basic Protocol 1 schematic workflow and HCoV cytopathic effect (CPE).

(A) Graphical protocol overview for the propagation of HCoV-OC43, −229E, or -NL63 in cell culture; created with Biorender.com. (B) Indicated cells were infected with HCoV- OC43, −229E, or -NL63 at an MOI of 0.01 and incubated at 33°C. The presence of cytopathic effect (CPE) was monitored by microscopy.

Materials:

HCoV-OC43 (ATCC VR-1558), HCoV-229E (ATCC VR-740), or HCoV-NL63

Vero E6 (ATCC CRL-1586), Huh-7, or LLC-MK2 cells (ATCC CCL-7)

Vero E6 cell, Huh-7 cell, or LLC-MK2 cell growth medium (CGM; see recipe)

1× PBS, pH 7.4 (GibcoTM 10010031)

Dulbecco’s Modified Eagle Medium containing 2% FBS (DMEM; GibcoTM 11966025) or MEM-alpha containing 2% FBS (GibcoTM 12571048)

50-ml High Clarity Conical Centrifuge Tubes (FalconTM 352070)

Class II biological safety cabinet

15-in. cell scrapers (FisherbrandTM 08-100-242)

175-cm2 (T-175) TC Treated Suspension Cell Culture Flasks with Filter Screw Cap (Greiner Bio-One 07-000-666)

CO₂ incubator set to 33°C and 5% CO₂

1.5-ml Eppendorf Safe-Lock microcentrifuge tubes (Eppendorf, 0030123611)

Costar^® 10- and 25-ml Stripette^® Serological Pipets (7536R37 and 7536R42)

Pipet-Aid

10-, 20-, 200-, and 1000-μl pipets and tips

CO₂ incubator set to 37°C and 5% CO₂

Protocol steps with step annotations:

Day prior to infection:

• 1Seed ~5 × 10⁶ cells of the appropriate cell line in 20 ml of appropriate cell growth medium (see Table 1) in a T-175 flask on the day before infection.

  We recommend that cells used be below passage 30 and ~80–85% confluent in each flask. If cells are <80% confluent, it is best to wait an additional day before starting the assay.

• 2Incubate the T-175 flasks in a 37°C incubator overnight.

Table 1.

Respective cell lines for HCoV growth

HCoV	Cell Line	Cell Growth Media (CGM)
HCoV-OC43	Vero E6	Vero E6 CGM
HCoV-229E	Huh-7	Huh-7 CGM
HCoV-NL63	LLC-MK2	LLC-MK2 CGM

The titer of viral stocks varies from lot to lot when purchased from the ATCC or another manufacturer. Make sure you identify your viral stock’s initial titer before beginning. The titer is typically found on the Certificate of Analysis.

Day of infection:

• 3Before infecting cells, remove medium and rinse cells with 1× PBS.

  Infections should be started when the T-175 is ~80–85% confluent.

• 4Make an HCoV inoculum at amultiplicity of infection (MOI) equal to 0.01 PFU/cell of the desired HCoV in 5 ml of appropriate medium with 2% FBS.

  Example calculation:

  Stock titer = 1×10⁶ PFU/ml; number of cells = 1 × 10⁶ cells/well (5 × 10⁶ cells/flask).

  To achieve 0.01 MOI, use (5 × 10⁶ cells/flask × 0.01)/(1 × 10⁶ PFU/ml) = 0.01 ml/flask.

  (1×10⁶ cells/ml × 0.01) / (1×10⁶ PFU/ml) = 0.01ml/well

  If the titer is lower than needed, it is recommended that you expand the viral stock.

  This can be done following this protocol but, instead of using anMOI of 0.01, inoculating the flasks with 100–200 μl HCoV stock diluted in 5 ml of medium containing 2% FBS.

• 5After inoculation, incubate the T-175 flask at 33°C for 1 hr.

  Rock the flask every 15 min to ensure the viral inoculum is in contact with all cells in the flask for absorption.

• 6Remove inoculum gently with a serological pipet, feed back 20 ml of roomtemperature medium (DMEM/2% FBS for HCoV-OC43 and -229E or MEMalpha/2% FBS for HCoV-NL63 stocks) into the flask, and incubate the flask at 33°C until significant CPE is visible or until the day of harvest.

  See Figure 1B for examples of CPE: top three panels, HCoV-OC43 CPE; middle three panels, HCoV-229E CPE; bottom three panels, HCoV-NL63.

• 7Table 2 lists the typical harvest day for each HCoV; ~80%–90% of cells should exhibit CPE on the day of harvest.

Table 2.

Respective harvest day following infection for each HCoV

HCoV	Harvest Day-Days Post Infection (dpi)
HCoV-OC43	4–5 dpi
HCoV-229E	3 dpi
HCoV-NL63	6–7 dpi

Day of Collection:

• 8On the day of harvest, scrape HCoV-infected cells off the flask into the medium still present using a sterile 15-in. cell scraper.
• 9Using a 10-ml serological pipet, rinse the cells off the flask surface and transfer cells and medium into a labeled 50-ml conical tube.
• 10Spin the virus-containing 50-ml conical tube for 10 min at ≥200 × g, 4°C.
• 11Place 45 ml of the viral supernatant into a fresh 50-ml conical and place the tube on ice.
• 12Vortex the remaining 5 ml of supernatant and the cell pellet.

  Vortex until pellet is resuspended.

• 13Freeze the conical with the resuspended 5 ml of supernatant and cell pellet at −80°C or using a mixture of dry ice and ethanol.

  Once fully frozen the conical will be opaque, about 15 minutes.

• 14Thaw frozen conical tube in a 37°C water bath until just thawed.

  Thaw for ~5–15 min.

• 15Repeat this freeze-thaw cycle two more times.
• 16After completing three freeze-thaw cycles, spin the thawed supernatant containing the cell pellet for 5 min at 1800 × g, 4°C.
• 17Transfer the centrifuged supernatant to the conical tube containing the other 45 ml of the supernatant that is on ice (from step 10).
• 18Dispose of the cell pellet by adding bleach and incubate at room temperature for ~30 min before discarding.
• 19Divide HCoV stock into 200-μl aliquots in 1.5-ml screw-cap tubes and store at −80°C.

  Do not aliquot less than 100 μL to avoid sublimation of the HCoV at −80°C.

• 20Determine titer by plaque assay (see Basic Protocol 2). See Table 3 for expected titers.

Table 3.

Expected titers for each HCoV

HCoV	Expected Titer
HCoV-OC43	~106–107 PFU/mL
HCoV-229E	~107 PFU/mL
HCoV-NL63	~105 PFU/mL

BASIC PROTOCOL 2:

Basic protocol title:

Quantification of HCoVs by Plaque Assay

Introductory paragraph:

Plaque assays are commonly used to measure the concentration of infectious virus (Payne, 2017). However, these can only be used for the subset of viruses that cause the formation of distinct plaques (or clearings) on a monolayer of cells in a cell culture plate. There are three key steps needed for plaque assays: (1) before plaque assay, seed the cells into culture plates, (2) infect with serial 10-fold dilutions of the virus stock or sample being titrated, and (3) after adsorption, add an immobilizing liquid overlay that covers the cell monolayer to prevent virus spread and restrict virus growth to foci of cells. The concentration of infectious virus in a sample is measured in plaque-forming units per ml (PFU/ml). Figure 2A provides a schematic depiction of the workflow.

Figure 2.

Basic Protocol 2 schematic workflow, overlay comparison, and schematic of expected results.

(A) Graphical overview of the protocol for plaquing HCoV-OC43, -229E, or -NL63; figure created with Biorender.com. (B) Indicated cells were infected with indicated HCoV samples, serially diluted, and overlaid with liquid overlay. Plaque assays were fixed 5, 3, or 6 days post infection for HCoV-OC43, -229E, or -NL63, respectively. Plaque assays were fixed with 4% PFA and stained with 1% crystal violet to visualize plaques. (C) Schematic representation of negative and expected plaque assay results; figure created with Biorender.com.

Materials:

HCoV-OC43, HCoV-229E, or HCoV-NL63 samples or stock from Basic Protocol 1

Vero E6 (ATCC CRL-1586), Huh-7, or LLC-MK2 cells (ATCC CCL-7)

Vero E6, Huh-7, or LLC-MK2 cell growth medium (CGM; see recipe)

0.05% trypsin (GibcoTM 25300054)

Dulbecco’s Modified Eagle Medium containing 2% FBS (DMEM; GibcoTM 11966025) or MEM-alpha containing 2% FBS (GibcoTM 12571048)

Liquid overlay (see recipe)

4% paraformaldehyde (PFA) in PBS (AAJ19943K2)

1% (w/v) crystal violet (see recipe)

50-ml High Clarity Conical Centrifuge Tubes (FalconTM 352070)

175-cm2 (T-175) TC Treated Suspension Cell Culture Flasks with Filter Screw Cap (Greiner Bio-One 07-000-666)

CO₂ incubator set to 37°C and 5% CO₂

1.5-ml Eppendorf Safe-Lock microcentrifuge tubes (Eppendorf 0030123611)

Costar^® 10- and 25-ml Stripette^® Serological Pipets (7536R37 and 7536R42)

Pipet-Aid

10-, 20-, 200-, and 1000-μl pipets and tips

CO₂ incubator set to 33°C and 5% CO₂

CorningTM CostarTM 6-well or 12-well Clear TC-treated Multiple Well Plates (07-200-83 or 07-200-82)

VWR Scientific TW-26 White Light Transilluminator

Protocol steps with step annotations:

Day prior to plaque assay:

• 1Seed plates for plaque assay with the appropriate cell line (see Table 4 1 day before infection.
• 2Trypsinize confluent T175 flasks of cells using 0.05% Trypsin (~23.3×10⁶ cells per flask)
• 3Resuspend cells in CGM for the respective cell line, consulting Table 5 regarding how many cells to seed per well. The total volume in each well should be 2 ml for 6-well plates or 1 ml for 12-well plates.
• 4When seeding cells the total volume of each well should be 2 mL for 6-well plates or 1 mL for 12-well plates.

  Mix cells well with medium by rocking plates before placing into incubator.

• 5Place plates in 37°C incubator overnight until infection the next day.

  For plaque assays, the desired confluency of cells should be ~80%–85% per well. If cells are <80% confluent, it’s best to wait an additional day before starting the assay.

Table 4.

Respective cell lines for HCoV plaque assays

HCoV	Cell Line for Plaque Assays
HCoV-OC43	Vero E6
HCoV-229E	Huh-7
HCoV-NL63	LLC-MK2

Table 5.

Seeding Density for HCoV plaque assays

Plate	Seeding Density
6-well	3 × 105 cells/well
12-well	1 × 105 cells/well

Day of plaque assay:

• 6Prepare 1:10 serial dilutions of HCoV sample in an appropriate medium containing 2% FBS: DMEM for HCoV-OC43 or -229E, or MEM-alpha for HCoV-NL63. Each dilution should be plated in technical duplicates for accuracy.

  The purpose of making and testing serial dilutions is to achieve a “countable” number of plaques in the cell monolayer. Recommended dilution range: 10⁻¹ to 10⁻⁶. Make 2.5X the volume needed for each sample to allow for plating in technical duplicates.

• 7When ready to infect the cells, aspirate medium from the wells of the plates seeded the day before.
• 8Infect using desired serial dilutions at the volume recommended in Table 6.
• 9Incubate at 33°C for 1 hr. During this incubation period, warm the liquid overlay to room temperature (see recipe).

  Rock plates every 15 minutes to ensure the viral inoculum is in contact with all cells in the well.

• 10After 1 hr, add the appropriate volume of liquid overlay (see Table 6 to the infected plate wells; do not remove inoculum from wells.
• 11Incubate plates at 33°C for the length of time indicated in Table 7.

Table 6.

Volumes of Sample and Liquid Overlay for Each HCoV Sample Dilution

Plate	Sample volume	Liquid overlay volume
6-well	0.2 ml	3 ml
12-well	0.1 ml	2 ml

Table 7.

Plaque assay incubation period for HCoVs

HCoV	Incubation
HCoV-OC43	4–5 days
HCoV-229E	3 days
HCoV-NL63	5–6 days

Day of fixation:

• 12After the incubation period is over, aspirate liquid overlay from the wells.
• 13Add 4% paraformaldehyde (PFA) in PBS to each well in the plaque assay plate.

  For 6-wells add a total of 4 mL of 4% PFA per well; for 12-well plates add a total of 3 mL of 4% PFA per well.

• 14After 30 minutes of fixation, remove 4% PFA, dispose accordingly, and stain with 1% crystal violet for 5 minutes.

  For 6-wells add a total of 1 mL of 1% crystal violet per well; for 12-well plates add a total of 0.5 mL of 1% crystal violet per well.

• 15Remove 1% crystal violet by inverting the plate over a sink.
• 16Rinse plates with water, air dry plates, and then count visible plaques using a Light Transilluminator.
• 17See Figure 2B for plaque morphology using liquid overlay and Figure 2C for illustrated negative and expected results.
• 18Calculate virus titer with the following equations; see Table 8 for sample calculations.

  6-well: (# of plaques*dilution factor)/0.2 ml = titer PFU/ml

  12-well: (# of plaques*dilution factor)/0.1 ml = titer PFU/ml

• 19Sample Calculation:

Table 8.

Primer Sequences for detection of N protein, RdRp, or 18S mRNA

HCoV-OC43		Sequence (5’->3’)	Annealing temp
N	Forward:	TACGGCACCGATATTGACGG	60°C
	Reverse:	GTGCGCGAAGTAGATCTGGA
RdRp	Forward:	GAGTGTAGATGCCCGTCTCG	57°C
	Reverse:	ATCAACACGCTGAAAACGGC
HCoV-229E
N	Forward:	GGCAAACGGGTGGATTTGTC	60°C
	Reverse:	CGCCTAACACCGTAACCTGT
RdRp	Forward:	TTGACTGTTACGAGGGTGGC	60°C
	Reverse:	GGCCAACCAGCGCTTTTATT
HCoV-NL63
N	Forward:	CCGATGACAGAGCTGCTAGG	60°C
	Reverse:	AGGCAAATCAACACGTTGCC
RdRp	Forward:	CTTCTTCCCCAGCACTCGTT	60°C
	Reverse:	AGCATCACCATTCTGTGCGA
Host Housekeeping gene
18S	Forward:	TTCGATGGTAGTCGCTGTGC	65°C
	Reverse:	CTGCTGCCTTCCTTGAATGTGGTA

6-well Counted Plaques:	12-well Counted Plaques:
10−1 = uncountable 10−2 = uncountable 10−3 = 145 (uncountable) 10−4 = 16 plaques 10−5 = 2 plaques	10−1 = uncountable 10−2 = uncountable 10−3 = 75 (uncountable) 10−4 = 28 plaques 10−5 = 3 plaques
10 −6 = 0 plaques	10 −6 = 0 plaques
(# of plaques*dilution factor) / 0.2mL = titer PFU/mL	(# of plaques*dilution factor) / 0.1mL = titer PFU/mL
16*104) / 0.2mL = 8 × 105 PFU/mL	(28*104) / 0.1mL = 2.8 × 10 PFU/mL

BASIC PROTOCOL 3:

Basic protocol title:

Quantification of HCoV RNA Products of Replication

Introductory paragraph:

HCoVs are enveloped positive-sense single-stranded RNA viruses with genomes ~30 kb in size (Weiss & Navas-Martin, 2005). The 5′ end consists of two overlapping open reading frames that encode polyproteins (ORF1a and ORF1b), while the 3′ end consists of the structural spike (S), envelope (E), membrane (M), and nucleocapsid (N) and lineagespecific accessory proteins. In brief, the genomic RNA (gRNA) is translated to produce the polyproteins that are post-translationally processed by virally encoded proteases to produce 16 nonstructural proteins (nsps). Structural and accessory proteins are translated from a set of nested subgenomic mRNAs (sgmRNAs;Weiss&Leibowitz, 2011). Reverse transcription–quantitative PCR (RT-qPCR) can be utilized for virus detection and quantification. Here we use RT-qPCR to detect and quantify HCoV gRNA. For this assay, we have designed primer sets specific to the N protein and the RNA-dependent RNA polymerase (RdRp) genes within nsp12, shown in Table 9. We utilize the host housekeeping gene 18S in analysis to normalize variable levels of total RNA between samples, which is particularly important in infected samples because total RNA yield can be quite variable.

Table 9.

Sample calculation for RdRp mRNA expression

Average Experimental Ct Value	Average Experimental Ct Value	Average Control Ct Value	Average Control Ct Value
TE - RdRp	HE – 18S	TC - RdRp	HC – 18S
18.6	4.9	30.6	4.5
TE- HE	18.6 – 4.9 =	13.7
TC - HC	30.6 – 4.5 =	26.1
ΔCt Value (Experimental)	ΔCtValue (Control)
ΔCTE	ΔCTC
13.7	26.1
ΔCTE – ΔCTC	13.7 – 26.1 =	−12.4
ΔΔCt Value
ΔΔCt
1.5
2−ΔΔCt		2-(−12.4) =	5404.7
RdRp Expression Fold Change
2−ΔΔCt
5404.7

Materials:

HCoV-OC43 (ATCC VR-1558), HCoV-229E (ATCC VR-740), or HCoV-NL63

Dulbecco’s Modified Eagle Medium containing 2% FBS (DMEM; GibcoTM 11966025) or MEM-alpha containing 2% FBS (GibcoTM 12571048)

1× PBS, pH 7.4 (GibcoTM 10010031)

RNA extraction reagent or kit (Qiagen 74004)

cDNA synthesis kit (Applied BiosystemsTM 4368814)

iQTM SYBR^® Green Supermix (Bio-Rad 1708880) Primer sets (see Table 9)

CO₂ incubator set to 33°C and 5% CO₂

Cell-culture-grade plates or flasks

Benchtop centrifuge (EppendorfTM Model 5810R Centrifuge)

Optical 96-well plate for PCR (Applied BiosystemsTM 4481192)

Optical adhesive film (Applied BiosystemsTM 4311971)

qPCR machine (recommended: QuantStudioTM 3 Real-Time PCR System, 96-well, 0.2 ml, desktop, Applied BiosystemsTM A31669, or equivalent)

Protocol steps with step annotations:

Prior to infection:

• 1HCoV-infected samples can be obtained by a simple infection of the desired cell line with one of the three HCoVs. Seed cells for infection 1 day before the infection.We recommend performing infections in triplicate and including mock-infected cells as a negative control.

  We typically perform our infections at an MOI of 1 or 5 in 12-well plates with cells at 85–90% confluence.

Day of infection:

• 2Follow Basic Protocol 1, steps 3-6, making sure to modify the MOI. For mockinfected plates, inoculate wells with the corresponding medium.
• 3After infection, place HCoV-infected and mock-infected cells in a 33°C incubator until the day of RNA collection.

Day of Collection:

• 4Aspirate or collect supernatants from HCoV-infected and mock-infected cells.

  We recommend you collect and quantify supernatant samples to titer and confirm viral replication for the infection following Basic Protocol 2. Samples can be frozen and stored at −80°C.

• 5Extract RNA from the HCoV-infected and mock-infected samples according to the instructions provided with the RNA extraction kit.

  We have successfully extracted RNA by utilizing Qiagen RNeasy^® plus Micro Kit at various time points (i.e. 24, 48, 72 hpi).

Create cDNA from extracted RNA samples

• 1Synthesize cDNA from the extracted RNA samples according to the instructions for a cDNA Reverse Transcription Kit.

  We utilize Applied Biosystems^™ High-Capacity cDNA Reverse Transcription Kit for cDNA synthesis and follow the instructions provided.

• 2Set up reactions containing cDNA, PCR master mix (i.e., iQTM SYBR^® Green Supermix), desired primer set from Table 9, and water in an optical 96-well plate.

  Master mix for negative control: mock-infected cDNA, iQ^™ SYBR^® Green Supermix, 18S forward and reverse primers, and water

  Master mix for HCoV-infected samples: HCoV-infected cDNA, iQ^™ SYBR^® Green Supermix, HCoV forward and reverse primers, and water

• 3Seal 96-well with an optical-grade adhesive film that is compatible with your qPCR instrument.
• 4Centrifuge the plate 1 min at ≥200 × g, room temperature.
• 5
  Run the prepared 96-well plate on a qPCR machine using the following parameters:

  • Initial step: 3 min 95°C (denaturation)
  • 40 cycles: 15 sec 95°C (extension)
  • 30 sec 60°C (annealing)
  • 1 min 65°C (extension)
  • Final step: 6 sec 95°C (dissociation)

  The annealing temperature should be appropriate for the primer set of choice. Temperature and cycle time run parameters may vary with different qPCR reagents, so follow the instructions provided with the reagent.

Analysis:

• 6Calculate the relative expression of the gene of interest by averaging the technical replicates for each sample (Livak&Schmittgen, 2001). This should be done for both the housekeeping gene (18S) and the viral gene being measured (N or RdRp).
• 7Subtract the Ct value of the housekeeping gene from the Ct value of the viral gene. This represents ΔCt. The Ct values used should be the averages obtained in step 11.

  We recommend performing similar analysis on mock-infected samples. Relative expression values fpr mock-infected samples should be significantly lower than those for experimental samples.

• 8Calculate 2(-DELTACt). This is your relative gene expression.

BASIC PROTOCOL 4:

Basic protocol title:

Concentrating HCoVs via Ultracentrifugation

Introductory paragraph:

Ultracentrifugation is a technique that can be used to concentrate viruses from aqueous solutions. Ultracentrifugation has proven particularly useful in working with the common cold HCoVs, as traditional propagation techniques often fail to produce viral stocks with titers sufficient for many in vitro assays. Here we present a sucrose cushion ultracentrifugation protocol to concentrate HCoVs. Sucrose cushion ultracentrifugation is a technique that allows for the separation of enveloped viruses and macromolecules. Separation is achieved by the virus mixture being pelleted through a 20% sucrose layer. Figure 4A depicts a schematic of the workflow described here.

Figure 4.

Basic Protocol 4 schematic workflow and concentrated HCoV-NL63 plaque assay.

(A) Graphical protocol overview for concentrating HCoV-OC43, −229E, or -NL63 utilizing Basic Protocol 4; created with Biorender.com. (B) LLC-MK2 cells were infected with concentrated HCoV-NL63 serially diluted and overlaid with Liquid Overlay. The plaque assay was fixed with 4% PFA for 30 minutes at 6-days post-infection. Plaques were then visualized following staining with 1% crystal violet.

Materials:

HCoV-containing medium (HCoV stock; Basic Protocol 1)

70% (v/v) ethanol (EtOH; see recipe)

DEPC-treated water (InvitrogenTM AM9922)

20% sucrose (see recipe)

Resuspension buffer (see recipe)

38.5-ml Open-Top Thinwall Ultra-Clear Tube (Beckman Coulter 344058)

SW 32 Ti Swinging-Bucket Rotor (Beckman Coulter 369650)

Optima XE Ultracentrifuge (B10049)

10-G metal hub needle, point style 4 (7749-01), autoclaved

5-ml sterile Luer-Lok syringe (BH Supplies C-BH5LL)

Ranger 3000TM Compact Bench Scale (OHAUSTM 30031708)

ParafilmTM M Wrapping Film (S37440)

1.5-ml Eppendorf Safe-Lock microcentrifuge tubes (Eppendorf, 0030123611)

Costar^® 10- and 25-ml Stripette^® Serological Pipets (7536R37 and 7536R42)

BVC aspirator system (CLS-900-100)

Protocol steps with step annotations:

Prior to ultracentrifugation:

• 1Prepare ~200mL total HCoV-containing media (HCoV stock).

  Approximately 10 T-175 flasks of virus each, this can be obtained following Basic Protocol 1.

Day of ultracentrifugation:

• 2Place a plastic ultracentrifuge tube in each ultracentrifuge rotor bucket.
• 3Sterilize sample tubes by adding 30 mL of 70% EtOH to each tube.
• 4Close tubes with their respective caps and shake briefly. Let the tube sit for 2 min.
• 5Pour off the 70% EtOH and add 30 mL of DEPC-Treated Water.
• 6Close the tubes and shake briefly, pour off the DEPC-Treated Water.
• 7Repeat steps 3–5 two more times.
• 8Add ~30–33 ml HCoV stock (from step 1) to each plastic ultracentrifuge tube.

  Leave a small amount of space to add more media when balancing. If not filling all tubes with HCoV stock, fill any unused tubes with serum-free media.

• 9Add 5 mL of 20% sucrose to each tube using an autoclaved metal needle and a 5 mL syringe.

  Touch the bottom of the tube, then dispense slowly to create the cushion – you should see a clear sucrose layer underneath the virus-containing media. Remove the needle slowly to not disturb the layers.

• 10Weigh each tube with its respective cap on a scale and note each tube’s weight. Balance tubes if needed by adding virus-containing media or serum-free media.

  Generally, pick the heaviest tube to be the standard weight. Bring up the other tubes to the same weight, ±0.01 grams.

• 11Centrifuge at 26,000 RPM for 2–3 hours at 4°C.

  This protocol has been optimized using a SW 32 Ti Swinging-Bucket Rotor and Optima XE Ultracentrifuge (B10049). Select the appropriate rotor you are using according to its serial number.

• 12Remove plastic tubes from rotor buckets and use an aspirator to remove the medium down to the sucrose cushion.

  The top of the sucrose cushion will be pink; remove as much of that as possible, but do not disturb the pellet.

• 13Pour off the remaining sucrose and set the tube upside down for 1 minute on a paper towel.
• 14Gently add 500 μL of Resuspension buffer to the tube being careful not to disturb the pellet.
• 15Seal each tube in parafilm and place in an ice bucket overnight at 4°C.
• 16The next morning, gently resuspend the pellets.

  Resuspend the pellets using P1000 tips as they are larger and decrease shearing force when pipetting.

• 17The volume of the stock can be increased by resuspension buffer. This is dependent on the original titer. A degree of concentration of 1:100 is typically recommended.

  Combine the volume from all ultracentrifuged tubes of virus and mix thoroughly to ensure a homogenous mixture and consistent titer.

• 18Divide virus into aliquots in 1.5-ml microcentrifuge tubes. Do not aliquot <100 μl to avoid sublimation of the HCoV at −80°C.
• 19Freeze aliquots at −80°C for ≤ 6 months.
• 20Fill empty ultracentrifuge buckets with 30ml of 70% EtOH. Invert a few times and empty. Repeat once more and then let buckets air dry.
• 21Determine the titer by plaque assay. Calculate virus titer. See Figure 4B for plaque assay depicting the titer of concentrated HCoV-NL63.
• 22See Table 10 for expected titers. See Basic Protocol 2, step 17, for an example of how to calculate titer.

Table 10.

Expected titers for each HCoV

HCoV	Expected Titer
HCoV-OC43	~108 PFU/mL
HCoV-NL63	~106−7 PFU/mL

REAGENTS AND SOLUTIONS:

Vero E6 cell growth media (1 liter)

• 890 mL Dulbecco’s Modified Eagle Medium (DMEM) (Gibco^™ 11966025)

• 100 mL Heat-inactivated (HI) HyClone Characterized Fetal Bovine Serum (FBS) (SH30071.03)

• 10 mL Penicillin and streptomycin (1X) (Gibco, 10378016)

• Store at 4°C for ≤ 6 months.

  Optional: After addition of all reagents, filter sterilize media using Stericup^® vacuum filter (C3240).

Huh-7 cell growth media (1 liter)

• 870 mL Dulbecco’s Modified Eagle Medium (DMEM) (Gibco^™ 11966025)

• 100 mL HI FBS (SH30071.03)

• 10 mL Penicillin and streptomycin (Gibco^™ 10378016)

• 10 mL 100X MEM Non-Essential Amino Acids (NEAA) (Gibco^™ 11140050)

• 10 mL GlutaMAX^™ Supplement (Gibco^™ 35050079)

• Store at 4°C for ≤ 6 months.

  Optional: After addition of all reagents, filter sterilize media using a Stericup^® vacuum filter (C3240).

LLC-MK2 cell growth media (1 liter)

• 890 mL Minimum Essential Medium Alpha (MEM-alpha) (Gibco^™ 12571048)

• 100 mL HI FBS (SH30071.03)

• 10 mL Penicillin and streptomycin (1X) (Gibco^™ 10378016)

• Store at 4°C for ≤ 6 months.

  Optional: After addition of all reagents, filter sterilize media using a Stericup^® vacuum filter (C3240).

2% FBS cell growth media (0.5 liter)

• 490 mL DMEM (Gibco^™ 11966025) or MEM-alpha (Gibco^™ 12571048)

• 10 mL HI FBS (SH30071.03)

1.4% sterile agarose (0.5 liter)

• 7g of UltraPure^™ Agarose (Invitrogen^™16500500)

• 500 mL milliQ water

• Store at room temperature for ≤ 6 months.

  Autoclave for 30 minutes on liquid cycle for sterilization. Before each use, heat until completely liquid in the microwave, (approximately 1 minute per 100 mL). Remember to loosen cap when heating. Keep in a 55°C water bath to prevent it from solidifying before use.

Liquid Overlay (1 liter)

• 900 mL DMEM (Gibco^™ 11966025)

• 20 mL HI FBS (SH30071.04IH25–40)

• 10 mL Sodium Pyruvate (100 mM) (Gibco^™ 11360070)

• 71 mL 1.4% sterile agarose

  After adding FBS and sodium pyruvate to DMEM, warm to 37°C before adding agarose.

  Heat 1.4% sterile agarose in the microwave until completely melted and place in the 55°C water bath for 15–20 minutes.

  Add warm liquified agarose to DMEM.

  Shake the Liquid Overlay bottle every two minutes for ten minutes at room temperature.

Store at 4°

• C for ≤ 6 months. Warm Liquid Overlay to room temperature for at least one hour before use.

20% Sucrose (0.5 liter)

• 100g D-Sucrose (Fisher BioReagents BP220–1)

• 25g Bovine Serum Albumin (BSA) (Sigma-Aldrich A9418–100G)

• 500 mL DEPC-Treated Water (Invitrogen^™ AM9922)

• Store at 4°C for ≤ 6 months.

  Sterilize by filtration through a 0.22-μm nitrocellulose filter.

Resuspension Buffer (10 milliliters)

• 0.8 g Sodium Chloride (NaCl) anhydrous, free-flowing, Redi-Dri^™, ReagentPlus^®, ≥99% (793566)

• 0.027 g Sodium phosphate dibasic dihydrate (Na2HPO4 • 2 H2O), BioUltra, ≥99.0% (71643)

1.2g

• HEPES (C8H18N2O4S) (H4034)

• 90 mL DEPC-Treated Water (Invitrogen^™ AM9922)

  Adjust the pH to 7.05 with NaOH. Sterilize by filtration through a 0.22-μm nitrocellulose filter.

  After pH balancing bring total volume to 100ml using DEPC-Treated Water.

• Store at −20°C for ≤ 6 months.

70% Ethanol (EtOH) (0.5 liter)

• 350 mL Ethyl Alcohol, 200 Proof (Decon 2701)

• 150 mL DEPC-Treated Water (Invitrogen^™ AM9922)

1% Crystal violet (w/v) (100 milliliters)

• 1 g crystal violet (ThermoFisher Scientific C581–25)

• 20 mL Ethyl Alcohol, 200 Proof (Decon 2701)

• 80 mL milli-q water

• Store at room temperature for ≤ 6 months, protect from light.

COMMENTARY:

Background Information:

Coronaviruses (CoV), a family within the Nidovirales order, are enveloped, singlestranded, positive-sense RNA viruses (Weiss & Leibowitz, 2011; Weiss & Navas-Martin, 2005). Seven human coronaviruses (HCoVs) have been identified, all having zoonotic origin in bats, mice, or domestic animals (Corman et al., 2018; Ye et al., 2020). HCoVs have a high level of genetic diversity due in part to frequent recombination of their genomes and can spill over into other species, making these viruses a significant threat to human health (Robson et al., 2020; Shang et al., 2020). HCoVs have been known since the late 1960s to cause multiple respiratory diseases of varying severity, ranging from mildto-moderate upper respiratory tract diseases to severe pneumonia, acute respiratory distress syndrome (ARDS), and death (Liu et al., 2020; Weiss & Leibowitz, 2011). HCoV-OC43, -229E, and -NL63 are three of the four seasonal human coronaviruses that infect humans, circulate seasonally, and are generally associated with less severe respiratory disease, although infection can result in more severe disease in at-risk populations (children, the elderly, and immunocompromised individuals; Gaunt et al., 2010; Principi et al., 2010). Therefore, the study of seasonal HCoVs is an important avenue of research.

Largely because of technical challenges in isolation and propagation, the seasonal HCoVs have been neglected for decades. Although HCoV-OC43, -229E, and -NL63 can grow in select tissue culture cell lines, existing protocols for their propagation result in low titers (Bracci et al., 2020). HCoVHKU1 has been a major challenge for successful propagation on all immortalized cells tested to date (Gaunt et al., 2010). Here we present optimized growth and quantification methods for HCoV-OC43, -229E, and -NL63.

The identification and isolation of HCoVs was conducted at 33°C, yielding a recoverable virus (Bucknall et al., 1972; Gorse et al., 2009; Van Der Hoek et al., 2004). We have reported that HCoV-NL63 and HCoV-229E are temperature sensitive and their replication is attenuated at 37°C (Otter et al., 2023). This suggests that temperatures warmer than 33°C negatively impact the replication of the HCoVs. Therefore, one central advantage of the protocols presented here is that they have been optimized at 33°C in order to yield hightiter stocks HCoV-OC43, -229E, and -NL63. The plaque assay technique specifically measures infectious virus particles. This method traditionally involves the use of a solid overlay (solidified culture medium with agar or agarose gel) to prevent virus spread and restrict virus growth to foci of cells. We present the use of a semisolid overlay (i.e., liquid overlay), which eliminates the lengthy process of preparing a solid overlay before each plaque assay while still providing sufficient viscosity to produce discrete and countable plaques. Finally, the use of a sucrose cushion ultracentrifugation technique as described in Basic Protocol 4 allows the production of high-titer stocks of HCoVs, especially for HCoV-NL63, which is notorious for yielding low-titer stocks.

Critical Parameters:

The HCoV strains utilized by our lab are not identical to strains available for purchase via the American Type Culture Collection (ATCC). We provided catalog numbers for commercially available HCoV-OC43, -229E, and -NL63. We have sequenced our HCoVs and the files are available upon request. We have optimized each protocol using our strains of HCoV, so it is important to keep in mind that the use of a slightly different strain may result in different results from those presented here.We recommend sequencing and comparing the genomes of any HCoV-OC43, -229E, or -NL63 obtained to those of the commercially available HCoVs.

To ensure successful replication and quantification of the seasonal HCoVs, infections as well as plaque assay incubations need to be carried out at 33°C. Using a higher temperature can result in low titers and hard-to-count plaques. Successful preparation of viral stocks of the seasonal HCoVs relies in part on the use of healthy cells as well as proper aseptic tissue culture technique when preparing cells for assays. We have optimized each protocol using the indicated cell lines; the use of a different cell line may therefore result in suboptimal results. HCoV-NL63 is the most difficult of the three seasonal HCoVs in terms of replication and plaquing.We and other groups have been unsuccessful in attaining workable titers in HCoV-NL63 stocks without the addition of the ultracentrifugation step (Basic Protocol 4). HCoV-OC43 and -229E can be grown to a high titer without the ultracentrifugation step.

Troubleshooting:

See Tables 11–13 for commonly encountered problems, causes, and solutions.

Table 11.

Troubleshooting Guide for Growth of HCoVs

Problem	Possible cause	Solution
No visible CPE	Microbial contamination of cell cultures	Use aseptic technique
	Poor cell growth	Ensure that cells are at least 90% confluent before starting assay
	P0 stock has a very low infectious titer and initiation of virus infection does not occur in the cell culture	Titer P0 stock and/or use a higher titer P0 stock
Very little CPE present on harvest day	HCoV inoculum was particularly low	Leave the HCoV-infected flask for longer incubation

Table 13.

Troubleshooting Guide for the Concentration of HCoVs via Ultracentrifugation

Problem	Possible cause	Solution
No infectious virus recovered	Viral titer may be <100 PFU/ml in HCoV-containing medium	Titer HCoV-containing media via plaque assay to determine starting titer.
No clear separation between sucrose and virus prior to ultracentrifugation	20% sucrose improperly made	If the 20% sucrose is not made correctly, the HCoV-containing medium will not layer under the cushion.
	20% sucrose was not loaded properly	Ensure that the 20% sucrose cushion is carefully loaded under the HCoV stock.
No clear separation between sucrose and virus after ultracentrifugation	Disrupting gradient (i.e. bumping buckets)	Be very careful when weighing and placing buckets into the rotor. Avoid tapping, bumping, or dropping the buckets.

Understanding Results:

Refer to Table 3 for expected titers for each HCoV when following Basic Protocol 1. In our laboratory, we have found that the titers of most of our HCoV stocks, passaged in their indicated cell line and titrated using plaque assays, range from 10⁵ to 10⁷ PFU/mL. Figure 1B illustrates the expected cytopathic effect (CPE), morphological changes in cells caused by viral infection. Common examples of CPE include rounding of the infected cell, development of hyper-dense foci as cells begin to die, and the appearance of nuclear or cytoplasmic inclusion bodies. If results differ, refer to Table 11 for common problems and solutions.

For Basic Protocol 2, each HCoV has a different plaque morphology. The expected plaque morphology is shown in Figure 2B for each HCoV. Refer to Figure 2B for an example of the plaques and titer obtained when growing HCoVs following Basic Protocol 2 in a 6-well plaque assay plate. In Figure 2C, we present a schematic of negative results that may occur when following Basic Protocol 2. Common issues are listed in Table 12.

Table 12.

Troubleshooting Guide for HCoV Quantification by Plaque Assay

Problem	Possible cause	Solution
High number of plaques at all dilutions	Viral titer of samples may be greater than the serial dilutions plated	Conduct another plaque assay with further serial dilutions of the samples.
	Improper technique for serial dilutions	Make sure to change pipet tips between each dilution, vortex well.
No plaques at all dilutions	Viral titer may be less than <100 PFU/ml (limit of detection when plated); plaque assay dilutions begin at 10−1	Conduct another plaque assay and use undiluted sample.
Plaques clustered around edges of wells	Not swirling the inoculum during the 1 hr incubation stage	Rock plates every 15 min.
Large area of missing cells on monolayer	Overlay or other reagents added quickly and directly on top of monolayer	Add overlay or other reagents slowly, aiming for the edge of well.
	Cells not confluent prior to start of assay	Ensure that cells are at least 80% confluent before starting assay.
‘Crescent moon’ clearing of monolayer along edge of well	Drying of cell monolayer	Work in small batches of plates to prevent the monolayer from drying out between each aspiration.
Large plaque-like spot	Scratching of the monolayer during reagent addition or removal	Avoid touching the monolayer directly with pipet tips. Hover above the well and aim along the edges when adding reagents.
	Reagents added directly to monolayer at high speed	Dispense overlay along the edges at low speed.

For Basic Protocol 3, refer to Figure 3 for an example of positive expected results when quantifying HCoV RNA products of replication. We have found detectable HCoVNL63 or HCoV-229E RdRpmRNAin infected MRC-5 cells, human fetal lung fibroblast cells often used for HCoV infections, at 24 and 48 hpi. The amount of RdRp or N mRNA detected is dependent on multiple factors. One key factor is if desired cells are susceptible to the desired HCoV. The second factor to consider is at what time point after infection the RNA is collected; extraction too early or too late might result in undetectable RdRp or N mRNA.

Figure 3.

Detection of HCoV-NL63 and HCoV-229E RdRp mRNA in MRC-5 cells.

(A) MRC-5 cells were infected at MOI of 5 PFU/mL with HCoV-NL63 or HCoV-229E and incubated at 33°C. RNA was extracted at indicated timepoints and cDNA was made from these samples. RdRp mRNA was measured for both time points.

Refer to Figure 4B for an example of the plaques and titer obtained concentrating HCoVs following Basic Protocol 4 in a 6-well plaque assay plate. Refer to Table 13 for expected titers for each HCoV when following Basic Protocol 4. We have found that the titers of most of our concentrated HCoVNL63 stocks range from 10⁶ to 10⁷ PFU/mL and concentrated HCoV-OC43 stocks typically reach ~10⁸ PFU/mL.

Time Considerations:

Each protocol’s time to completion is variable depending on which HCoV is worked with. HCoV-OC43, -229E, and -NL63 require different cell types for each protocol. For Basic Protocol 1, a significant amount of time is spent growing and seeding cells for the growth of HCoV stocks days before the infection. Visualization of cytopathic effect (CPE) is dependent on the CoV. HCoV-NL63 CPE is visible later than HCoV-OC43 and -229E, 5-7 days post-infection. Therefore, a considerable amount of time is spent waiting for CPE to develop and progress before harvesting HCoVNL63 stocks.

Basic Protocol 2 requires the seeding of 6-well or 12-well plates, which requires planning ahead of time to grow enough cells for the desired number of plates needed for the plaque assay. The day post infection on which plaques are visible varies for each HCoV, and HCoV-NL63 has the longest incubation period, with countable plaques forming only on day 5-6 post infection.

Basic Protocol 4 is the most timeconsuming protocol, requiring extensive work beforehand to prepare for concentrating HCoVs. Therefore, it is recommended to follow and complete Basic Protocol 1 and obtain ~200 ml of HCoV-containing medium that is titered using Basic Protocol 2 before performing Basic Protocol 4.

DATA AVAILABILITY STATEMENT:

The data that support the findings of this study are available from the corresponding author upon reasonable request.