Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2005 Apr;79(8):4630–4639. doi: 10.1128/JVI.79.8.4630-4639.2005

Requirements at the 3′ End of the Sindbis Virus Genome for Efficient Synthesis of Minus-Strand RNA

Richard W Hardy 1,*, Charles M Rice 2
PMCID: PMC1069581  PMID: 15795249

Abstract

The 3′-untranslated region of the Sindbis virus genome is 0.3 kb in length with a 19-nucleotide conserved sequence element (3′ CSE) immediately preceding the 3′-poly(A) tail. The 3′ CSE and poly(A) tail have been assumed to constitute the core promoter for minus-strand RNA synthesis during genome replication; however, their involvement in this process has not been formally demonstrated. Utilizing both in vitro and in vivo analyses, we have examined the role of these elements in the initiation of minus-strand RNA synthesis. The major findings of this study with regard to efficient minus-strand RNA synthesis are the following: (i) the wild-type 3′ CSE and the poly(A) tail are required, (ii) the poly(A) tail must be a minimum of 11 to 12 residues in length and immediately follow the 3′ CSE, (iii) deletion or substitution of the 3′ 13 nucleotides of the 3′ CSE severely inhibits minus-strand RNA synthesis, (iv) templates possessing non-wild-type 3′ sequences previously demonstrated to support virus replication do not program efficient RNA synthesis, and (v) insertion of uridylate residues between the poly(A) tail and a non-wild-type 3′ sequence can restore promoter function to a limited extent. This study shows that the optimal structure of the 3′ component of the minus-strand promoter is the wild-type 3′ CSE followed a poly(A) tail of at least 11 residues. Our findings also show that insertion of nontemplated bases can restore function to an inactive promoter.


Synthesis of the minus-sense copy of a plus-sense RNA virus genome constitutes the first step in genome replication. Determining how this process occurs is a fundamental requirement for understanding the early events in virus replication.

Alphaviruses are a group of medically and economically important positive-sense RNA viruses that are amenable to genetic analysis (22, 55). Full-length DNA copies of the genomes have been used to study the roles of viral proteins and cis-acting elements in the processes of virus replication and pathogenesis (8, 9, 30, 33, 39, 47). Additionally, alphavirus-based vector systems are becoming widely used in the fields of gene and vaccine delivery (1, 14, 19, 36, 40, 41, 59).

Sindbis virus (SIN) is the type species and one of the best-studied members of the alphavirus genus (22, 55). The SIN genome is a single strand of RNA with positive polarity 11,703 nucleotides (nt) in length exclusive of the 5′ cap and 3′ polyadenylate tail and thus closely resembles a eukaryotic mRNA (54). Upon introduction to the host cell cytosol the genome serves as a template for translation of the viral nonstructural polyproteins P123 and P1234. P1234, produced by translational readthrough of an opal codon at the 3′ end of the nsP3 coding sequence, is initially processed to P123 and nsP4 by the nsP2-associated proteinase activity (10, 13, 24, 25, 37, 38). nsP4 is the catalytic subunit of the viral replicase/transcriptase, possessing RNA-dependent RNA polymerase (RdRp) activity. In complex with P123, nsP4 serves to copy the viral genome into a full-length complementary RNA (minus-strand) (34, 35, 52). Proteolytic processing of P123 by the nsP2 proteinase, specifically cleavage at the 2/3 junction, turns off minus-strand RNA synthesis and switches the RNA synthetic activity of the complex to plus-strand genomic and subgenomic RNA synthesis (35, 52).

Recent work has demonstrated that the 5′ end of the SIN genome is important for minus-strand RNA synthesis, a process that initiates at the 3′ end of the genome (18, 21). Similar 5′ requirements have been found for other positive-sense RNA viruses (2, 6, 26, 56, 58). While the 5′ end of the genome is important for facilitating efficient production of the replication intermediate, the 3′ end of the genome is considered to be the core promoter for minus-strand RNA synthesis. In order to achieve productive replication of viable progeny, virus initiation of minus-strand synthesis must occur at or close to the 3′ terminus of the genome to prevent loss of genetic information. The 3′-noncoding regions of a number of positive-sense RNA viruses have been demonstrated to play a role in regulating minus-strand RNA synthesis (11, 27, 29, 42, 43, 53, 58). However, a rigorous analysis of requirements in this region for efficient initiation of SIN minus-strand RNA synthesis has not been performed.

The 3′ end of the SIN genome consists of a polyadenylate tail preceded by a sequence element 19 nucleotides in length that is highly conserved across the alphavirus genus (3′ CSE) (45, 54). In studies by Kuhn et al., specific mutations in the 3′ CSE were found to inhibit virus production or to bestow a temperature sensitive phenotype on the virus, but the point at which these mutations exert their effect was not defined (32). Additionally, while it has been proposed that minus-strand RNA synthesis is initiated on the poly(A) tail, the need for the poly(A) tail during genome copying has not been demonstrated, nor has a specific size requirement been defined (16, 49). Furthermore, recent studies have demonstrated that viral genomes lacking or possessing partial deletions of the 3′ CSE and the poly(A) tail can function or were repaired to a functional state in order to support virus replication in vivo (20, 46). The regenerated 3′ sequences were not identical to the wild-type (wt) 3′ CSE but varied in length and in some cases had adenylate- and uridylate-rich sequences added. Invariably the poly(A) tail was regenerated. These sequences were assayed only for their ability to support virus replication under noncompetitive conditions in cell culture, but their ability to program efficient minus-strand RNA synthesis was not examined. These studies have raised a number of questions concerning the 3′ requirements for initiation of alphavirus minus-strand RNA synthesis.

In this study we used in vitro and in vivo RNA synthesis assays to define the requirements at the 3′ end of the SIN genome for efficient minus-strand RNA synthesis. Our results demonstrate a poly(A) tail size requirement, a spacing requirement between the poly(A) tail and the 3′ CSE, and specific nucleotide requirements at certain positions in the 3′ CSE. In vitro analysis of 3′ sequences from the previously mentioned repaired viruses demonstrate that the efficiency of minus-strand RNA synthesis programmed by these sequences is significantly lower than that of the wild-type sequence, but the insertions between a mutated 3′ CSE and the poly(A) tail can restore limited promoter function. The implications of these findings for our understanding of requirements for SIN replication are discussed.

MATERIALS AND METHODS

Cells and viruses.

BHK-21 cells were obtained from the American Type Culture Collection, Rockville, Md. These cells were grown in Alpha minimal essential medium (Invitrogen) supplemented with 10% fetal bovine serum and vitamins. Recombinant vaccinia viruses encoding T7 DNA-dependent RNA polymerase, the SIN polyprotein P123C>S, and a ubiquitin-nsP4 fusion protein were grown individually to a high titer in BSC-40 cells cultured in Dulbecco's minimal essential medium (Invitrogen) supplemented with 10% fetal bovine serum, nonessential amino acids, and vitamins (34, 35, 52). The virus titer was determined by a plaque assay on BSC-40 cells.

Plasmids and constructs.

The plasmid pwt(+) encodes the RNA (1,112 nt) outlined in Fig. 1A. This plasmid was generated by replacing the BamHI-EcoRI fragment of pMini1(+) with a similarly digested PCR product of the same sequence but possessing a poly(A) tail of 25 residues. pMini1(+) was constructed by replacing the BamHI-XhoI fragment of pDH-BB(5′SIN) with the corresponding fragment of pSINrep5 (5). pMini1(+) encodes an RNA identical to pwt(+) with the exception of the poly(A) tail that is 34 residues in length.

FIG. 1.

FIG. 1.

Requirement for the 3′ CSE for efficient minus-strand RNA synthesis. (A) Diagram of the wt(+) genome analog RNA showing the regions of the SIN genome present in this RNA. UTR, untranslated region; sub-gen pro, subgenomic RNA promoter. (B) Results of in vitro minus-strand RNA synthesis from the wt(+) RNA (lanes 1, 2, and 3), the wt(+) RNA lacking the 3′ CSE and poly(A) tail (Δ−20 no A, lanes 4 and 5), and wt(+) RNA lacking the 3′ CSE (Δ−20 + A, lanes 6 and 7). Template RNA used for reactions yielding the products in lanes 3, 5, and 7 was treated with sodium metaperiodate prior to use in order to remove the 3′ hydroxyl group. Following 1 h of incubation at 30°C, RNA from the reactions was phenol-chloroform extracted and ethanol precipitated. Precipitated RNA was denatured and separated by agarose-phosphate gel electrophoresis. Products were visualized by autoradiography.

The construction of the plasmids encoding 5′SIN3′SIN and the SIN replicon RNA, TSG-pac, have been described previously (17, 18). P5′SIN3′SINΔ−20noA and p5′SIN3′SINΔ−20+A were generated by PCR amplification of nucleotides 1545 to 2729 of the 5′SIN3′SIN sequence (this product terminates 20 residues prior to the poly(A) tail region of p5′SIN3′SIN). An SpeI site followed by an EcoRI site were added during amplification to the 3′ sequence of the 5′SIN3′SINΔ−20noA product, and 25 A residues and an EcoRI site were added to the 3′ end of the 5′SIN3′SINΔ−20+A product during amplification. PCR products were digested with SapI and EcoRI (New England Biolabs) and ligated into similarly digested p5′SIN3′SIN. Each of the plasmids based on p5′SIN3′SIN possessed an SP6 promoter followed by the SIN 5′ sequence derived from Toto1101, a subgenomic promoter followed by a firefly luciferase gene, and the SIN 3′-untranslated region with the changes described. Mutations in the 3′ CSE and poly(A) tail of pwt(+) were made by PCR amplification using mutagenic oligonucleotide primers corresponding to the 3′ end of pwt(+) and a primer corresponding to the 5′ end of the SIN genome preceded by a T7 promoter. PCR amplification was performed using high-fidelity Triple Master polymerase (Brinkman-Eppendorf).

RNA transcription.

Plasmids encoding the genome analog wt(+) were digested with BsgI. Plasmids encoding the 5′SIN3′SIN and 5′SIN3′SINΔ−20+A genome analogs were linearized by digestion with EcoRI. The plasmid encoding 5′SIN3′SINΔ−20 was linearized by digestion with SpeI. Products of PCR amplification were gel isolated using a gel extraction kit (QIAGEN), quantitated by spectrophotometry, and used directly in transcription reactions. RNAs were transcribed in the presence of cap analog (New England Biolabs) using SP6 or T7 RNA polymerase (New England Biolabs). DNA templates were removed by DNase I (Takara) digestion. The integrity and yield of the RNA transcripts were monitored by gel electrophoresis. RNA was purified by phenol-chloroform extraction and ethanol precipitation. Isolated RNA was dissolved in water to a final concentration of 1 μg/μl as determined by spectrophotometry.

Oxidation of 3′ OH of template RNA.

Ten micrograms of RNA isolated from an in vitro transcription reaction was ethanol precipitated and resuspended in 250 μl of buffer containing 50 mM sodium acetate (pH 5.0) and 20 mM sodium metaperiodate. Reactions were incubated at 25°C for 90 min (4). Following incubation, the RNA was ethanol precipitated, washed with 70% ethanol, and desalted by passage over an RNeasy column (QIAGEN). The integrity of the RNA was checked by agarose/Tris-acetate-EDTA (TAE) gel electrophoresis. The extent of 3′ oxidation was determined by the inability to be labeled in the presence of [α32P]-ATP and poly(A) polymerase (Ambion).

In vitro minus-strand RNA synthesis assay.

Polymerase extracts used for in vitro minus-strand RNA synthesis were prepared as previously described (34). Briefly, BHK-21 monolayers (approximately 3 × 107 cells) were coinfected with recombinant vaccinia viruses expressing T7 DNA-dependent RNA polymerase, SIN polyprotein P123 containing a mutation abolishing nsP2-associated protease activity, and nsP4 with an amino-terminal ubiquitin fusion (multiplicity of infection = 10 PFU/cell for each virus) (35). Infected cells were incubated at 37°C for 6 h in minimal essential medium plus 10% fetal bovine serum, whereupon they were harvested in ice-cold phosphate-buffered saline. Cells were collected by low-speed centrifugation (900 × g). Cell pellets were resuspended in 1 ml of hypotonic buffer (10 mM Tris-HCl [pH 7.8], 10 mM NaCl), allowed to swell for 15 min on ice, and disrupted with 50 strokes of a tight-fitting Dounce homogenizer. Nuclei were removed by centrifugation (900 × g for 5 min at 4°C). Postnuclear homogenates were centrifuged at 15,000 × g for 20 min at 4°C. Pellets (P15) were resuspended in 120 μl of storage buffer (hypotonic buffer plus 15% glycerol) and stored at −80°C.

Standard reaction mixtures contained 50 mM Tris-HCl (pH 7.8), 50 mM KCl, 3.5 mM MgCl2, 10 mM dithiothreitol, 10 μg of actinomycin D per ml, 5 mM creatine phosphate, 25 μg of creatine phosphokinase per ml, 1 mM ATP, 1 mM GTP, 1 mM UTP, 40 μΜ CTP, 1 mCi of [α-32P]CTP per ml, 800 U of RNasin per ml, 1 μg of template RNA, 18 μl of P15, and H2O to a total volume of 50 μl. Reaction mixtures were incubated at 30°C for 60 min, at which point 5 U of alkaline phosphatase was added, and incubation continued for 20 min. Reactions were terminated by the addition of sodium dodecyl sulfate to 2.5% and proteinase K to 100 μg/ml. RNA was isolated by phenol-chloroform extraction and ethanol precipitated. RNAs were denatured with glyoxal, separated by electrophoresis, and visualized by autoradiography. The quantitation of radioactivity was performed using a phosphorimager (Amersham).

Reverse transcription-PCR (RT-PCR) assay of minus-strand RNA.

This assay was based on the procedure described by Shirako et al. (51). BHK-21 cells (2 × 106) were transfected with TSG/pac (SIN replicon RNA [17, 18]) and the experimental template RNA. In this assay the experimental template RNA was based on the 5′SIN3′SIN RNA described previously (17, 18). This RNA encodes a firefly luciferase gene following the subgenomic promoter (see description of construct above), and this non-SIN sequence was used to facilitate specific PCR amplification of RNA derived from this template. Cells were incubated at 37°C and harvested 5 h posttransfection using a mild detergent buffer (10 mM Tris-HCl, pH 7.4, 140 mM NaCl, 1% NP-40, 0.4% sodium deoxycholate). Nuclei were removed by low-speed centrifugation, and intracellular RNA was phenol extracted in the presence of 0.1% sodium dodecyl sulfate. Isolated RNA was ethanol precipitated, resuspended, and treated with 15 U of DNase I. RNA was reisolated by phenol extraction and ethanol precipitation. First-strand cDNA was synthesized using ImPromII reverse transcriptase (Promega) and a plus-sense primer corresponding to nucleotides 1905 to 1926 of the 5′SIN3′SIN RNA. The cDNA was amplified using a minus-sense primer, complementary to nucleotides 2671 to 2691 of the 5′SIN3′SIN RNA, and the plus-sense primer described above. After 10, 15, and 20 cycles of PCR, one-tenth of the reaction products were resolved by electrophoresis on a 1% agarose/TAE gel, then stained with ethidium bromide. The assay was controlled using RNA extracted from cells that were not transfected with experimental template RNA and 25 ng of 5′SIN3′SIN RNA isolated from the SP6 RNA transcription reaction described above.

RESULTS

Initiation of SIN minus-strand RNA synthesis requires the 3′ poly(A) tail and 3′ CSE.

RNA templates analogous to the SIN genome were generated and used in an in vitro minus-strand RNA synthesis assay. Replicase activity was provided from membrane fractions prepared from recombinant vaccinia virus-infected cells expressing the polyprotein P123 and nsP4. The active site of the nsP2-associated proteinase in P123 was mutated (amino acid 481 of nsP2 changed from C to S) to prevent processing of the polyprotein, which would alter the replicase complex and lower its efficiency in minus-strand RNA synthesis (34, 35, 52).

Figure 1A is a diagram of the genome analog RNA wt(+) showing the regions of the SIN genome present in this RNA. The wt(+) RNA is 1,087 nt long and also contains a 25-residue 3′ poly(A) tail. This RNA was considered the wild-type template for most of the mutagenesis studies we performed.

Figure 1B shows the results of in vitro minus-strand RNA synthesis assays using template RNA with a wild-type 3′ end (lanes 1, 2, and 3), a template with the 3′ poly(A) tail and the 3′ CSE deleted (lanes 4 and 5), and a template with the 3′ CSE deleted but with a 25-residue 3′ poly(A) tail (lanes 6 and 7). The 3′-hydroxyl group of the template RNA used for reactions yielding the RNA in lanes 3, 5, and 7 was oxidized using sodium metaperiodate.

Membrane fractions from cells infected with recombinant vaccinia virus expressing the polyprotein P123, but not nsP4, were used to demonstrate that RNA synthesis in the reactions was dependent upon the presence of the SIN RdRp (Fig. 1B, lane 1). The absence of discrete products in lane 1 of Fig. 1B confirms the absolute requirement for nsP4 for SIN minus-strand RNA synthesis (3, 23, 28, 34, 35, 48, 52). When wt(+) template RNA was used in the reactions, the major product was genome length. RNase H digestion of this product in the presence of strand-specific oligonucleotides has previously shown that it is a minus-strand copy of the input template RNA (34). A second minor product was also visible and corresponded to an RNA approximately twice the size of the input template RNA. Oxidation of the 3′ OH of the template RNA by metaperiodate demonstrated that the production of the 1× genome-length minus strand occurred independently of the 3′ OH and was likely the result of de novo initiation (Fig. 1B, lane 3). The decrease in 1× length product following oxidation of the 3′ OH may indicate that some of the signal seen in lane 2 is due to the addition of radiolabeled nucleotide to the unoxidized 3′ end of the template RNA. The 2× length RNA was not produced in the absence of 3′ OH of the template RNA (Fig. 1B, lane 3), indicating that this RNA is a product of self-primed copy-back RNA synthesis. Removal of the 3′ CSE and the poly(A) prevented production of genome length minus-strand RNA, but the 2× genome length product was generated (Fig. 1B, lane 4). Again, the production of this larger RNA was dependent on the presence of a 3′ OH on the template RNA and thus likely to be a product of copy-back synthesis. Restoration of the poly(A) tail to a template RNA lacking the 3′ CSE failed to restore 3′ OH independent minus-strand RNA synthesis (Fig. 1B, lanes 6 and 7). These results demonstrate the requirement for the 3′ CSE for efficient de novo minus-strand RNA synthesis. The production of a 2× genome-length RNA during SIN infection has not been observed, and the biological relevance of such a product is unknown; however, to reduce the complication of analysis, all RNA templates used in the subsequent experiments were subjected to metaperiodate oxidation prior to use.

A parallel analysis of the requirement for the 3′ CSE for minus-strand RNA synthesis was performed in vivo. In order to specifically analyze the effects of mutations on minus-strand RNA synthesis, we made use of a method that allowed translation of the nonstructural proteins required for RNA synthesis to be separated from replication of the experimental template (17, 18). SIN replicon RNA encoding the nonstructural proteins was cotransfected with 5′SIN3′SIN, 5′SIN3′SINΔ−20no A, or 5′SIN3′SINΔ−20+A into BHK-21 cells (Fig. 2A). The experimental template RNA was oxidized with sodium metaperiodate prior to transfection to block copy-back synthesis of minus-strand products. Following incubation at 37°C for 5 h, cells were harvested, and RNA was extracted. The extent of minus-strand RNA synthesis from the experimental template RNA was analyzed by RT-PCR (51).

FIG. 2.

FIG. 2.

Analysis of in vivo minus-strand RNA synthesis. (A) SIN replicon RNA and the experimental RNA were cotransfected into BHK-21 cells and incubated at 37°C for 5 h. Cells were harvested into a detergent buffer for lysis, nuclei were removed, and RNA was extracted from the lysate. First-strand cDNA synthesis was performed using ImPromII reverse transcriptase (Promega) and an oligonucleotide primer corresponding directly to a region in the luciferase gene of the experimental RNA (nt 1905 to 1926 of 5′SIN3′SIN). PCR amplification of the cDNA was done using Taq DNA polymerase (Brinkman-Eppendorf), the primer described above, and an oligonucleotide complementary to nucleotides 2671 to 2691 of the 5′SIN3′SIN RNA. Samples were taken from the PCR mixture after 10, 15, and 20 cycles of amplification, run on a TAE/agarose gel, and stained with ethidium bromide. (B) The procedure described above was followed for cells transfected with SIN replicon RNA and 5′SIN3′SIN RNA (lanes 2 to 4), SIN replicon RNA alone (lanes 5 to 7), SIN replicon RNA plus 5′SIN3′SINΔ−20 RNA (lanes 11 to 13), or SIN replicon RNA plus 5′SIN3′SINΔ−20+A RNA (lanes 14 to 16). The result of a control (con) RT-PCR using 25 ng of purified SIN5′/SIN3′ template RNA is shown in lane 8. Lanes 1, 9, and 10 show a 100-bp DNA ladder (New England Biolabs).

If the experimental RNA was copied into a minus strand, a 787-nt product of RT-PCR amplification should be observed. A product of the predicted size was readily observed following 15 cycles of amplification of cDNA obtained from cells transfected with 5′SIN3′SIN, possessing the wt 3′ end (Fig. 2B, lanes 2 to 4). When no experimental RNA was transfected, no product was observed (Fig. 2B, lanes 5 to 7). If the template RNA lacked the 3′ CSE, 5′SIN3′SINΔ−20+A (Fig. 2B, lanes 14 to 16), or lacked both the 3′ CSE and poly(A) tail, 5′SIN3′SINΔ−20noA (Fig. 2B, lanes 11 to 13), no product was observed, demonstrating a requirement for the 3′ CSE in vivo for efficient minus-strand RNA synthesis. As a control, 25 ng of purified experimental RNA possessing the wild-type 3′ end was subjected to RT-PCR (Fig. 2B, lane 8). Following 20 cycles of amplification, products smaller than those expected from minus-strand RNA were observed. Similar products were seen for all samples following 30 cycles of amplification (data not shown). It is possible that minus-strand RNA synthesis occurs from templates without the 3′ CSE, but if this is the case it occurs at levels below the detection limit of this assay.

These results demonstrate the requirement for the 3′ CSE for de novo synthesis of minus-strand RNA both in vivo and in vitro. Additionally, the results from the in vitro analysis indicate that the SIN replicase is capable of synthesizing an RNA twice the size of the input template RNA probably by a self-priming copy-back mechanism.

Size requirements for the 3′ poly(A) tail for minus-strand initiation.

The poly(A) tail of alphavirus genomic RNA has previously been proposed as the initiation site for minus-strand RNA synthesis, giving rise to minus-strand RNA with different lengths of oligonucleotide (U) at the 5′ end (16, 49). However, minimum size requirements for the poly(A) tail and spacing of the poly(A) tail in relation to the 3′ CSE have not been determined. RNA templates possessing different-size poly(A) tails were generated. The number of residues in the poly(A) tail ranged from 0 to 34. Template RNA was treated with sodium metaperiodate to oxidize the 3′-hydroxyl group. The results shown in Fig. 3 demonstrate a biphasic decrease in efficiency of minus-strand RNA synthesis as the length of the poly(A) tail is reduced. Minus-strand synthesis was equally efficient on RNA templates possessing 25 and 34 adenylate residues in the poly(A) tail; however, when the size of the tail was reduced to 20 residues, a significant (>70%) decrease in the efficiency of minus-strand synthesis was observed. A second decrease in efficiency occurred when the size of the tail was reduced to 10 residues. The lack of a 3′ poly(A) tail severely inhibited the production of minus-strand RNA. A template RNA with no 3′ poly(A) tail programmed minus-strand RNA synthesis at only 4% the level of a template RNA with 25 3′-terminal adenylate residues.

FIG. 3.

FIG. 3.

In vitro minus-strand RNA synthesis (synth.) from template RNA with poly(A) tails of various lengths. RNA templates were generated by in vitro transcription from BsgI-digested pwt(+) and pMini1(+) or PCR products encoding a SIN genome analog giving rise to RNA templates with 3′ poly(A) tails varying in size from 0 to 34 adenylate residues. These RNA templates were used in an in vitro minus-strand synthesis assay. Products of the reaction were analyzed by agarose-phosphate gel electrophoresis. An autoradiograph of a typical gel is shown. The numbers above the lanes refer to the size of the poly(A) tail. The percentage of wt minus-strand RNA synthesis is shown below each lane. Quantitation was performed by phosphorimaging, and the numbers shown are the average of three independent experiments. The degree of experimental variability is shown in parentheses under each lane.

Further analysis of the poly(A) tail was performed by introducing a run of three cytidylate residues at various positions in the 25-nt poly(A) tail (Fig. 4A). Interrupting the poly(A) tail close to the 3′ CSE (between residues 1 and 12 of the A tail) caused a significant decrease in efficiency of minus-strand RNA synthesis, to less than 10% of that seen with a template possessing an uninterrupted run of 25 adenylates (Fig. 4B, lanes 1 to 4 and 8). The efficiency of minus-strand synthesis increased when the three cytidylates were inserted after residue 12 of the poly(A) tail (Fig. 4B, lane 5). A further increase occurred when the insertions were introduced following 15 or 18 A residues (Fig. 4B, lanes 6 and 7). Similar results were obtained when the inserted residues were uridylates or guanylates, but the decrease in the efficiency of minus-strand RNA synthesis was not as pronounced (Fig. 4B, lanes 9, 10, 11, and 12).

FIG. 4.

FIG. 4.

Minus-strand RNA synthetic activity of template RNA with interrupted poly(A) tails. (A) Diagram of RNA templates generated with 25 A residues interrupted at specific points with three C, three U, or three G residues. Residues introduced into the poly(A) tail are shown in bold lowercase letters. (B) Levels of minus-strand RNA synthesized from templates with interrupted poly(A) tails. The numbers above the lanes indicate the number of A residues immediately following the 3′ CSE and preceding the insertion. The RNA templates were used in an in vitro minus-strand RNA synthesis assay, and products were analyzed by agarose-phosphate gel electrophoresis. An autoradiograph of a gel from a representative experiment is shown. Products were quantitated by phosphorimaging and expressed as a percentage of minus-strand synthesis from a wt template (lane 8). The amount of minus-strand synthesis is shown below each lane as a percentage of that synthesized from the wt(+) template (average of results from three independent experiments; the degree of experimental variability is shown in parentheses under each lane).

Taken together these results demonstrate that efficient minus-strand RNA synthesis requires 11 or 12 consecutive A residues immediately following the 3′ CSE. If the poly(A) tail is shifted away from the 3′ CSE by inserting three nucleotides, the efficiency of minus-strand RNA synthesis decreases. This indicates that not only are the 3′ CSE and a poly(A) tail required but the spacing between these elements is critical for efficient initiation of minus-strand RNA synthesis. It should also be noted that the template possessing a 15-residue poly(A) tail did not program minus-strand RNA synthesis as efficiently as a template possessing 25 adenylates interrupted by three cytidylates following the first 15 adenylates. This indicates that an adenylate-rich sequence located 3′ to the required 11- to 12-residue poly(A) tail aids minus-strand initiation possibly by enhancing binding of a trans-acting factor.

Requirements in the 3′ CSE for efficient minus-strand RNA synthesis.

We conducted a detailed mutational analysis of the 3′ CSE and examined the ability of mutant templates to program minus-strand RNA synthesis. Table 1 shows the 3′ CSE of each mutant template RNA analyzed, and the amount of minus-strand RNA synthesized is expressed as a percentage of that synthesized from a wt template (the mean value of results from three independent experiments).

TABLE 1.

In vitro minus-strand RNA synthesis programmed by RNA templates possessing mutations in the 3′ CSE

3′ terminal sequence (5′-3′)a Template name % Minus-strand synthesisb
AAUUUUGUUUUUAACAUUUCA25 wt 100
AAUUUUGUUUUUAACAUUU-A25 Δ − 1 0.8 ± 0.5
AAUUUUGUUUUUAACAUUUcCA25 insC 62 ± 6.1
AAUUUUGUUUUUAACAUUUgCA25 insG 18 ± 4.2
AAUUUUGUUUUUAACAUUUuCA25 insU 15 ± 5.6
AAUUUUGUUUUUAACAUUUaCA25 insA 13 ± 3.5
AAUUUUGUUUUUAACAUUUgA25 C − 1G 2.2 ± 0.6
AAUUUUGUUUUUAACAUUUuA25 C − 1U 8.1 ± 2.5
AAUUUUGUUUUUAACAUU--A25 Δ − 2 > − 1 1.2 ± 0.3
AAUUUUGUUUUUAACAUUaCA25 U − 2A 2.3 ± 0.5
AAUUUUGUUUUUAACAUUcCA25 U − 2C 7.8 ± 1.4
AAUUUUGUUUUUAACAUaUCA25 U − 3A 5.1 ± 2.1
AAUUUUGUUUUUAACAUcUCA25 U − 3C 7.3 ± 1.9
AAUUUUGUUUUUAACAaUUCA25 U − 4A 1.9 ± 0.9
AAUUUUGUUUUUAACuUUUCA25 A − 5U 1.2 ± 0.6
AAUUUUGUUUUUAAC-UUUCA25 Δ − 5 0.8 ± 0.6
AAUUUUGUUUUUAAC----CA25 Δ − 5 > − 2 0.2 ± 0.2
AAUUUUGUUUUUAA-AUUUCA25 Δ − 6 1.1 ± 1.0
AAUUUUGUUUUUAAuAUUUCA25 C − 6U 135 ± 22
AAUUUUGUUUUUAAaAUUUCA25 C − 6A 72 ± 12
AAUUUUGUUUUUAA------A25 Δ − 6 > − 1 0.3 ± 0.2
AAUUUUGUUUUUA-CAUUUCA25 Δ − 7 1.8 ± 0.6
AAUUUUGUUUUUAaCAUUUCA25 A − 7C 1.3 ± 0.5
AAUUUUGUUUUU--CAUUUCA25 Δ − 8 > − 7 1.1 ± 0.8
AAUUUUGUUUUUuuCAUUUCA25 A − 8& − 7U 2.2 ± 1.2
AAUUUUGUUUUUcACAUUUCA25 A − 8C 0.8 ± 0.6
AAUUUUGUUUUcAACAUUUCA25 U − 9C 1.3 ± 0.4
AAUUUUGUUcUUAACAUUUCA25 U − 11C 2.1 ± 1.2
AAUUUU--------CAUUUCA25 Δ − 14 > − 7 0.1 ± 0.1
AAUUUUG-----AACAUUUCA25 Δ − 13 > − 9 0.3 ± 0.3
AAUUUUGUcccUAACAUUUCA25 U − 12 > − 10C 0.3 ± 0.3
AAUUUUGUaaaUAACAUUUCA25 U − 12 > − 10A 0.8 ± 0.6
AAUUUUG-UUUUAACAUUUCA25 Δ − 13 2.2 ± 1.3
AAUUUUG--UUUAACAUUUCA25 Δ − 13 > − 12 1.1 ± 0.4
AAUUUUG-------------A25 Δ − 13 > − 1 2.8 ± 1.8
AAUUUU-UUUUUAACAUUUCA25 Δ − 14 62 ± 8
AAUUUUaUUUUUAACAUUUCA25 G − 14A 68 ± 12
AAUU--GUUUUUAACAUUUCA25 Δ − 16 > − 15 56 ± 9
AAaaUUGUUUUUAACAUUUCA25 U − 18 > − 17A 97 ± 8
uuUUUUGUUUUUAACAUUUCA25 A − 20 > − 19U 110 ± 11
ccccUUGUUUUUAACAUUUCA25 −20 > − 17C 81 ± 12
a

Changes in the 3′ CSE are indicated by dashes for deletions or bold lowercase letters for substitutions and insertions.

b

The average efficiency of minus-strand synthesis expressed as a percentage of that of the wild type was calculated from three independent experiments. Quantitation was performed by phosphorimaging of dried agarose-phosphate gel.

Nucleotides −5 to −1 are sensitive to deletion or substitution. Deleting or changing any of these residues caused a significant decrease in minus-strand RNA synthesis from the template. A template in which the C residue immediately preceding the poly(A) tail was changed to a U (C−1U) was capable of programming minus-strand RNA synthesis at 8% of the wt level. This indicates that the process of minus-strand synthesis has some tolerance for a C-to-U change at the −1 position and may indicate a requirement for a purine in the corresponding position of the nascent minus strand. The residue at position −6 is tolerant of substitution; in fact, changing this residue from a C to a U (C−6U) increases the efficiency of minus-strand RNA synthesis. This is not surprising since this residue is not highly conserved among alphaviruses (45). Deletion of this residue, however, abolished nearly all RNA synthesis from this template. This may be indicative of a spacing requirement between the 3′ five residues and residues −13 to −7. All template RNAs with changes or deletions of residues −13 to −7 were severely impaired in their ability to program minus-strand RNA synthesis (0 to 2% of the wt synthesis). Positions −19 to −14 were more tolerant of change. A decrease in efficiency of minus-strand RNA synthesis was observed when the G at position −14 was deleted or changed to an A and when residues −16 and −15 were deleted; however, RNA synthesis was still greater than 50% of that from a wt template.

Insertion of a C residue between the −1 and −2 positions caused a decrease in the efficiency of RNA synthesis to 62% of that from a wt template. The insertion of an A, U, or G residue in the same place caused a far greater decrease in template efficiency, but minus-strand synthesis was observable. The decrease in efficiency of minus-strand synthesis may indicate a spacing requirement between the poly(A) tail and the 3′ CSE as previously seen in Fig. 4.

Predictably, template RNA containing deletions of more than one nucleotide from the 3′ end of CSE (Δ−2>−1, Δ−6>−1, and Δ−13>−1) programmed very low levels of minus-strand RNA synthesis. The activity of these templates for minus-strand RNA synthesis is of particular interest, as George and Raju found that SIN genomic RNA possessing these deletions were viable templates for virus replication (20). However, Kuhn et al. reported that genomic RNAs with the same deletions were unable to support virus replication (32), which is consistent with our findings.

Analysis of the effect of insertions between the 3′ CSE and the poly(A) tail.

Deletion of the C residue at the −1 position has been reported to be lethal for virus replication (32), and we have shown that this mutation severely inhibits minus-strand RNA synthesis (Table 1). George and Raju demonstrated that SIN genomic RNA with a deletion of the C at the −1 position and an insertion of six U residues between the consensus −2 U residue and the poly(A) tail produced virus that replicated to levels similar to those of wild-type virus (20). These data suggest that the insertion of six uridylate residues between the mutated 3′ CSE and the poly(A) tail restores template function during virus replication. Therefore, we examined the ability of a template RNA with this 3′ sequence to program minus-strand RNA synthesis. Figure 5B shows that the Δ−1 plus 6U template RNA is capable of programming limited minus-strand RNA synthesis (lane 8)—approximately 18% of that observed from a wt template.

FIG. 5.

FIG. 5.

Minus-strand RNA synthesis from template with uridylate insertions between a mutated 3′ CSE and the poly(A) tail. (A) 3′ sequences of RNA templates. Dashes indicate deletions in the 3′ CSE, and bold lowercase letters indicate insertions. (B) RNA templates possessing a deletion of the −1 residue followed by insertions of 2, 3, 4, 5, or 6 uridylate residues prior to the poly(A) tail were examined for their ability to program minus-strand RNA synthesis in vitro. Products were analyzed and quantitated as previously described.

In order to determine the number of inserted uridylates required for the restoration of minus-strand RNA synthesis, we generated a set of template RNA molecules that had the C residue at the −1 position deleted and two to five U residues inserted prior to the poly(A) tail (Fig. 5A). The results in Fig. 5B show that deletion of the −1 residue almost completely abolishes minus-strand RNA synthesis (lane 2). Minus-strand synthesis occurs at approximately 10% of the wt level when a single U is inserted prior to the poly(A) tail (Fig. 5B, lane 3), as shown in Table 1. Inserting two or three uridylate residues (Fig. 5B, lanes 4 and 5) allowed minus-strand synthesis from these templates at a level higher than that from the Δ−1 template but lower than that from the C−1U template. Inserting four, five, or six U residues increases the efficiency of minus-strand RNA synthesis to 14, 19, and 18% of the wt level, respectively (Fig. 5B, lanes 6, 7, and 8). These data demonstrate that activity can be restored to an inactive promoter by the insertion of a short run of uridylate residues between the 3′ CSE and the poly(A) tail.

DISCUSSION

The 3′ end of the SIN genome possesses a conserved sequence element that is 19 nucleotides in length (the 3′ CSE) immediately preceding a poly(A) tail. Both the 3′ CSE and the poly(A) tail have previously been demonstrated to be required for efficient virus replication; however, the point in virus replication at which they function has not been elucidated (32, 46). The poly(A) tail almost certainly plays a role in the efficiency of translation of viral nonstructural proteins and RNA stability as it does with cellular mRNA; however, it has also been proposed as the site of initiation of minus-strand RNA synthesis (16, 49). While the 3′ CSE is believed to be a core component of the promoter for minus-strand RNA synthesis, its involvement in this process has not been formally demonstrated. Using in vitro and in vivo analyses we demonstrate a requirement for both the 3′ CSE and the poly(A) tail for minus-strand RNA synthesis, indicating that both elements are necessary components of the promoter.

Previously published work has shown that the majority of alphavirus minus-strand RNA has a 5′ end comprised of poly(U) (16, 49). This indicates that minus-strand synthesis is initiated on the 3′ poly(A) tail of the genomic RNA. We have demonstrated that the poly(A) tail is required for efficient minus-strand RNA synthesis and also have shown that there is a minimum size requirement for efficient promotion of RNA synthesis. Shortening the poly(A) tail to less than 25 residues caused a decrease in minus-strand RNA synthesis, and minus-strand synthesis was almost completely inhibited if the poly(A) tail was shortened to 10 or fewer adenylate residues. By systematic interruption of the poly(A) tail we have found that a minimum of 11 to 12 A residues is required immediately 3′ of the 3′ CSE in order to obtain efficient minus-strand RNA synthesis.

The involvement of the poly(A) tail in genome replication has been demonstrated in other viral systems. Initiation of poliovirus minus-strand RNA synthesis occurs in a primer-dependent fashion on the 3′ poly(A) tail (44). Additionally, the poly(A) tail plays an indirect role in recruitment of the replication complex to the 3′ end of the genome. The components of the replication complex bind the 5′ end of the poliovirus genome and are relocated to the 3′ end through protein-protein interaction between poly(C)-binding protein that is associated with the 5′ end of the genome and poly(A)-binding protein (PABP) in complex with the 3′ poly(A) tail (2, 26). Characterization of potexvirus minus-strand RNA synthesis has also shown initiation to occur at multiple sites in the poly(A) tail of the genome (7). Further, studies of potyvirus RdRp have shown a direct interaction between the polymerase and PABP (57). It is therefore becoming apparent that the poly(A) tails of positive-sense RNA viral genomes, and associated proteins, play a significant role in viral RNA replication.

The requirement for 11 or more A residues for efficient SIN minus-strand synthesis is intriguing in that this corresponds to the length of poly(A) required for efficient binding of PABP. Deo et al. demonstrated that the primary RNA recognition motifs of PABP (RRM1 and RRM2) bind with optimal efficiency to A11 or larger (12). The possibility of an interaction between the replication complex and the poly(A) tail, either directly or through PABP, would help to explain how the minus-strand replicase complex, which appears to primarily recognize the 5′ end of the genome, is relocated to the 3′ end in order to initiate minus-strand RNA synthesis (18). While previously published data has shown that the termini of isolated SIN genomic RNA interact through hydrogen bonding, this does not preclude the possibility of a protein-protein or protein-RNA interaction being required to stabilize such a terminal interaction under physiological conditions (15). Alternatively, the termini may stably interact through hydrogen bonding, but appropriate positioning of the replication complex may be mediated by an interaction with the poly(A) tail directly or through PABP.

The conservation of the 3′ CSE across the alphavirus genus indicates its importance in the virus replication cycle (45). While this sequence has always been assumed to be a critical component of the minus-strand promoter, definitive studies demonstrating its requirement during minus-strand RNA synthesis have not been performed. Previous studies by Kuhn et al. demonstrated that mutations within the 3′ CSE had deleterious effects on virus replication (32). In most cases our data correlate well with those of Kuhn et al., in that mutations previously seen to reduce virus replication cause a decrease in the efficiency of minus-strand RNA synthesis. Our data for residues −6 and −7 conflicted with the previous study by Kuhn et al. We saw a significant decrease in minus-strand synthesis if the A residue at −7 was deleted or changed, whereas a full-length viral genome possessing changes to U or G, or with the residue deleted, was capable of producing virus with a wild-type phenotype. We also observed a significant decrease in minus-strand RNA synthesis if the −6 residue was deleted, whereas phenotypically wild-type virus could be recovered from transfected genomic RNA with this deletion. The reasons for this difference are unclear; however, it is possible that second-site changes may have occurred in the genomic RNA possessing the deletion of the −6 residue, allowing wild-type levels of virus replication.

Our analyses clearly show that minus-strand RNA synthesis is compromised when all but one of the 3′-terminal 13 nucleotides of the CSE are altered in any way. The C residue at −6 can be changed but not deleted. Minus-strand RNA synthesis is more tolerant of changes in the 3′ distal residues of the 3′ CSE (−19 to −14). Using the C at −6 and the G at −14 as delineating residues, we propose dividing the 3′ CSE into three regions: a 3′-distal region (−19 to −14), a central region (−13 to −7), and a 3′-proximal region (−5 to −1). Minus-strand RNA synthesis is sensitive to any change in the central region and the 3′ proximal region. These residues presumably play a role in the productive initiation of RNA synthesis; however, their precise role during initiation remains unclear. The requirements for promoting de novo RNA synthesis can be broken into a number of steps: (i) template-polymerase recognition, (ii) promoter localization, (iii) nucleotide substrate recognition, (iv) phosphodiester bond formation, (v) promoter clearance, and (vi) processive elongation. The promoter functions for SIN minus-strand RNA synthesis appear to be divided among different elements in the genome. Primary recognition of the template by the replicase complex appears to be through an interaction with the 5′ end of the genome (18). If, as previously proposed, minus-strand synthesis is initiated on the poly(A) tail, then promoter localization, nucleotide substrate recognition, and initial extension of the nascent strand would be determined by the poly(A) tail (16, 49). This means that it is possible that the 3′ CSE only plays a role in promoter clearance and the transition to productive elongation. However, further mechanistic studies are required to obtain a detailed molecular and biochemical understanding of the promotion of minus-strand RNA.

It is of interest that in the absence of the 3′ CSE a 2× genome length product was observed in vitro; this was probably a product of self-primed copy-back RNA synthesis as its production required the template RNA to have a 3′ OH. The significance of such an RNA species during SIN infection is not known; however, it does suggest a means by which the virus may be able to produce a minus-strand copy of its genome in the absence of the core promoter for minus-strand synthesis.

While our mutagenic analyses of the 3′ CSE were for the most part consistent with the data of Kuhn et al., it initially appeared that they would be hard to reconcile with the findings of George and Raju (20, 32). These investigators had found that virus genomic RNA with deletions of the 3′ CSE was capable of producing virus following transfection. These viruses approximated the wild type in their growth kinetics and plaque size, and maintained the original deletion of the 3′ CSE. We found that minus-strand RNA synthesis was severely inhibited from three RNA templates possessing deletions in the 3′ CSE (Δ−2>−1, Δ−6>−1, and Δ−13>−1) even though genomic RNAs with these same deletions have been reported to support virus replication (20). George and Raju also reported that virus genomic RNA with deletions of the 3′ CSE capable of producing virus had an additional sequence between the remnants of the 3′ CSE and the poly(A) tail. One such RNA had a deletion of the C at the −1 position and an insertion of six U residues between the altered 3′ CSE and the poly(A) tail. We have shown this deletion at position −1 to almost completely inhibit minus-strand RNA synthesis; however, the insertion of six uridylate residues restored template activity to a limited extent.

The addition of U- or A/U-rich sequences to the SIN genome in order to restore RNA synthesis is becoming a common theme. Shirako et al. found that A/U additions to the 5′ end of the genome allowed mutant nsP4 to function in RNA replication (50). These investigators proposed that the change in the 3′ sequence of the minus strand facilitated access to the promoter by the defective RNA polymerase. Further work by Gorchakov et al. has shown that 5′-A/U additions restore RNA synthetic activity to templates possessing non-SIN 5′ sequences (21). These additions restored both minus-strand and plus-strand synthesis from these RNA templates. In the present paper we show that the insertion of a run of uridylate residues between the 3′ CSE and poly(A) tail can, to a limited extent, restore minus-strand RNA synthesis to templates with mutated promoters. Taken together these findings suggest that the replicase/polymerase has an affinity for A/U-rich sequences and the addition of such sequences to a promoter element can restore promoter activity. How these sequences are added to the genome is not known, but an attractive hypothesis is that the polymerase has a propensity for addition of nontemplated nucleotides to the 3′ end of viral RNA with a bias towards A and U, and since the polymerase has a preference for de novo initiation on short stretches of A/U-rich sequence, RNA synthetic activity from a previously inactive template is restored. This may represent a nonspecific genome repair mechanism.

From the work of George and Raju a question arises as to why mutant 3′ sequences that are defective for minus-strand RNA synthesis were maintained over multiple passages of the virus. One explanation is that the virus was passaged at a relatively high multiplicity of infection under noncompetitive conditions. It is possible that low-level production of minus-strand RNA from multiple virus genomes in the same cell could provide enough minus-strand RNA for a productive infection and limit the selective pressure for promoter efficiency. Another possibility is that under noncompetitive conditions very little minus-strand synthesis may be required for these sequences to be maintained in the population. However, one would predict that under conditions in which competitive fitness can be assessed the wild-type sequence would ultimately predominate. It should also be noted that as SIN infects multiple host species there could be more stringent requirements for the wild-type 3′ CSE in other cell types. Previous studies have demonstrated a differential affect of mutations in the 3′-untranslated region on the ability of SIN to replicate in different host cells (31, 32). Further, mutations in this region can alter the efficiency of replication in different tissues of the same host species (31). So while our studies have identified requirements at the 3′ end of the SIN genome for efficient minus-strand RNA synthesis in BHK-21 cells, it is possible that these requirements are different in other cell lines and hosts.

Acknowledgments

The authors thank M. Thal and J. Posto for technical assistance.

This work was supported by grants MCB-0416048 from the National Science Foundation (to R.W.H.) and R37 A124134 from the National Institutes of Health (to C.M.R.).

REFERENCES

  • 1.Agapov, E. V., I. Frolov, B. D. Lindenbach, B. M. Prägai, S. Schlesinger, and C. M. Rice. 1998. Noncytopathic Sindbis virus RNA vectors for heterologous gene expression. Proc. Natl. Acad. Sci. USA 95:12989-12994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Barton, D. J., B. J. O'Donnell, and J. B. Flanegan. 2001. 5′ cloverleaf in poliovirus RNA is a cis-acting replication element required for negative-strand synthesis. EMBO J. 20:1439-1448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Barton, D. J., S. G. Sawicki, and D. L. Sawicki. 1988. Demonstration in vitro of temperature-sensitive elongation of RNA in Sindbis virus mutant ts6. J. Virol. 62:3597-3602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Behrens, S. E., L. Tomei, and R. De Francesco. 1996. Identification and properties of the RNA-dependent RNA polymerase of hepatitis C virus. EMBO J. 15:12-22. [PMC free article] [PubMed] [Google Scholar]
  • 5.Bredenbeek, P. J., I. Frolov, C. M. Rice, and S. Schlesinger. 1993. Sindbis virus expression vectors: packaging of RNA replicons by using defective helper RNAs. J. Virol. 67:6439-6446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chen, J., A. Noueiry, and P. Ahlquist. 2001. Brome mosaic virus protein 1a recruits viral RNA2 to RNA replication through a 5′ proximal RNA2 signal. J. Virol. 75:3207-3219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cheng, J.-H., C.-W. Peng, Y.-H. Hsu, and C.-H. Tsai. 2002. The synthesis of minus-strand RNA of bamboo mosaic potexvirus initiaites from multiple sites within the poly(A) tail. J. Virol. 76:6114-6120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Davis, N. L., N. Powell, G. F. Greenwald, L. V. Willis, B. J. B. Johnson, J. F. Smith, and R. E. Johnston. 1991. Attenuating mutations in the E2 glycoprotein gene of Venezuelan equine encephalitis: construction of single and multiple mutants in a full-length clone. Virology 183:20-31. [DOI] [PubMed] [Google Scholar]
  • 9.Davis, N. L., L. V. Willis, J. F. Smith, and R. E. Johnston. 1989. In vitro synthesis of infectious Venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant. Virology 171:189-204. [DOI] [PubMed] [Google Scholar]
  • 10.de Groot, R. J., W. R. Hardy, Y. Shirako, and J. H. Strauss. 1990. Cleavage-site preferences of Sindbis virus polyproteins containing the nonstructural proteinase: evidence for temporal regulation of polyprotein processing in vivo. EMBO J. 9:2631-2638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Deiman, B. A. L. M., A. K. Koenen, P. W. G. Verlaan, and C. W. A. Pleij. 1998. Minimal template requirements for initiation of minus-strand synthesis in vitro by the RNA-dependent RNA polymerase of turnip yellow mosaic virus. J. Virol. 72:3965-3972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Deo, R. C., J. B. Bonanno, N. Sonenberg, and S. K. Burley. 1999. Recognition of polyadenylated RNA by the poly(A)-binding protein. Cell 98:835-845. [DOI] [PubMed] [Google Scholar]
  • 13.Ding, M., and M. J. Schlesinger. 1989. Evidence that Sindbis virus nsP2 is an autoprotease which processes the virus nonstructural polyprotein. Virology 171:280-284. [DOI] [PubMed] [Google Scholar]
  • 14.Foy, B. D., K. M. Myles, D. J. Pierro, I. Sanchez-Vargas, M. Uhlirova, M. Jindra, B. J. Beaty, and K. E. Olson. 2004. Development of a new Sindbis virus tranducing system and its characterization in three culicine mosquitoes and two lepidoteran species. Insect Mol. Biol. 13:89-100. [DOI] [PubMed] [Google Scholar]
  • 15.Frey, T. K., D. L. Gard, and J. H. Strauss. 1979. Biophysical studies on circle formation by Sindbis virus 49S RNA. J. Mol. Biol. 132:1-18. [DOI] [PubMed] [Google Scholar]
  • 16.Frey, T. K., and J. H. Strauss. 1978. Replication of Sindbis virus: VI. Poly(A) and poly(U) in virus-specific RNA species. Virology 86:494-506. [DOI] [PubMed] [Google Scholar]
  • 17.Frolov, I., E. Agapov, T. A. Hoffman, Jr., B. M. Prágai, M. Lippa, S. Schlesinger, and C. M. Rice. 1999. Selection of RNA replicons capable of persistent noncytopathic replication in mammalian cells. J. Virol. 73:3854-3865. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Frolov, I., R. Hardy, and C. M. Rice. 2001. cis-acting RNA elements at the 5′ end of Sindbis virus genome RNA regulate minus- and plus-strand RNA synthesis. RNA 7:1638-1651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Frolov, I., T. A. Hoffman, B. M. Prágai, S. A. Dryga, H. V. Huang, S. Schlesinger, and C. M. Rice. 1996. Alphavirus-based expression systems: strategies and applications. Proc. Natl. Acad. Sci. USA 93:11371-11377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.George, J., and R. Raju. 2000. Alphavirus RNA genome repair and evolution: molecular characterization of infectious Sindbis virus isolates lacking a known conserved motif at the 3′ end of the genome. J. Virol. 74:9776-9785. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gorchakov, R., R. Hardy, C. M. Rice, and I. Frolov. 2004. Selection of functional 5′ cis-acting elements promoting efficient Sindbis virus genome replication. J. Virol. 78:61-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Griffin, D. E. 2001. Alphaviruses, p. 917-962. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 1. Lippincott Williams and Wilkins, Philadelphia, Pa.
  • 23.Hahn, Y. S., A. Grakoui, C. M. Rice, E. G. Strauss, and J. H. Strauss. 1989. Mapping of RNA− temperature-sensitive mutants of Sindbis virus: complementation group F mutants have lesions in nsP4. J. Virol. 63:1194-1202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hardy, W. R., and J. H. Strauss. 1988. Processing of the nonstructural polyproteins of Sindbis virus: study of the kinetics in vivo using monospecific antibodies. J. Virol. 62:998-1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hardy, W. R., and J. H. Strauss. 1989. Processing the nonstructural polyproteins of Sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans. J. Virol. 63:4653-4664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Herold, J., and R. Andino. 2001. Poliovirus RNA replication requires genome circularization through a protein-protein bridge. Mol. Cell 7:581-591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jacobson, S. J., D. A. M. Konings, and P. Sarnow. 1993. Biochemical and genetic evidence for a pseudoknot structure at the 3′ terminus of the poliovirus RNA genome and its role in viral RNA amplification. J. Virol. 67:2961-2971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kamer, G., and P. Argos. 1984. Primary structural comparison of RNA-dependent polymerases from plant, animal, and bacterial viruses. Nucleic Acids Res. 12:7269-7282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kao, C., and J.-H. Sun. 1996. Initiation of minus-strand RNA synthesis by brome mosaic virus RNA-dependent RNA polymerase: use of oligonucleotide primers. J. Virol. 70:6826-6830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kinney, R. M., G.-J. Chang, K. R. Tsuchiya, J. M. Sneider, J. T. Roehrig, T. M. Woodward, and D. W. Trent. 1993. Attenuation of Venezuelan equine encephalitis virus strain TC-83 is encoded by the 5′-noncoding region and the E2 envelope glycoprotein. J. Virol. 67:1269-1277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kuhn, R. J., D. E. Griffin, H. Zhang, H. G. M. Niesters, and J. H. Strauss. 1992. Attenuation of Sindbis virus neurovirulence by using mutations in nontranslated regions of the genome RNA. J. Virol. 66:7121-7127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kuhn, R. J., Z. Hong, and J. H. Strauss. 1990. Mutagenesis of 3′ nontranslated region of Sindbis virus RNA. J. Virol. 64:1465-1476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kuhn, R. J., H. G. M. Niesters, Z. Hong, and J. H. Strauss. 1991. Infectious RNA transcripts from Ross River virus cDNA clones and the construction and characterization of defined chimeras with Sindbis virus. Virology 182:430-441. [DOI] [PubMed] [Google Scholar]
  • 34.Lemm, J. A., A. Bergqvist, C. M. Read, and C. M. Rice. 1998. Template-dependent initiation of Sindbis virus replication in vitro. J. Virol. 72:6546-6553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lemm, J. A., T. Rümenapf, E. G. Strauss, J. H. Strauss, and C. M. Rice. 1994. Polypeptide requirements for assembly of functional Sindbis virus replication complexes: a model for the temporal regulation of minus and plus-strand RNA synthesis. EMBO J. 13:2925-2934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lewis, D. L., M. A. DeCamillis, C. R. Brunetti, G. Halder, V. A. Kassner, J. E. Selegue, S. Higgs, and S. B. Carroll. 1999. Ectopic gene expression and homeotic transformations in arthropods using recombinant Sindbis viruses. Curr. Biol. 9:1279-1287. [DOI] [PubMed] [Google Scholar]
  • 37.Li, G., and C. M. Rice. 1989. Mutagenesis of the in-frame opal termination codon preceding nsP4 of Sindbis virus: studies of translational readthrough and its effect on virus replication. J. Virol. 63:1326-1337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li, G., and C. M. Rice. 1993. The signal for translational readthrough of a UGA codon in Sindbis virus RNA involves a single cytidine residue immediately downstream of the termination codon. J. Virol. 67:5062-5067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Liljeström, P., S. Lusa, D. Huylebroeck, and H. Garoff. 1991. In vitro mutagenesis of a full-length cDNA clone of Semliki Forest virus: the small 6,000-molecular-weight membrane protein modulates virus release. J. Virol. 65:4107-4113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lundstrom, K. 2001. Alphavirus vectors for gene therapy applications. Curr. Gene Ther. 1:19-29. [DOI] [PubMed] [Google Scholar]
  • 41.Lundstrom, K. 1997. Alphaviruses as expression vectors. Curr. Opin. Biotechnol. 8:578-582. [DOI] [PubMed] [Google Scholar]
  • 42.Miller, W. A., J. J. Bujarski, T. W. Dreher, and T. C. Hall. 1986. Minus-strand initiation by brome mosaic virus replicase within the 3′ tRNA-like structure of native and modified RNA templates. J. Mol. Biol. 187:537-546. [DOI] [PubMed] [Google Scholar]
  • 43.Oh, J.-W., T. Ito, and M. M. C. Lai. 1999. A recombinant hepatitis C virus RNA-dependent RNA polymerase capable of copying the full-length viral RNA. J. Virol. 73:7694-7702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Paul, A. V., J. H. van Boom, D. Filippov, and E. Wimmer. 1998. Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature 393:280-284. [DOI] [PubMed] [Google Scholar]
  • 45.Pfeffer, M., R. M. Kinney, and O.-R. Kaaden. 1998. The alphavirus 3′-nontranslated region: size heterogeneity and arrangement of repeated sequence elements. Virology 240:100-108. [DOI] [PubMed] [Google Scholar]
  • 46.Raju, R., M. Hajjou, K. R. Hill, V. Botta, and S. Botta. 1999. In vivo addition of poly(A) tail and AU-rich sequences to the 3′ terminus of the Sindbis virus RNA genome: a novel 3′-end repair pathway. J. Virol. 73:2410-2419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Rice, C. M., R. Levis, J. H. Strauss, and H. V. Huang. 1987. Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker, and in vitro mutagenesis to generate defined mutants. J. Virol. 61:3809-3819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Sawicki, D. L., D. B. Barkhimer, S. G. Sawicki, C. M. Rice, and S. Schlesinger. 1990. Temperature sensitive shut-off of alphavirus minus strand RNA synthesis maps to a nonstructural protein, nsP4. Virology 174:43-52. [DOI] [PubMed] [Google Scholar]
  • 49.Sawicki, D. L., and P. J. Gomatos. 1976. Replication of Semliki Forest virus: polyadenylate in plus-strand and polyuridylate in minus-strand RNA. J. Virol. 20:446-464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shirako, Y., E. G. Strauss, and J. H. Strauss. 2003. Modification of the 5′ terminus of Sindbis virus genomic RNA allows nsP4 RNA polymerase with nonaromatic amino acids at the N terminus to function in RNA replication. J. Virol. 77:2301-2309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Shirako, Y., E. G. Strauss, and J. H. Strauss. 2000. Suppressor mutations that allow Sindbis virus RNA polymerase to function with nonaromatic amino acids at the N-terminus: evidence for interaction between nsP1 and nsP4 in minus-strand RNA synthesis. Virology 276:148-160. [DOI] [PubMed] [Google Scholar]
  • 52.Shirako, Y., and J. H. Strauss. 1994. Regulation of Sindbis virus RNA replication: uncleaved P123 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from P123 are required for efficient plus-strand RNA synthesis. J. Virol. 68:1874-1885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Singh, R. N., and T. W. Dreher. 1997. Turnip yellow mosaic virus RNA-dependent RNA polymerase: initiation of minus strand synthesis in vitro. Virology 233:430-439. [DOI] [PubMed] [Google Scholar]
  • 54.Strauss, E. G., C. M. Rice, and J. H. Strauss. 1984. Complete nucleotide sequence of the genomic RNA of Sindbis virus. Virology 133:92-110. [DOI] [PubMed] [Google Scholar]
  • 55.Strauss, J. H., and E. G. Strauss. 1994. The alphaviruses: gene expression, replication, evolution. Microbiol. Rev. 58:491-562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Teterina, N. L., D. Egger, K. Bienz, D. M. Brown, B. L. Semler, and E. Ehrenfeld. 2001. Requirements for assembly of poliovirus replication complexes and negative-strand RNA synthesis. J. Virol. 75:3841-3850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wang, X., Z. Ullah, and R. Grumet. 2000. Interaction between zucchini yellow mosaic potyvirus RNA-dependent RNA polymerase and host poly-(A) binding protein. Virology 275:433-443. [DOI] [PubMed] [Google Scholar]
  • 58.You, S., and R. Padmanabhan. 1999. A novel in vitro replication system for Dengue virus. Initiation of RNA synthesis at the 3′-end of exogenous viral RNA templates requires 5′- and 3′-terminal complementary sequence motifs of the viral RNA. J. Biol. Chem. 274:33714-33722. [DOI] [PubMed] [Google Scholar]
  • 59.Zhang, J., I. Frolov, and S. J. Russell. 2004. Gene therapy for malignant glioma using Sindbis vectors expressing a fusogenic membrane glycoprotein. J. Gene Med. 6:1082-1091. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES