Skip to main content
PLOS One logoLink to PLOS One
. 2023 Dec 5;18(12):e0295319. doi: 10.1371/journal.pone.0295319

Isolation, molecular characterization, and genetic diversity of recently isolated foot-and-mouth disease virus serotype A in Egypt

Ramy E El-Ansary 1,*, Samy Kasem 2, Mohamed A M El-Tabakh 1, Yassien Badr 3, Ahmed S Abdel-Moneim 4,*
Editor: Nussieba A Osman5
PMCID: PMC10697586  PMID: 38051725

Abstract

Foot-and-mouth Disease (FMD) is a highly contagious viral disease affecting all hoof-cloven animals. Serotypes A, O and SAT 2 of the foot-and-mouth disease virus (FMDV) are circulating in Egypt. The present study aimed to identify and molecularly characterize the FMDV strains circulating in Northern Egypt during an epidemic that struck the nation in 2022. RNA was extracted from the epithelial specimens, vesicular fluid from affected cattle. The samples were screened using real-time reverse-transcription polymerase chain reaction (RT-PCR) targeting the RNA-dependent RNA polymerase (RdRp) gene. Positive samples underwent individual serotype-specific amplification using primers designed for VP1 of O, A, and SAT 2 serotypes. Subsequently, direct sequencing was performed on the positive samples. The real-time RT-PCR detected positive samples from epithelial and vesicular fluid samples, but not in the blood of infected animals. Out of the 16 samples, seven tested positive for FMDV serotype A. Of these seven positive samples, six were categorized as serotype A-African topotype-G-IV, and these positive samples were isolated in BHK-21 cells, yielding an overt cytopathic effect caused by the virus. In conclusion, it is necessary to sustain continuous surveillance of the evolution of circulating FMDV strains to facilitate the assessment and aid in the selection of vaccine strains for the effective control of FMDV in Egypt.

Introduction

FMD is a highly contagious transboundary viral disease that affects many cloven-hoofed animals. It results in significant economic losses due to reduced milk production, decreased meat output, the mortality of young animals, medical expenses, and restrictions on the transportation of animals from endemic areas [1–3]. Common symptoms include fever, lethargy, loss of appetite, profuse, often frothy, salivation, and the development of vesicles or blisters on the tongue. While some infected animals may be asymptomatic, they can still carry the virus and transmit it to others. The disease is generally not fatal in mature cattle; however, it increases the risk of abortion in pregnant animals [4].

FMDV is a member of the genus Aphthovirus, subfamily Caphthovirinae, of the family Picornaviridae within the order Picornavirales. FMDV is a non-enveloped, single-stranded, positive-sense, non-segmented RNA virus encased in an icosahedral capsid containing around 60 copies of four structural viral proteins (VP1, VP2, VP3, and VP4) [5]. FMDV is divided into seven immunologically distinct serotypes: A, O, C, SAT 1, SAT 2, SAT 3, and Asia 1 [6–8]. Among such serotypes, more than 65 topotypes, genetic lineages, and strains have been identified [5,9]. Africa, Europe-South America (Euro-SA), and Asia are the three recognized topotypes of Serotype A [10,11]. Nucleotide sequences and genetic studies contribute to more than 15% of the genetic variance in viral protein 1 (VP1).

VP1 is responsible for antigenic heterogeneity, serotype specificity, and viral attachment to host cells. The nucleotide and amino acid sequences of VP1 are quite diverse [12]. Because the VP1 coding sequence has been widely employed in molecular epidemiology studies [13], VP1-based diagnostic techniques are widely used [14].

The epidemiology of FMD in Egypt is complicated due to the expansion of local FMD viruses as well as incursions of exotic viral strains from Sub-Saharan Africa and the Middle East [15]. Egypt has been categorized as an FMDV-endemic African nation with many outbreaks since 1958 [16,17]. In Egypt, FMDV serotypes O, A, and SAT2 viruses coexist. According to the World Reference Laboratory for Foot and Mouth Disease (WRLFMD, Pirbright, UK), multiple serotype A topotypes have been reported nationwide. In 2006, the Agriculture Ministry in Egypt notified international public health authorities by reporting to the World Organization for Animal Health of 6 outbreaks of FMDV caused by serotype A in Ismailia and 12 additional outbreaks in 7 other Egyptian governorates; Alexandria, Menofia, Dakahlia, Behera, Dumyat, Fayum and Cairo, during these period the Egyptian and East African strains were comparable [18]. An Asian topotype that fits the Iranian strain (A-Iran-05BAR-08) was originally introduced into Egypt in 2010, and the most recent laboratory report was in 2015 [19]. FMDV serotype A topotype Africa G-IV strain, on the other hand, was discovered in 2012 and has since been reported on several occasions in 2016 and 2018 [19], as well as its dominance in early 2020 [20].

Clinical symptoms are often used to make an initial diagnosis of the condition. Due to natural or vaccine-induced immunity, incomplete symptoms are often ignored in endemic areas [21].

Despite control efforts, various FMDV serotypes and topotypes have been found in Egypt due to live animal and animal product imports and transit, uncontrolled animal movement from neighboring countries, and a lack of quarantine facilities [22]. These factors underscore the importance of continuous monitoring of FMD viral genetic alterations to update FMD vaccine seed strains with currently circulating strains, as well as the need for rapid, reliable, sensitive, and effective diagnostic tests to contain the disease [17].

Real-time RT-PCR (RT-qPCR) is a rapid and highly sensitive molecular diagnostic method for detecting and quantifying nucleic acid targets. Due to its high sensitivity and specificity, it is a serves as a valuable diagnostic tool for FMDV identification [23]. However, achieving significant sensitivity and specificity requires a high degree of complementarity between primers and probes. In the case of FMDV, which exhibits considerable sequence variability, mismatches between primer and probe sequences can result in false-negative results or amplification failure. Therefore, it is essential to regularly review primer and probe sequences to ensure their suitability for their intended purpose [24].

Periodic FMDV mutations lead to significant antigenic changes and the emergence of new topotypes and lineages, potentially resulting immunization failure [25]. Consequently, the development of molecular-based technologies for the early and rapid detection and differentiation of circulating FMDV serotypes is crucial during persistent endemic epidemics [26]. In the current study we aim to genotype FMDV strains from the recent 2022 outbreak in different districts in northern Egypt.

Materials and methods

Animals

Naturally infected cattle show clinical symptoms suggestive of FMD, including salivation, the appearance of vesicles on the tongue and in the mouth, depression, and loss of appetite. Representative samples from examined dairy farms were collected from Behera (n = 8), Kafr El-Sheikh (n = 4), and Gharbiya (n = 4) during the period between July and October 2022. Dairy farms in Behera and Gharbiya were vaccinated with a local polyvalent inactivated vaccine developed by the Veterinary Serum and Vaccine Research Institute (VSVRI) in Cairo, Egypt. In contrast, the vaccine status of animals in Kafr El-Sheikh governorate was unknown.

Samples

The samples were collected and processed in accordance with the World Organization for Animal Health (OIE) standard criteria [27,28]. Briefly, epithelial tissue was collected from an unruptured or recently ruptured vesicle on the tongue or the buccal mucosa and placed in virus transport medium containing penicillin (1000 IU), neomycin sulfate (100 IU), polymyxin sulfate (50 IU), and myostatin (100 IU). Vesicular fluid was aspirated from unruptured vesicles using a sterile needle and transferred to a sterile sample container. All samples were kept in an icebox to maintain the cold chain temperature during transport to the laboratory. Sterile sand was used to crush the tissue samples. A 10-minute centrifugation at 3000 rpm for 10 minutes at 4°C clarified the tissue homogenate. The supernatant was filtered using syringe filters (0.2 μm filter, Corning) and then incubated for three hours at room temperature with a 1% antibiotic solution (100 IU/mL Penicillin and 100 mg/mL Streptomycin). The processed sample solution was then stored at -80°C until virus isolation and molecular analysis.

Virus isolation

In constrained biosafety level-2 environments, the produced materials were injected into the virus-adapted kidney cell line of Baby Hamster Kidney (i.e., BHK-21) and were used for FMDV isolation [29]. Confluent monolayer cell cultures were inoculated with the produced materials, while control cells consisted of non-infected cells. The inoculated cells were cultured in 25 cm^3 cell culture flasks containing Earl’s salts, 10% fetal calf serum, 100 IU/ml penicillin, and 100 mg/ml streptomycin. The growth media supernatant in the flasks was decanted, and the cell monolayer was washed three times with sterile phosphate-buffered saline before gently applying 0.5 ml of the viral sample to the cell monolayer. The flasks were incubated at 37°C for 90 minutes in a 5% CO2-supplied incubator, with gentle tilting every 10 minutes. The flasks were monitored for viral cytopathic effects on the BHK-21 cell monolayer for 24 to 72 hours. When cytopathic effects (CPE) were observed, infected cells were harvested, subjected to three freeze-thaw cycles, and then passaged three times consecutively.

RNA extraction

Viral RNA was extracted using the EasyPure® viral RNA kit (TransGen Biotech, Beijing, China, Cat. No. ER101-01) from a 200 μL processed sample, following the manufacturer’s instructions. Viral RNA was eluted in 30 μL of RNase-free water and stored at -80°C.

FMD screening using real-time RT-PCR (qRT-PCR)

For the detection of FMDV, primers and probes directed toward the conserved 3D gene (conserved catalytic core domain of RNA-dependent RNA polymerase (RdRp)), were used as previously described [29] (Table 1). TransScript® Probe One-Step qRT-PCR SuperMix (TransGen Biotech, Beijing, China, Cat. No. AQ221) was employed for 3D gene amplification, following the manufacturer’s instructions. The cycles consisted of reverse transcription at 45°C for 5 minutes, followed by initial denaturation at 94°C for 2 minutes, with forty cycles of 94°C for 30 seconds and 60°C for 30 seconds. Samples with a cycle threshold (Ct) of fewer than thirty were used for standard one-step RT-PCR.

Table 1. Primers used in real-time RT-PCR of 3D gene, one-step RT-PCR and sequencing reaction of 1D gene of FMDV.

Serotype Primer designation Primer sequence (5’-3’) Amplicon size References
All serotypes
(3D gene)
3D-F ACTGGGTTTTACAAACCTGTGA 106 bp Callahan et al., 2002
3D-R GCGAGTCCTGCCACGGA
3D-Probe TCCTTTGCACGCCGTGGGAC
O O-Egy-F CCTCCTTCAAYTACGGT 283 bp El-mayet et al., 2020
A A-Egy-F GGAATCWGCAGACCCTGTC 750 bp
SAT2 SAT2-Egy-F TGAYCGCAGTACACAYGTYC 666 bp
A,O, and SAT2 NK61–2BR GACATGTCCTCCTGCATCTG -

One-Step Reverse-Transcription Polymerase Chain Reaction (RT-PCR)

The TransScript® One-Step RT-PCR SuperMix amplified the VP1 gene using three selective primers for the three serotypes (A, O, and SAT2) (TransGen Biotech, Beijing, China, Cat. No. AT411) as previously described [30] (Table 1). In summary, a 25 μL PCR reaction mixture consisting of 5 μL of the RNA template, 12.5 μL of the One-Step Reaction Mix, 0.4 μL of the One-Step Enzyme Mix, and 3.1 μL of RNase-free water was combined with 2 μL of each primer (10 pMol) as instructed by the kit manual. The target genes were amplified using a BIO-RAD® PCR system T100 thermocycler (BioRad, Hercules, California, USA). The following conditions were employed for the one-step RT-PCR: 45°C for 25 min (reverse transcription step), 94°C for 5 min (denaturation), followed by 40 repeated cycles of 94°C for 45 sec (denaturation) and 60°C for 1 min (annealing), except for the SAT2-specific detection primer at 50°C for 45 sec (annealing) and 72°C for 45 sec (extension), followed by a final extension at 72°C for 10 min and scheduled for a final hold at 4°C. The PCR results were then subjected to 1.5 percent agarose gel electrophoresis using Tris Borate EDTA buffer (1X) stained with ethidium bromide. The RT-PCR products and DNA ladder were loaded into the appropriate wells, and the agarose gel was examined and analyzed for FMDV-specific bands using the Molecular Imager Gel DocTM XR + Imaging system (BIO-RAD) and Image labTM gel image analysis software. The amplified RT-PCR products were purified from the gel using the QIAquick Gel Extraction Kit (Qiagen, USA, Cat. No. 28704), following the manufacturer’s instructions. The QubitTM dsDNA HS test kit (Molecular Probes, Life Technologies, USA) was used in combination with the Qubit® 2.0 fluorometer for precise DNA quantification.

DNA sequencing

The purified PCR products were sequenced using a dideoxy chain termination approach with the same primers. The sequencing reaction was prepared using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher, USA). For sequencing, the thermal cycling conditions included 96°C for 1 minute, followed by 25 cycles at 96°C for 10 seconds. The T-100TM Thermal Cycler was set to 5 seconds at 50°C and 2 minutes at 60°C (Bio-Rad, USA). The sequencing reaction product was purified using Centri-SepTM Spin Columns (Thermo Fisher, USA), which were then electrokinetically injected into capillary electrophoresis systems 3500 Genetic analyzers (Applied Biosystems, USA).

Phylogenetic analysis

We utilized NCBI’s Basic Local Alignment Search Tool (BLAST) to compare nucleic acid and amino acid sequences. Multisequence alignment was performed using MEGA 5.1. For phylogenetic analysis, we employed the Maximum Likelihood method with 1000 bootstrap replications and applied the Tamura-Nei model [31,32].

Results

Clinical signs

During the outbreak investigation and sample collection, the study population observed salivation and vesicle formations in the oral cavity and interdigital spaces. FMD lesions on the mouth included sores, destruction of the upper and lower pad regions, and tongue lacerations, while foot abrasions included wearing away in the interdigital space. Study groups lagged behind healthy cattle in terms of nutrition and milk output.

Virus isolation

The virus was cultured from seven FMDV-positive samples (six epithelial and one vesicular) selected based on their Ct values. Cytopathogenic effects (CPE) of FMDV on BHK-21 cells were observed as cell rounding, swelling, granulation, and monolayer detachment from the cell culture flask surface. Cells were severely damaged and eventually died within 24–72 hours following injection, indicating the presence of an infectious virus. However, samples with no CPE did not cause any morphologic alterations in BHK-21 cells. Positive viral isolation findings on BHK-21 cells were confirmed using related samples. Ct values varied from 17.21 to 23.38 (Fig 1). However, the remaining FMDV clinical samples (n = 9) did not exhibit any CPE on BHK-21 cells, with Ct values exceeding 29.75.

Fig 1. Isolation of FMDV on BHK-21 cell line.

Fig 1

(a) Control BHK-21 cell line (cell without FMDV infection), (b & c) positive BHK-21 cell line induced CPE inoculated with FMDV outbreak samples with Ct values ranged from 17.21 to 23.38 showing rounding, granulation or swelling.

FMDV screening using qRT-PCR

Using qRT-PCR, the 16 collected samples were screened for FMDV, and seven (43.7 percent) were found to be positive when pan-FMDV 3D primers were used. Positive samples had Ct values ranging from 17.21 to 23.38 (Table 2).

Table 2. Real time reverse transcriptase polymerase chain reaction on clinical samples from affected cattle that showed clinical signs relevant to FMDV infection.

Date of collection Location Sample ID Cycle Threshold (CT)c Molecular Tests results (Blood) Molecular
Tests results
(tissues)
Accession number e
16/07/2022 Behera C1 33.87 Negative Negative -
C2 19.62 Negative Positive OQ316637
C3 31.19 Negative Negative -
23/07/2022 Behera
C4 17.73 Negative Positive OQ316638
C5 33.23 Negative Negative -
C6 29.75 Negative Negative -
C7 30.14 Negative Negative -
28/07/2022 Gharbiya C8 32.35 Negative Negative -
C9 33.45 Negative Negative -
C10a 17.45 Negative Positive OQ316639
12/08/2022 Gharbiya C11 19.59 Negative Positive OQ316633
16/08/2022 Kafr El-Sheikh C12 b 31.12 Negative Negative -
C13 b 17.21 Negative Positive OQ316634
21/08/2022 Kafr El-Sheikh C14 17.59 Negative Positive OQ316635
11/09/2022 Kafr El-Sheikh C15 18.22 Negative Positive OQ316636
14/09/2022 Behera C16d 31.76 Negative Negative -

Samples: Both skin scape from the affected lesion and heparin treated blood were collected from infected animals.

aThe sample was vesicular fluid and heparin treated blood.

bAnimals were vaccinated by locally prepared vaccine except for two farms in Kafr El-Sheikh with unknown vaccination status (b).

d Pregnant animal.

e Accession numbers of the VP1 gene of the samples showed positive in real RT-PCR and positive for serotype specific one-step RT-PCR.

Sequencing and genetic characterization

FMDV-positive qRT-PCR specimens were further investigated using serotypes A, O, and SAT2 specific primers. In cases where samples could not be identified using the previously published serotype-specific primers, all seven pan-FMDV positive isolates were found to be serotype A positive, as confirmed by conventional RT-PCR (Fig 2 and S1 Raw image).

Fig 2. Gel electrophoresis of RT-PCR amplicons of a local FMDV strain from clinically diseased cattle using serotype A specific primers.

Fig 2

Lane M: High molecular weight nucleic acid marker (100 bp); lanes S1-S7, tested samples which are epithelium tissues and vesicular fluid samples collected from different governorates in 2022 from July to October; Lane 8, (N) negative control and Lane 9, (P) positive control for FMDV.

The partial-length of 1D (VP1 protein) gene sequences of 6 out of 7 FMDV isolates obtained in this study was successful (accession numbers OQ316633-OQ316638). BLAST analysis for VP1 encoding of the recently detected and currently circulating Egyptian FMDV.

The strains in our study exhibit a close relationship with sequences of Egyptian FMD viruses of serotype A, subclade IV, isolated between late 2015 and 2022. They were closely related to Egyptian A serotypes (IV subtype) detected in different parts of northern and southern Egypt. Another serotype A FMDV circulating in Egypt includes Asia/Iran-05/BAR-08, GI, G-II, G-III, G-VII and G-VIII. Two strains of FMDV serotype A are in use as seed virus strains of local vaccines, including MT442146|EGY/1/2010, which belongs to the Asia/Iran-05/BAR-08 serotype, and KC440882|EGY 1/2012, which is found to be related to (AY593766|Kitale/KEN/64 | G-VIII) (Fig 3).

Fig 3. Phylogenetic tree of the VP1 nucleotide sequences in comparison to other FMDV serotype A sequences.

Fig 3

Red sequences are related to the vaccines, blue sequences are those identified in the current study. Phylogenetic tree was created using MEGA 5.1 with Maximum Likelihood method with 1000 bootstraps replications.

The strains identified in the current study showed three N-glycosylation sites at positions 43, 85 and 131. All strains in the current study were identical to each other but showed amino acid substitutions to other G-IV subtypes. They exhibited 31 and 32 amino acid substitutions from KC440882|EGY_1/2012 and MT442146|EGY/1/2010, respectively, which also lack the third N glycosylation site present in the current (Fig 3). P149 is present in all strains in the current study (Fig 3). P149S was detected in the two vaccine strains, while P149 to A (three Egyptian strains) and P149T (in a single Egyptian strain) (Fig 4).

Fig 4. Deduced amino acid sequences of the VP1 protein of the strains detected in the current study in comparison to selected FMDV strains and serotype A vaccine sequences.

Fig 4

Dots mean identical sequences. Underlined sequence denotes to N-glycosylation sites. 141–160 is the G-H loop, and 200–211 is the C-terminus area.

Discussion

FMDV genome displays a high mutation rate and evolves rapidly (2, 3), leading to the subsequent emergence of numerous subtypes [33]. Changes in the VP1 hypervariable region result in the evolution of numerous antigenic variants. Serotype A comprises three major subtypes: Africa, Asia, and Euro-SA. The Africa subtype encompasses GI to G-VIII, while the Asia subtype consists of 10 clades: (A15, A22, G-VII, Iran-5, Iran-87, Iran 96, Iran 99, Oak-09, Sea-97, and Thai-87). The Iran-5 clade contains 17 subclades. The Euro-SA subtype is comprised of four clades: A-81, A12, A24, and A5 [11]. The emergence of FMDV variants is accelerated by immune pressure or immune selection during infection of partially immunized animals [33–35].

In Egypt, repeated epidemics of FMD persist despite the intensive use of polyvalent FMDV vaccines, including locally isolated vaccine strains containing serotypes O pan Asian II (EGY/2010), An Iran 05 (A/EGY/1/2012), A/ KC440882|EGY 1/2012, SAT2 (EGY/Gharbia/2012), and SAT2 (LIB/2018). This suggests there may be a vaccination failure. Possible causes of vaccination failure include the presence of immunosuppressive disorders that hinder the animal’s ability to develop a satisfactory immune response, improper storage and transport of the vaccine, and immune evasion due to the presence of different vaccine variants as previously reviewed [36]. This fact means that FMDV continues to be an endemic disease in the country. Immunization efforts have been effective in reducing FMD incidence; however, FMDV strains continue to circulate due to unregulated animal movement. Furthermore, Egypt’s unique geographical location increases the likelihood of the introduction of circulating strains from Asian and East African nations into the country. In the past decade, at least eight FMDV serotype strains have been identified (A, O, and SAT2), including (A-Iran 05, A-African genotype IV, A-African genotype VII, O-Pan Asia II, O East Africa, SAT2 Ghb-12, SAT2 Lib-12, and SAT2 Alx-12) with alternating displacement and an annual winter peak of two to three circulating strains and a dominant circulating strain [30]. According to the first 12 hits of BLAST data from this lineage, all sequenced FMDV isolates in this study were genetically classified as serotype A of genotype IV of the African topotype [37].

Antigenic properties of FMDV strains have been found to be associated with specific amino acid motifs in the VP1 protein: 43–45, 83, 96, 141–160 (G-H loop), 169–173, and 200–211 (C-terminus), as previously determined in serotype A [38–42]. In the current study, current vaccine strains were found to have different amino acid substitutions from the strain identified in the current study, including T133V, T137S, G139T, A140G, N43K, Q83E, S141G, S142D/G, P149S, L154V, and E170T. This highlights the possibility that the current vaccine strains may offer reduced protection against the recent circulating strains. The substitution from P149 to S149 affects the antigenicity of the A22 vaccine [41]. However, sequence homology provides an indication of the relatedness of the virus strains circulating in the region and their relation to the vaccine strains, but it serves as only an indirect guide. Therefore, one should primarily rely on cross-neutralization studies to assess the effectiveness of vaccine coverage and cross-neutralization. The latter is more suitable for determining the efficacy and cross-protection of the vaccines in use.

In conclusion, the current study underscores the ongoing challenges in controlling FMDV infection in Egypt, as it highlights the need for continuous monitoring and vaccine strain selection to effectively manage FMDV in the region.

Supporting information

S1 Raw image. Raw gel electrophoresis of RT-PCR amplicons of a local FMDV strain from clinically diseased cattle using serotype A specific primers.

(JPG)

Acknowledgments

The authors would like to acknowledge the Deanship of Scientific Research, Taif University, Taif 21944, Saudi Arabia for funding this research.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Knight-Jones TJ, Rushton J. The economic impacts of foot and mouth disease–What are they, how big are they and where do they occur? Preventive veterinary medicine. 2013;112(3–4):161–73. doi: 10.1016/j.prevetmed.2013.07.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Diab E, Bazid AI, Fawzy M, El-Ashmawy WR, Fayed AA, El-Sayed MM. Foot-and-mouth disease outbreaks in Egypt during 2013–2014: Molecular characterization of serotypes A, O, and SAT2. Vet World. 2019;12(2):190–7. Epub 2019/05/02. doi: 10.14202/vetworld.2019.190-197 ; PubMed Central PMCID: PMC6460869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Saravanan S, Umapathi V, Priyanka M, Hosamani M, Sreenivasa B, Patel B, et al. Hematological and serum biochemical profile in cattle experimentally infected with foot-and-mouth disease virus. Veterinary World. 2020;13(3):426. doi: 10.14202/vetworld.2020.426-432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Rich KM, Winter-Nelson A. An integrated epidemiological‐economic analysis of foot and mouth disease: Applications to the Southern Cone of South America. American Journal of Agricultural Economics. 2007;89(3):682–97. [Google Scholar]
  • 5.Domingo E, Baranowski E, Escarmís C, Sobrino F. Foot-and-mouth disease virus. Comparative immunology, microbiology and infectious diseases. 2002;25(5–6):297–308. [DOI] [PubMed] [Google Scholar]
  • 6.Brown E, Nelson N, Gubbins S, Colenutt C. Airborne Transmission of Foot-and-Mouth Disease Virus: A Review of Past and Present Perspectives. Viruses. 2022;14(5). Epub 2022/05/29. doi: 10.3390/v14051009 ; PubMed Central PMCID: PMC9145556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Singanallur NB, Eblé PL, Ludi AB, Statham B, Bin-Tarif A, King DP, et al. A Vaccine Based on the A/ASIA/G-VII Lineage of Foot-and-Mouth Disease Virus Offers Low Levels of Protection against Circulating Viruses from the A/ASIA/Iran-05 lineage. Viruses. 2022;14(1). Epub 2022/01/23. doi: 10.3390/v14010097 ; PubMed Central PMCID: PMC8781018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Liu H, Xue Q, Zhu Z, Yang F, Cao W, Liu X, et al. Foot-and-Mouth Disease Virus Inhibits RIP2 Protein Expression to Promote Viral Replication. Virologica Sinica. 2021;36(4):608–22. Epub 2021/01/06. doi: 10.1007/s12250-020-00322-2 ; PubMed Central PMCID: PMC8379319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jamal SM, Belsham GJ. Foot-and-mouth disease: past, present and future. Veterinary research. 2013;44:1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bari FD, Parida S, Tekleghiorghis T, Dekker A, Sangula A, Reeve R, et al. Genetic and antigenic characterisation of serotype A FMD viruses from East Africa to select new vaccine strains. Vaccine. 2014;32(44):5794–800. doi: 10.1016/j.vaccine.2014.08.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.FMDbase. FMDbase: The Pirbright Institute, Ash Road, Pirbright, Woking, GU24 0NF; 2023. Available from: https://www.fmdbase.org/. [Google Scholar]
  • 12.Cottam EM, Wadsworth J, Shaw AE, Rowlands RJ, Goatley L, Maan S, et al. Transmission pathways of foot-and-mouth disease virus in the United Kingdom in 2007. PLoS pathogens. 2008;4(4):e1000050. Epub 2008/04/19. doi: 10.1371/journal.ppat.1000050 ; PubMed Central PMCID: PMC2277462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Knowles NJ, Samuel AR, Davies PR, Midgley RJ, Valarcher JF. Pandemic strain of foot-and-mouth disease virus serotype O. Emerging infectious diseases. 2005;11(12):1887–93. Epub 2006/02/21. doi: 10.3201/eid1112.050908 ; PubMed Central PMCID: PMC3367651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wong CL, Yong CY, Ong HK, Ho KL, Tan WS. Advances in the Diagnosis of Foot-and-Mouth Disease. Frontiers in veterinary science. 2020;7:477. Epub 2020/09/26. doi: 10.3389/fvets.2020.00477 ; PubMed Central PMCID: PMC7473413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tekleghiorghis T, Moormann RJ, Weerdmeester K, Dekker A. Foot-and-mouth Disease Transmission in Africa: Implications for Control, a Review. Transboundary and emerging diseases. 2016;63(2):136–51. Epub 2014/07/24. doi: 10.1111/tbed.12248 . [DOI] [PubMed] [Google Scholar]
  • 16.Vosloo W, Bastos AD, Sangare O, Hargreaves SK, Thomson GR. Review of the status and control of foot and mouth disease in sub-Saharan Africa. Revue scientifique et technique (International Office of Epizootics). 2002;21(3):437–49. Epub 2003/01/14. doi: 10.20506/rst.21.3.1349 . [DOI] [PubMed] [Google Scholar]
  • 17.Hassan AM, El-Mayet FS, El-Habbaa AS, Shahein MA, El Zowalaty ME, Hagag NM, et al. Molecular Characterization of Newly Emerging Foot-and-Mouth Disease Virus Serotype SAT 2 of Lib-12 Lineage Isolated from Egypt. Virus research. 2022;311:198651. Epub 2021/12/09. doi: 10.1016/j.virusres.2021.198651 . [DOI] [PubMed] [Google Scholar]
  • 18.Knowles NJ, Wadsworth J, Reid SM, Swabey KG, El-Kholy AA, Abd El-Rahman AO, et al. Foot-and-mouth disease virus serotype A in Egypt. Emerging infectious diseases. 2007;13(10):1593–6. Epub 2008/02/09. doi: 10.3201/eid1310.070252 ; PubMed Central PMCID: PMC2851527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sobhy NM, Bayoumi YH, Mor SK, El-Zahar HI, Goyal SM. Outbreaks of foot and mouth disease in Egypt: Molecular epidemiology, evolution and cardiac biomarkers prognostic significance. International journal of veterinary science and medicine. 2018;6(1):22–30. Epub 2018/09/27. doi: 10.1016/j.ijvsm.2018.02.001 ; PubMed Central PMCID: PMC6148740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hassan AM, Zaher MR, Hassanien RT, Abd-El-Moniem MI, Habashi AR, Ibraheem EM, et al. Molecular detection, phylogenetic analysis and genetic diversity of recently isolated foot-and-mouth disease virus serotype A African topotype, Genotype IV. Virology journal. 2022;19(1):1. Epub 2022/01/05. doi: 10.1186/s12985-021-01693-y ; PubMed Central PMCID: PMC8722054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kitching RP. Identification of foot and mouth disease virus carrier and subclinically infected animals and differentiation from vaccinated animals. Revue scientifique et technique (International Office of Epizootics). 2002;21(3):531–8. doi: 10.20506/rst.21.3.1365 [DOI] [PubMed] [Google Scholar]
  • 22.Kandeil A, El-Shesheny R, Kayali G, Moatasim Y, Bagato O, Darwish M, et al. Characterization of the recent outbreak of foot-and-mouth disease virus serotype SAT2 in Egypt. Arch Virol. 2013;158(3):619–27. Epub 2012/11/08. doi: 10.1007/s00705-012-1529-y . [DOI] [PubMed] [Google Scholar]
  • 23.Abd El-Rhman M, Salem S, Bazid A, El-Hassan DA. Molecular and serological typing of foot-and-mouth disease virus serotypes currently circulating in Egypt. Iraqi Journal of Veterinary Sciences. 2021;35(3):581–8. [Google Scholar]
  • 24.Howson ELA, Orton RJ, Mioulet V, Lembo T, King DP, Fowler VL. GoPrime: Development of an In Silico Framework to Predict the Performance of Real-Time PCR Primers and Probes Using Foot-and-Mouth Disease Virus as a Model. Pathogens (Basel, Switzerland). 2020;9(4). Epub 2020/04/25. doi: 10.3390/pathogens9040303 ; PubMed Central PMCID: PMC7238122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.El Damaty HM, Fawzi EM, Neamat-Allah ANF, Elsohaby I, Abdallah A, Farag GK, et al. Characterization of Foot and Mouth Disease Virus Serotype SAT-2 in Swamp Water Buffaloes (Bubalus bubalis) under the Egyptian Smallholder Production System. Animals: an open access journal from MDPI. 2021;11(6). Epub 2021/07/03. doi: 10.3390/ani11061697 ; PubMed Central PMCID: PMC8228956. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Le VP, Lee KN, Nguyen T, Kim SM, Cho IS, Van Quyen D, et al. Development of one-step multiplex RT-PCR method for simultaneous detection and differentiation of foot-and-mouth disease virus serotypes O, A, and Asia 1 circulating in Vietnam. Journal of virological methods. 2011;175(1):101–8. Epub 2011/05/10. doi: 10.1016/j.jviromet.2011.04.027 . [DOI] [PubMed] [Google Scholar]
  • 27.WOAH. Foot and mouth disease—WOAH—World Organisation for Animal Health 2022. [updated Aug. 14, 2022)Aug. 14, 2022]. Available from: https://www.woah.org/en/disease/foot-and-mouth-disease/ [Google Scholar]
  • 28.Bonbon E. A framework for national official assurance systems with reference to World Organisation for Animal Health standards. Revue scientifique et technique (International Office of Epizootics). 2020;39(1):193–200. Epub 2020/07/31. doi: 10.20506/rst.39.1.3072 . [DOI] [PubMed] [Google Scholar]
  • 29.Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, et al. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. Journal of the American Veterinary Medical Association. 2002;220(11):1636–42. Epub 2002/06/08. doi: 10.2460/javma.2002.220.1636 . [DOI] [PubMed] [Google Scholar]
  • 30.El-mayet FS, Sharawy S, El-Habbaa AS, Shahen N, Hagag N. Rapid detection and isolation of Foot and Mouth Disease Virus in samples from clinically suspected animals in Egypt during 2016–2019. Benha Veterinary Medical Journal. 2020;39(1):135–40. [Google Scholar]
  • 31.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution. 2011;28(10):2731–9. doi: 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. evolution. 1985;39(4):783–91. doi: 10.1111/j.1558-5646.1985.tb00420.x [DOI] [PubMed] [Google Scholar]
  • 33.Weddell GN, Yansura DG, Dowbenko DJ, Hoatlin ME, Grubman MJ, Moore DM, et al. Sequence variation in the gene for the immunogenic capsid protein VP1 of foot-and-mouth disease virus type A. Proceedings of the National Academy of Sciences. 1985;82(9):2618–22. doi: 10.1073/pnas.82.9.2618 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.McCahon D. The genetics of aphthovirus. Archives of Virology. 1981;69:1–23. [DOI] [PubMed] [Google Scholar]
  • 35.Sobrino F, Dávila M, Ortín J, Domingo E. Multiple genetic variants arise in the course of replication of foot-and-mouth disease virus in cell culture. Virology. 1983;128(2):310–8. doi: 10.1016/0042-6822(83)90258-1 [DOI] [PubMed] [Google Scholar]
  • 36.Singh RK, Sharma GK, Mahajan S, Dhama K, Basagoudanavar SH, Hosamani M, et al. Foot-and-Mouth Disease Virus: Immunobiology, Advances in Vaccines and Vaccination Strategies Addressing Vaccine Failures-An Indian Perspective. Vaccines. 2019;7(3). Epub 2019/08/21. doi: 10.3390/vaccines7030090 ; PubMed Central PMCID: PMC6789522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Abd El Rahman S, Hoffmann B, Karam R, El-Beskawy M, Hamed MF, Forth LF, et al. Sequence analysis of egyptian foot-and-mouth disease virus field and vaccine strains: intertypic recombination and evidence for accidental release of virulent virus. Viruses. 2020;12(9):990. doi: 10.3390/v12090990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mahapatra M, Statham B, Li Y, Hammond J, Paton D, Parida S. Emergence of antigenic variants within serotype A FMDV in the Middle East with antigenically critical amino acid substitutions. Vaccine. 2016;34(27):3199–206. Epub 2016/03/27. doi: 10.1016/j.vaccine.2016.02.057 ; PubMed Central PMCID: PMC4912224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Thomas AA, Woortmeijer RJ, Puijk W, Barteling SJ. Antigenic sites on foot-and-mouth disease virus type A10. Journal of virology. 1988;62(8):2782–9. Epub 1988/08/01. doi: 10.1128/JVI.62.8.2782-2789.1988 ; PubMed Central PMCID: PMC253712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Baxt B, Vakharia V, Moore DM, Franke AJ, Morgan DO. Analysis of neutralizing antigenic sites on the surface of type A12 foot-and-mouth disease virus. Journal of virology. 1989;63(5):2143–51. Epub 1989/05/01. doi: 10.1128/JVI.63.5.2143-2151.1989 ; PubMed Central PMCID: PMC250631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ludi AB, Horton DL, Li Y, Mahapatra M, King DP, Knowles NJ, et al. Antigenic variation of foot-and-mouth disease virus serotype A. The Journal of general virology. 2014;95(Pt 2):384–92. Epub 2013/11/05. doi: 10.1099/vir.0.057521-0 ; PubMed Central PMCID: PMC7346513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bae S, Li V, Hong J, Kim JN, Kim H. Phylogenetic and evolutionary analysis of foot-and-mouth disease virus A/ASIA/Sea-97 lineage. Virus genes. 2021;57(5):443–7. Epub 2021/07/15. doi: 10.1007/s11262-021-01848-7 ; PubMed Central PMCID: PMC8445868. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Raw image. Raw gel electrophoresis of RT-PCR amplicons of a local FMDV strain from clinically diseased cattle using serotype A specific primers.

(JPG)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLOS ONE are provided here courtesy of PLOS

RESOURCES