Codonopsis pilosula polysaccharide alleviates rotenone-induced murine brain organoids death through downregulation of gene body DNA methylation modification in the ZIC4/PGM5/CAMTA1 axis

Abstract

Here, the protective mechanism of Codonopsis pilosula polysaccharide (CpP) against mouse brain organoids (mBO) damage was analyzed, and the rotenone affected the genomic epigenetic modifications and physiological activity of mouse brain organoids was examined. Pathological experiments have shown that rotenone significantly damaged the subcellular organelles of mouse brain organoids. According to RRBS-Seq, rotenone significantly promoted gene body hypermethylation modifications in mouse brain organoids. Molecular biology experiments have confirmed that rotenone significantly promoted the hypermethylation modification of Zic4, Pgm5, and Camta1 gene bodies in mouse brain organoids, and their expression levels were significantly lower than those of the control group. Bioinformatic analysis suggested that multiple binding motif of transcription factors ZIC4 (Zinc finger protein of the cerebellum 4) were present at the promoters of both the Pgm5 (Phosphoglucomutase 5) and Camta1 (Calmodulin binding transcription activator 1) genes. When the expression of Zic4 was silenced, the proliferation of mouse brain organoids was significantly reduced and the expression level of PGM5 was also significantly decreased. In addition, Codonopsis pilosula polysaccharide treatment of mouse brain organoids significantly reduced the cytotoxicity of rotenone, promoted cell cycle progression, increased intracellular glutathione activity, significantly induced the demethylation modification of the Zic4, Pgm5, and Camta1 gene bodies, and promoted the high expression of ZIC4 and PGM5. Therefore, the study confirmed that Codonopsis pilosula polysaccharide alleviated rotenone-induced mouse brain organoids death by downregulating DNA gene bodies methylation modification of the Zic4/Pgm5/Camta1 axis.

Highlights

• •The subcellular organelle damage of mBOs is promoted with rotenone.
• •DNA hypermethylation modification in mBO gene bodies is promoted with rotenone.
• •Silencing Zic4 expression impaired the proliferative activity of mBOs.
• •CpP improves cytotoxicity and DNA methylation of mBOs by CpP.

Abbreviation list:

CpP

Codonopsis pilosula polysaccharide

mBOs

Mouse brain organoids

ZIC4

Zinc finger protein of the cerebellum 4

Pgm5

Phosphoglucomutase 5

Camta1

Calmodulin binding transcription activator 1

NADH

Nicotinamide adenine dinucleotide dehydrogenase

Sirt1

Sirtuin 1

TNF-α

Tumor necrosis factor alpha

IL-6

Interleukin-6

NF-κB

Nuclear factor kappa B

PP2A

Phosphatase 2A

qPCR

Quantitative real-time reverse transcription PCR

MTT

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-bromide

ATP

Adenosine triphosphate

MDA

Malondialdehyde

TBA

Thiobarbituric acid

SDS-PAGE

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis

PVDF

Polyvinylidene fluoride

TBST

Tris-buffered saline-Tween 20

ECL

Enhanced chemiluminescence

RRBS-Seq

Reduced-representation bisulfite sequencing

MS-PCR

Bisulfite conversion of genomic DNA and methylation-specific PCR

Foxo6

Forkhead box O6

Nkx6-2

NK6 homeobox 2

Nr5a1

Nuclear receptor subfamily 5 group A member 1

ChAT

Choline O-acetyltransferase

Tuj1

Tubulin III antibody

TH

Tyrosine hydroxylase

siRNA

Small interfering RNA

1. Introduction

Rotenone (C₂₃H₂₂O₆), (2R,6aS,12aS)-1,2,6,6a,12,12a-hexahydro-2-isopropenyl-8,9-dimethoxychromeno(3,4-b)furo(2,3-h)chromen-6-one, is found in the roots of the legume genus. This organic substance is also found in Chinese herbs, including sunflower seeds, bitter sandalwood, and Kunming spatholobi roots. During air exposure, it becomes oxidized and precipitates as dehydrorotenone [1]. It is toxic to insects and when it enters their body, it inhibits their mitochondrial electron respiratory chain in cells. As a result, it causes respiratory disorders, including respiratory distress and convulsions, paralysis, retardation, and death [2]. Early studies found that the mechanism of action of rotenone mainly affects insect respiration by interacting with the components between nicotinamide adenine dinucleotide dehydrogenase (NADH) and coenzyme Q. Mitochondria, NADH dehydrogenase, succinate, mannitol, and other substances in cells are susceptible to rotenone [[3], [4], [5], [6], [7]]. Rotenone has been used as a snail-killing agent during the capture of ornamental fish [8]. Other than its toxicity to aquatic animals and insects, rotenone was considered safe for humans, the environment, and animals [[3], [4], [5], [6], [7]]. Although some studies found that rotenone is highly toxic to livestock, silkworm, fish, and rodents (notably, neurotoxicity and reproductive toxicity, other studies reported it as safe for humans and animals [[3], [4], [5], [6], [7],9]. Our previous results shown that rotenone induced apoptosis of dopamine neurons by targeting and regulating sirtuin 1 (Sirt1) and histone H3K9 acetylation modifications and enhanced the transcriptional activity of the P53 gene [10]. Our study tentatively indicated that rotenone was epigenetically toxic to cells; however, the specific molecular mechanisms and regulatory targets remained mostly unknown. Because rotenone is frequently used in aquaculture and agriculture to remove pests and snails, it has led to a significant increase in the probability of its contamination of soil and groundwater sources [11]. Rotenone, therefore, has posed a significant threat to environmental ecological health and become a potential environmental toxin.

Codonopsis pilosula is classified as a traditional Chinese herbal medicine [[12], [13], [14]]. Codonopsis pilosula, a perennial herb of the genus Codonopsis in the family Campanulaceae, has anti-aging, antioxidant, and immune-enhancing properties [[12], [13], [14]]. Codonopsis is rich in polysaccharides, saponins, sesquiterpenes, polyacetylene, alkaloids, polyphenolic glycosides, essential oils, and phytosterols [[12], [13], [14]]. The primary active component of Radix et Rhizoma Ginseng is Codonopsis pilosula polysaccharide (CpP) [[12], [13], [14]]. The chemical structure of Codonopsis pilosula polysaccharide (CpP) is mainly composed of galactose rhamnose arabinose (1.12:1.00:1.0) monosaccharides [[12], [13], [14]]. Codonopsis pilosula polysaccharide can minimize intracellular oxidative stress damage and hinder amyloid beta (Aβ)-induced neurotoxicity. According to Hu et al., by modulating the CD38/NAD + signaling pathway, Codonopsis pilosula polysaccharide alleviated Aβ1-40-induced PC12 cell energy dysmetabolism [15]. Qin et al. found that Codonopsis pilosula polysaccharide induced the secretion of tumor necrosis factor alpha (TNF-α) and interleukin (IL)-6 and improved the phagocytic index of peritoneal macrophages. In addition, Codonopsis pilosula polysaccharide improved the translocation of the NF-κB p65 subunit into the nuclei of macrophages and increased nuclear factor kappa B (NF-κB) inhibitor alpha (IκB-α) degradation [16]. Zhang et al. proposed that Codonopsis pilosula polysaccharide could prevent Alzheimer's disease–like Tau hyperphosphorylation by activating protein phosphatase 2A (PP2A). They also suggested that Codonopsis pilosula polysaccharide could restore synaptic plasticity and synaptogenesis, thus attenuating Alzheimer's disease-like cognitive impairments [17]. These studies have identified the role of Codonopsis pilosula polysaccharide in mitigating and ameliorating neuronal toxicity.

Organoids are 3D culture systems that induce targeted differentiation of stem cell populations into a class of tissues and organs in vitro. Because organoids can reproduce some of their functions, they provide a highly physiologically relevant system, which shares a similar spatial organization to their counterpart organs [[18], [19], [20]]. Tissue samples with single adult stem cells or adult stem cells, or those obtained by directly inducing differentiation of pluripotent stem cells, can generate organoids [19,20]. Organoids are complementary to animal model systems and 2D cell culture methods [19,20]. This class of model biological tools holds significant potential in the fields of efficacy testing and drug toxicity, developmental biology, and toxicology studies [[21], [22], [23]]. Organoid cultures have been used for several types of tissues, including liver [21,24,25], intestinal [26,27], kidney [21,24,25], pancreas [24], lung [28], prostate [29], optic cup [30], and the brain [31,32]. Few studies to date, however, have applied organoids to ecotoxicology and environmental pollution.

DNA methylation is a major epigenetic form of mammalian gene expression regulation and a frequent modification in eukaryotic cells [[33], [34], [35]]. DNA methylation requires covalent bonding between a methyl group and the cytosine fifth carbon atom of the genomic CpG dinucleotide, which is catalyzed by a DNA methylation transferase [[33], [34], [35]]. DNA methylation transforms the chromatin structure, DNA stability, and DNA conformation. Because it also changes how DNA interacts with proteins, it is able to control gene expression [[33], [34], [35]]. DNA methylation commonly is found in the CpG island region of the promoter of a gene, specifically in the first exon region or in the 5′ noncoding region [[33], [34], [35]]. DNA methylation often stops gene transcription and reduces expression levels. According to Freeman et al., non-germline allele-specific DNA methylation was conserved between human and mouse genomes. This verified the sensitivity of allele-specific DNA methylation to environmental factors, including rotenone. By disrupting neuronal development, DNA methylation might mediate the chance of neurological disease [36]. Furthermore, Scola et al. showed that rotenone increased 5-methylcytosine and hydroxymethylcytosine levels and thus reduced ATP production and mitochondrial complex I activity. This result suggested the likely association between DNA alterations and complex I dysfunction [37]. Several reports have revealed a close association between rotenone and the epigenetic regulation of DNA methylation modifications in the mammalian genome; however, mechanistic findings remain unreported.

In this study, the ameliorative mechanism of Codonopsis pilosula polysaccharide on rotenone-induced neurotoxicity of mouse brain organoids (mBOs) from epigenetic and cell biological perspectives was interpreted.

2. Materials and methods

2.1. Mouse brain organoids established

The NE-4C cell line was cultrued until it was full-grown, digested it with Accutase, and collected the cell precipitates, following prior research [38,39]. The cell precipitate with 0.5 mL of ice-pre-cooled basal medium was resuspended and 0.5 mL of ice-pre-cooled Matrigel was added. Then the precipitate was well blown and mixed. A controlled rate of about 0.1 mL per drop to add the cell suspension dropwise to a nonadherent cell culture dish. The cell culture incubator was used at 37 °C with 5 % CO₂ to incubate the suspension for 15 min. Next, 4 mL of pre-warmed basal medium was added at 37 °C and a cell culture incubator was added at 37 °C with 5 % CO₂ to incubate the suspension. After 2 days, the original medium was discarded and 4 mL of induction medium 1 was added. Incubation continued for 2 days. Then the induction medium was discarded and 4 mL of induction medium 2 was added. Incubation continued for 3 days. Then the medium was discarded and 4 mL of induction medium 2 was added. Incubation continued for 3 days. Then the medium was discarded and 4 mL of induction medium 2 was added. The culture was continued for about 10 days. At the point, the obvious formation of clonal spheres of cells was observed. The basal medium was composed of the following: advanced Dulbecco’s modified Eagle’s medium (DMEM)-F12 (83 mL), fetal bovine serum (FBS) (15 mL), Penicillin-streptomycin 1 mL, and l-glutamine 1 mL. Induction medium 1 included the following: advanced DMEM-F12 (80 mL), FBS (15 mL), Penicillin-streptomycin (1 mL), l-glutamine (1 mL), B27 supplement (2 mL), N2 supplement (1 mL), Activin A 10 ng/mL, basic fibroblast growth factor (bFGF; 10 ng/mL), epidermal growth factor (EGF; 10 ng/mL), retinoic acid (RA; 10 ng/mL), vascular endothelial growth factor (VEGF; 10 ng/mL), and Ascorbic acid 50 ng/mL. Induction medium 2 including the following: advanced DMEM-F12 (75 mL), FBS (15 mL), Penicillin-streptomycin (1 mL), l-glutamine (1 mL), B27 supplement (2 mL), N2 supplement (1 mL), Activin A 10 ng/mL, bFGF 10 ng/mL, EGF 10 ng/mL, VEGF 10 ng/mL + Ascorbic acid 50 ng/mL, recombinant insulin-like growth factor (R3-IGF-1; 10 ng/mL), hydrocortisone (10 ng/ml), and heparin (10 ng/mL).

2.2. Rotenone and Codonopsis pilosula polysaccharide treatment

Previous studies have examined the amount of rotenone and Codonopsis pilosula polysaccharide needed to treat mouse brain organoids [9,10,15]. Results have shown that the concentration of Codonopsis pilosula polysaccharide (Sigma-Aldrich) was 50 μg/mL and the concentration of rotenone (Sigma-Aldrich) was 1.0 μmol. The mouse brain organoids were treated with rotenone and Codonopsis pilosula polysaccharide immediately after 10 days of clonal spheres formation.

2.3. siRNA transfections

Briefly, siRNA-Zic4 and random control (siRNA-Mock) oligoRNAs were synthesized by Genepharma (Genepharma, Shanghai, China). The mouse brain organoids group were conducted to transfer 1.0 μg siRNA-Zic4 or siRNA-Mock, respectively, with Lipofectamine 2000 Reagent according to the manufacturer's protocol.

2.4. RNA extraction and quantitative real-time reverse transcription PCR (qPCR)

The mouse brain organoids grouping and drug treatment concentration were Rotenone treated group (Rot, 1.0 μmol), DMSO treated group (1 μL). All groups are continuously cultured for 24 h. Each group suspension was centrifuged was centrifuged at 15,00×g at 4 °C for 5 min, and the supernatant was discarded. The TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA) was used to perform RNA extraction following the manufacturer’s instructions [40]. The DNase I (Sigma-Aldrich) was used to treat total RNA and used a NanoDrop 1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) to determine the RNA concentration, The ultraviolet (UV) absorbance at 260 nm was measured. The MMLV reverse transcriptase (Promega, Madison, WI, USA) to subject total RNA (1–2 μg) was used to reverse transcription for cDNA synthesis. The 0.5 μg of oligo dT18 was added to each tube. Then, the samples for 5 min were incubated at 70 °C to melt the secondary structures within the template. Then, the mixture was immediately placed on ice. A mixture including 5 μL of MMLV 5 × reaction buffer and 1.25 μL of 10 mM dNTP mixture, 25 U of ribonuclease inhibitor (Sigma), 200 U of MMLV (Promega), and RNase-free water were used to adjust the final volume to 25 μL to perform reverse transcription. The cDNA synthesis was achieved by incubation for 60 min at 42 °C and 5 min for 95 °C. The cDNA was stored at −20 °C. A RealPlex4 real-time PCR detection system (Eppendorf Co. LTD, Hamburg, Germany) with SYBR Green Real-Time PCR Master Mix (Toyobo (Shanghai) Biotech Co., Ltd., Shanghai, China) was used to perform the qPCR step of the qPCR protocol. The qPCR reaction included 40 cycles of initial denaturation at for 15 s at 95 °C, annealing for 30 s at 58 °C, and extension for 42 s at 72 °C. The 2-^ΔΔCt method was used to measured relative gene expression levels (ΔCt = Ct_genes- Ct_18SrRNA and ΔΔCt = ΔCt_all_groups-ΔCt_control_group). The mRNA expression levels based on 18S rRNA expression level were corrected. The qPCR primers are as follows: Cyb5b-FP: GAGCCCTCCGTCACCTACTA; Cyb5b-RP: AGCTTTCAGTTGCATCAGCAC; Odc1-FP: GACGAGTTTGACTGCCACATC; Odc1-RP: CGCAACATAGAACGCATCCTT; Esrrg-FP: AAGATCGACACATTGATTCCAGC; Esrrg-RP: CATGGTTGAACTGTAACTCCCAC; Nudt17-FP: AGTCAGTGAGCTTCACACAGA; Nudt17-RP: GGGAATGGATTGCTAGAGAGGAC; Ggta1-FP: GGTGGTTCCCAAGCTGGTTTA; Ggta1-RP: CGGGCGGTTCTTTGGATTGA; Foxo6-FP: CCCCGGACAAGAGACTCAC; Foxo6-RP: CGACAGGTTGTGCCGAATG; Pgm5-FP: GTTGCCAATGGAGGTCCTG; Pgm5-RP: CTTCCCAGTCGAGATAGGTCA; Nkx6-2-FP: AAGTCTGCCCCGTCTCAAC; Nkx6-2-RP: GGTCTGCTCGAAAGTCTTCTC; Mpped1-FP: ATCATCGAGGTGGACGAATACA; Mpped1-RP: GGATCTGTCCTTGAGTGAGTGT; Camta1-FP: GAGGTGCTACTGGCTCCTTC; Camta1-RP: CCCACTCCTTCTTGTCGGT; Alx3-FP: GCTACCAGTGGATTGCCGAG; Alx3-RP: GCTCCCGAGCATACACGTC; Nr5a1-FP: CCCAAGAGTTAGTGCTCCAGT; Nr5a1-RP: CTGGGCGTCCTTTACGAGG; Hs3st4-FP: TGGTGGTACGAAACCCAGTG; Hs3st4-RP: CAAAGCATAGATCCCAATGCGA; Zic4-FP: CACCGCTTCTCATGCACGTTA; Zic4-RP: GCAGGAGTCCGTTCAAAGGA; WDR70-FP: GAATCCGTAACTACTGTGGACG; WDR70-RP: GTGTTATCTCATGCGAGTCAGG; C14orf39-FP: TCTGGCTCTAGGATCAGGCC; C14orf39-RP: AGTTCTATTTCTCTTCTGATCCTCCT; RAD50-FP: TCCCGGATCGAAAAGATGAGC; RAD50-RP: CTCGCCTCAGGACTTACCG; ATM-FP: GATCTGCTCATTTGCTGCCG; ATM-RP: GTGTGGTGGCTGATACATTTGAT; SMARCAD1-FP: CTTCGGCCCTTTGTGTTCC; SMARCAD1-RP: TGACAGCTTTCAATGAACTAGCC; RBBP8-FP: AATGGTCAACAGGATCAAGTAGC; RBBP8-RP: GTAGCCGGTTAATGCCAGAAAA; MRE11-FP: CCTCTTATCCGACTACGGGTG; MRE11-RP: ACTGCTTTACGAGGTCTTCTACT; BRCA1-FP: CGAATCTGAGTCCCCTAAAGAGC; BRCA1-RP: AAGCAACTTGACCTTGGGGTA; NBN-FP: GATCAGTCAATCAGTCGAAACCA; NBN-RP: CCAAGGGCTCGTATTCTACTCTG; RNF138-FP: CCTGTCAGCACGTTTTCTGTA; RNF138-RP: CCACGACATAGGGGACAATGTA; HELB-FP: CTGCACCCGTACAAGAGCG; HELB-RP: TCATCAGGGATAGACACTCGC; DNA2-FP: GGGTGGAGCTACTTCGGAAGA; DNA2-RP: CTCCTCGGCTCAGAACTGTCT; BARD1-FP: AAGGAGCCCGTGTGCTTAG; BARD1-RP: TTGCCCTAGATGTGTTGTCTTTT; UBE2V2-FP: AGGTGATGGTACTGTTAGCTGG; UBE2V2-RP: TTGGTGGCCCAATAATCATGC; BLM-FP: AGCGACACTCAGCCAGAAAAC; BLM-RP: GCCTCAGACACGTTCACATCTT; BRIP1-FP: TACTCTGGCTGCAAAGTTATCTG; BRIP1-RP: TCGTGCATCTACATGGTGGAC; SPO11-FP: GCGTGGCCTCTAGGTTTGAT; SPO11-RP: CTGATTTTGGTGAATCGCTTCTG; EXD2-FP: TATGGAGGCAGAACACTACCC; SLX1B-FP: TCTGCCCCTAGAGGGACATTG; SLX1B-RP: CAACCAGGTTTCCCCAAAGTAG; KAT5-FP: TCCCGGTCCAGATCACACTC; KAT5-RP: ACCTTCCGTTTCGTTGAGCG; SLX4-FP: GGCCCTGATTTTACCAGGTGG; SLX4-RP: GGCTGCTGTTTCCTTGATGG; SETMAR-FP: AGATAGCAGCATCTGAGGAGG; SETMAR-RP: TCCAGGTCCAGCGACATGA; UBE2N-FP: GCTGGCAGAACCAGTTCCT; UBE2N-RP: TCCCTCAAAGGGGGAATCCTG; 18SrRNA-FP: AGGGGAGAGCGGGTAAGAGA; 18SrRNA-RP: GGACAGGACTAGGCGGAACA.

2.5. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-bromide (MTT) assay

The 96-well cell culture plates were used to inoculate 500/mL mouse brain organoids. The mouse brain organoids grouping and drug treatment concentration were Rotenone and DMSO treated group(Rot + DMSO, 1.0 μmol and 1 μL), Rotenone and Codonopsis pilosula polysaccharide treated group (Rot + CpP, 1.0 μmol and 50 μg/mL). All groups are continuously cultured for 72 h, with a detection time point every 24 h 10 μL of MTT solution (Sigma-Aldrich) was added to each group of cells after 24 h and the cells were incubated for 3 h at 37 °C. The medium were discarded and 150 μL of dimethyl sulfoxide (DMSO) (Sigma-Aldrich) was added to each well, which was then shaken and mixed for 15 s. The cell culture plates were placed in a plate reader and recorded the absorbance values at 450 nm. The cell proliferation inhibition rate (%) was calculated as follows: (1-cell OD of experimental group/cell OD of control group) × 100 %.

2.6. Adenosine triphosphate assay

The manufacturer's protocol from the Enhanced Adenosine Triphosphate (ATP) Assay Kit (Beyotime, Shanghai, China) [41] was used to perform the ATP assay. The mouse brain organoids grouping and drug treatment concentration were Rotenone treated group (Rot, 1.0 μmol), DMSO treated group (1 μL). All groups are continuously cultured for 24 h. Each group suspension was centrifuged was centrifuged at 15,00×g at 4 °C for 5 min, and the supernatant was discarded. 200 μL of the sample lysate was added to 1 × 10⁶ cells/mL and thoroughly mixed the sample by pipetting it up and down. The mixture was centrifuged at 12,000×g at 4 °C for 5 min and the supernatant was collected. The ATP standard solutions was set up as follows: 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μM. The solutions with the samples were simultaneously tested and ATP testing solution (100 μL) was added to each of the testing wells and standard wells. 20 μL of the test sample or standard solution was added to the wells and rapidly mixed them. After 5 s at room temperature, a luminometer was added to measure the relative light unit (RLU) values.

2.7. Malondialdehyde assay

The malondialdehyde Assay Kit (Abcam; # ab118970) was used to assess the relative malondialdehyde (MDA) concentration in cell or tumor lysates following the manufacturer's instructions. To generate a reddish-pink MDA-TBA adduct (called TBARS), which could be detected spectrophotometrically at 532 nm, the MDA was reacted in the sample with thiobarbituric acid (TBA). To detect lipid peroxidation in the cells, C11-BODIPY dye (Thermo Fisher Scientific, Waltham, MA, USA) was used. The fluorescence emission peak shifted from approximately 590 to approximately 510 nm because of oxidation of the polyunsaturated butadienyl portion of the dye.

2.8. Western blotting

The 12 % denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were used to separate total proteins from each group of cells and then transferred the cells to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). After blocking and washing, we incubated primary antibodies (Rabbit anti-PGAM5 (Long Isoform) Antibody (#24584), Mouse anti-Zic4 (RY-6) Antibody (sc-101202), Mouse anti-GAPDH Antibody (ab8245), all antibodies were purchased from Santa Cruz Biotechnology, Inc., Abcam, Inc., or Cell Signaling Technology, Inc.) with the membranes at 37 °C for 45 min. The membranes sufficiently was washed and then appropriate secondary antibodies with the membranes were incubated at 37 °C for 45 min. The membranes were washed four times with Tris-buffered saline-Tween 20 (TBST) at room temperature for 14 min each. The membranes on ECL-enhanced chemiluminescence (ECL kit, Pierce Biotechnology, Rockford, IL, USA) were exposed to visualize the immunoreactive proteins.

2.9. Hematoxylin and eosin staining

The 4 % paraformaldehyde and paraffin were used to fix the all samples after dehydration. The thin slices were cut at 4 μm thickness on a paraffin-sectioning machine and attached the slices to slides. The sections were dewaxed using xylene, which we dehydrated using an ethanol gradient. The hematoxylin solution was added for staining for 5 min at room temperature. Then ethanol fractionated with 1 % hydrochloric acid was used for incubation for 30 s. The light ammonia was used to return the blue color for 1 min and then we rinsed with distilled water for 5 min. Subsequently, the eosin staining solution was added at room temperature and incubated for 2 min. Next, we rinsed with distilled water for 2 min and then performed ethanol gradient decolorization. The neutral gum was used to seal the slides.

2.10. Immunofluorescence staining

All samples were immersed in 4 % paraformaldehyde (Sigma-Aldrich) at room temperature for 30 min. The tissue in an ethanol gradient were dehydrated and embedded them in paraffin. Then, the tissue was sectioned (thickness = 6 μm) and deparaffinized by immersion in xylene. The immunohistochemical blocking solution (Beyotime Biotechnology Co., Ltd., Zhejiang, China) was used to block the tissue sections for 30 min at 37 °C. After the blocking solution being discarded, the sections were washed three times using immunohistochemical washing solution (Beyotime Biotechnology Co., Ltd.) at room temperature for 5 min each. Then, the primary antibodis (Rabbit anti-Tyrosine Hydroxylase (TH, E2L6M) Antibody (#58844), Rabbit anti-PGAM5 (Long Isoform) Antibody (#24584), Rabbit anti-ChAT (E4F9G) Antibody (#27269), Mouse anti-Ki67 (8D5) Antibody (#9449), Mouse anti-β3-Tubulin (TUJ, TU-20) Antibody (#4466), Mouse anti-NeuN (E4M5P) Antibody (#94403), Mouse anti-Zic4 (RY-6) Antibody (sc-101202), Mouse anti-GAPDH Antibody (ab8245), all antibodies were purchased from Santa Cruz Biotechnology, Inc., Abcam, Inc., or Cell Signaling Technology, Inc.) were added for incubation for 45 min at 37 °C. The antibodies solution were discarded and the immunohistochemical cleaning solution (Beyotime Biotechnology Co., Ltd.) was added. The solution was incubated three times at room temperature for 5 min. After the appropriate secondary antibodies being added, the solution was incubated for 45 min at 37 °C. The antibody solution was discarded and the sections were washed on three times with immunohistochemical cleaning solution (Beyotime Biotechnology Co., Ltd., Zhejiang, China) for 5 min at room temperature. Last, to seal the sections, the immunofluorescence blocking solution (Sigma-Aldrich, St. Louis, USA) was added.

2.11. Reduced-representation bisulfite sequencing (RRBS-Seq)

Each group of samples were lysed in DNA lysis buffer (0.5 % SDS, 0.1 M EDTA, 10 mM Tris-HCl pH 8.0, and 100 ng/mL Proteinase K, all from Sigma-Aldrich) and incubated for 2 h at 55 °C. The manufacturer’s instructions for the Mammalian genomic DNA extraction and purification kit (Beyotime Biotechnology Co., Ltd., Zhejiang, China) was used to purify the genomic DNA. To analyze the degree of DNA degradation and the presence of RNA contamination, the PCR detection of the genomic DNA in each group was also conducted. The 12 g/L ethidium bromide-containing agarose gel electrophoresis with 1 × Tris Acetate EDTA (TAE) buffer were used to separate the PCR products. Then UV illumination was used for visualization. A Qubit fluorometer was used to accurately quantify the DNA concentration. Then, the methylation-sensitive restriction enzyme, MspI, was used to enzymatically cleave the DNA samples with suitable quantity and quality. The enzymatically cleaved DNA fragments were end-repaired, A-tailed, and ligated to sequencing junctions in which all cytosines were methylated and modified. The DNA fragments with insert lengths between 150 and 300 bp for cutting glue was selected. The bisulfite treatment (EZ DNA Methylation Gold Kit, (Zymo Research, Irvine, CA, USA) was subsequently performed. To obtain the final DNA library we performed PCR amplification. The Qubit 2.0 (Thermo Fisher Scientific) was subsequently performed, diluted to 1 ng/μL, to initially quantify the libraries and used an Agilent 2100 instrument (Agilent, Santa Clara, CA, USA) to detect the insert length of the library. For the libraries with a suitable insert length, the effective concentration was accurately quantified using qPCR (effective library concentration >2 nM). After the different libraries based on their effective concentrations being pooled and the required target data volume, it sequenced them according to the Illumina HiSeq method (Illumina, San Diego, CA, USA).

2.12. Bisulfite conversion of genomic DNA and methylation-specific PCR (MS-PCR)

Each group of samples were lysed in DNA lysis buffer (0.5 % SDS, 0.1 M EDTA, 10 mM Tris-HCl pH 8.0, and 100 ng/mL Proteinase K, all from Sigma-Aldrich) and incubated for 2 h at 55 °C. The manufacturer’s instructions for the EZ DNA Methylation™ Kit (Zymo Research) was used to process the genomic DNA. The PCR detection of the genomic DNA in each group was also conducted. The 12 g/L ethidium bromide-containing agarose gel electrophoresis with 1 × Tris Acetate EDTA (TAE) buffer were used to separate the PCR products. Then UV illumination was used for visualization.

2.13. Statistical analysis

Each experiment was performed at least three times and reported values as the mean ± standard error, where applicable. The Student's t-test was used to evaluate differences (p < 0.05 indicated statistical significance).

3. Results

1. The proliferation of mouse brain organoids in vitro is inhibited and subcellular organelle damage is promoted with rotenone.

The NE-4C cell line is derived from C57Bl/Sv129 mice with p53 gene knockout, which were isolated from embryonic brain vesicles on the 9th day and were established stable cell lines in vitro. This cell line has the typical characteristics of neural stem cells and can differentiate into neuron and astrocyte-like cells under the induction of retinoic acid. When the cell is undifferentiated, it displays a clone like structure in embryonic stem cell like form and grows adherently. The proportion of BrdU + cells in the control group was significantly higher than in the rotenone-treated mouse brain organoids group (Fig. 1A). According to the flow cytometry results shown in Fig. 1B, the proportion of apoptotic cells in the control group was significantly lower than in the rotenone-treated mouse brain organoids group. According to the biochemical assay results, MDA in mouse brain organoids increased significantly because of rotenone (Fig. 1C); but compared with the control group, GSSG, total (T)-GSH, and ATP were significantly lower (Fig. 1C). According to the hematoxylin and eosin staining results, we found that the control group had multiple neuron-like cells in the clonogenic spheres of the mouse brain organoids. Fig. 1D shows that these cells had bulging, large, and deeply stained nuclei as well as multiple cellular synapses. In the group treated with rotenone, we observed atrophied neuronal cells that had indistinct nuclei and vacuole-like structures, which indicated significant cell death (Fig. 1D). Electron microscopy also showed that the mitochondria of the mouse brain organoids in the rotenone-treated group were significantly damaged, including swelling, deformation, vacuolation, and blurred inner ridge. The nuclei were atrophied and deformed, with loss of nucleoli, and the nuclear membrane was swollen, thickened, and ruptured (Fig. 1E). As shown in Fig. 1E, we also found that the proportion of abnormal subcellular organelles in the mouse brain organoids in the control group was significantly lower than that in the rotenone-treated group. According to the qRT-PCR results, the expression levels of several DNA damage repair genes were significantly lower in the control group than in the rotenone-treated mouse brain organoids. This finding showed that rotenone induced DNA damage and interfered significantly with DNA stability. These results verified that rotenone promoted subcellular organelle damage, inducing cell death, and significantly inhibited the proliferation of mouse brain organoids in vitro.

Fig. 1.

Rotenone inhibits the proliferation of mouse brain organoids in vitro and promotes subcellular organelle damage A. BrdU incorporation assay indicating that rotenone inhibits the proliferation and cytokinesis of mBOs in vitro. **p < 0.01 vs. DMSO; t-test. B. Flow cytometry results indicating the rotenone induces apoptosis in mBOs. **p < 0.01 vs. DMSO; t-test. C. Oxidative stress assay results showing rotenone induced increase in lipid peroxidation as well as decrease in ATP and antioxidant capacity in mBOs. **p < 0.01 vs. DMSO; t-test. D. H&E staining results showing the neuronal morphology in rotenone damaged mBOs. Magnification is 200 × . a,b,c,d Magnification is 400 × . E. Transmission electron microscopy results showing that rotenone induced subcellular organelle damage in mBOs. **p < 0.01 vs. DMSO; t-test. F. Heat map of mRNA expression levels of DNA mismatch repair genes within each group of mBOs. G. qRT-PCR results showing that rotenone induces high expression of DNA mismatch repair genes within mBOs.

2. DNA hypermethylation modification in mouse brain organoids gene bodies is promoted with rotenone.

To identify differences in genomic DNA methylation modifications between the two groups, we used RRBS-Seq. The sequencing results showed that, between the two groups of organoids, a total of about 3860 differentially methylated regions (DMR) were identified (Fig. 2A). Most of the DMRs in the control group were hypomethylated. In the rotenone-treated mouse brain organoids group, however, most of the DMRs were highly methylated. The statistical results of DMR methylation distribution levels are shown in Fig. 2B. Analysis of the genomic structural element regions revealed that the gene body DMRs in the rotenone-treated mouse brain organoids group were highly methylated (exon, intro, and 2 kbp downstream (down2k)) compared with those in the control group (Fig. 2C). Statistical analysis revealed that the two groups of rotenone-treated mouse brain organoids shared 70 fragments with hypermethylated DMRs (Diff >0.25) and 7 fragments with hypo(de)methylated DMRs (Diff ≤0.25) (Fig. 2D; Supplementary Table S1). These experimental results suggest that rotenone promoted DNA hypermethylation of mouse brain organoids gene bodies.

Fig. 2.

Analysis of RRBS-Seq results A. Statistical results of differences in DMR methylation levels in each group of samples. B. Cluster heat map showing DMR methylation levels for each group of samples. C. Comparison of the differential levels of methylation modifications of genomic structural elements. D. Results of intra/intergroup statistical analysis of Gene body differentially methylated modified genes. E. GO analysis showing the biological functional taxonomic groups in which gene body hypermethylated modifications are located in each group of samples.

Subsequently, the gene ontology (GO) analysis showed that the genes with hypermethylated gene bodies were associated with two biological_process classifications (i.e., cellular process and metabolic process), with cellular_component classification for cellular anatomical entity; with binding, catalytic activity in molecular_function; and with gene-specific transcriptional regulator and metabolite interconversion enzyme in protein_class (Fig. 2E). The methylation signal visualization of genes in the gene-specific transcriptional regulator and metabolite interconversion enzyme groups in the protein_class classification revealed that the gene bodies of the genes encoding metabolic regulatory enzymes, including PGM5 (phosphoglucomutase 5), HS3ST4 (heparan sulfate-glucosamine 3-sulfotransferase 4), CAMTA1 (calmodulin binding transcription activator 1), ZIC4 (Zic family member 4), and other transcription factors were hypermethylated. The rest of the genes, however, did not have significant hypermethylation (Fig. 3A). Finally, the qRT-PCR results showed that the expression levels of Odc1 (encoding ornithine decarboxylase 1), Esrrg (encoding estrogen related receptor gamma), Pgm5, Mpped1 (encoding metallophosphoesterase domain containing 1), and other genes encoding metabolic regulatory-related enzymes were significantly decreased in rotenone-treated mouse brain organoids compared with those in the control group (Fig. 3B). In addition, compared with those in the control group, in the rotenone-treated mouse brain organoids, the mRNA expression levels of Foxo6 (encoding forkhead box O6), Nkx6-2 (encoding NK6 homeobox 2, Camta1, Nr5a1 (encoding nuclear receptor subfamily 5 group A member 1), and Zic4 genes encoding transcription factors were significantly reduced (Fig. 3B). In addition, cell immunofluorescence staining indicated that both cholinergic and dopamine-like neurons (choline O-acetyltransferase (ChAT)+/anti-beta-tubulin III antibody (TUJ1)+) and tyrosine hydroxylase (TH)+/TUJ1+) were treated in the rotenone-treated mouse brain organoids. As shown in Fig. 4, the levels of Ki67 protein (a marker of cell proliferation and division) as well as CAMTA1, NR5A1, and ZIC4 were significantly lower than the control group. By combining the RRBS-Seq and qRT-PCR detection results, we found that the hypermethylation of the gene bodies of Zic4, Pgm5, and Camta1 was consistent with their mRNA and protein expression levels.

Fig. 3.

Expression levels of genes contained in gene-specific transcriptional regulator and metabolite interconversion enzyme protein families A. Results of visual analysis of DMR gene methylation modification sites. B. qRT-PCR detection of mRNA expression levels of hypermethylated genes in each group of mBOs. **p < 0.01 vs. DMSO; t-test.

Fig. 4.

Cellular immunofluorescence staining A. Results of immunofluorescence staining of cells. Magnification, 200 × . B. Statistical results of the proportion of positively stained cells. **p < 0.01 vs. DMSO; t-test.

3. Silencing Zic4 expression impaired the proliferative activity of mouse brain organoids.

The nucleic acid sequences of the Pgm5 and Camta1 gene promoters were predicted using the bioinformatics tool Algorithmics and Genetics Group (ALGGEN; https://alggen.lsi.upc.es/home.html). The prediction results suggested the presence of multiple binding motifs for the transcription factor ZIC1 in the promoter regions of Pgm5 and Camta1 (Fig. 5A). Subsequently, using the Tomtom Motif Comparison Tool (Version 5.5.0; https://meme-suite.org/meme/tools/tomtom) tool, we obtained the ZIC4-binding motif sequences on the promoters of Pgm5 and Camta1genes, namely A(C/G)(C/G)T (Fig. 5B). A small interfering RNA (siRNA) was used to silence the expression of endogenous Zic4 in mouse brain organoids to detect the effects of ZIC4 on mouse brain organoids and the regulatory effects of ZIC4 on Pgm5 and Camta1. According to the MTT assay, in vitro, inhibition of the proliferation of the control group was significantly lower than the siRNA-Zic4-transfected mouse brain organoids group (Fig. 5C). Western blotting results showed that the siRNA-Zic4-transfected mouse brain organoids had significantly lower levels of ZIC4, PGM5, and CAMTA1 compared with those in the control group (Fig. 5D). Therefore, the experimental results indicated that silencing Zic4 decreased the expression levels of PGM5 and CAMTA1 and weakened the proliferation ability of the mouse brain organoids.

Fig. 5.

Silencing Zic4 expression impairs the proliferative activity of mouse brain organoids A. Bioinformatic analysis revealing ZIC4 binding sites on the promoters of the Pgn5 and Camta1 genes. B. Bioinformatic analysis shows tZIC4 binding to motifs. C. MTT assay results suggest that silencing Zic4 expression significantly increases the proliferation inhibition of mBOs in vitro. **p < 0.01 vs. siRNA-Mock; t-test. D. Western blotting results showing that silencing the expression of Zic4 significantly reduces the protein levels of PGM5. *p < 0.05 vs. siRNA-Mock; t-test. **p < 0.01 vs. siRNA-Mock; t-test.

4. Codonopsis pilosula polysaccharide improves cytotoxicity and DNA methylation of mouse brain organoids.

The results of the MTT assay showed that, in vitro, the inhibition of cell proliferation was significantly lower in the mouse brain organoids treated with rotenone combined with Codonopsis pilosula polysaccharide (Rot + CpP) than in the rotenone-only group (Rot + DMSO), and proliferation correlated positively with the Codonopsis pilosula polysaccharide treatment time (Fig. 6A). Flow cytometry revealed that the cell cycle in the Rot + Codonopsis pilosula polysaccharide cells was significantly more active than in the Rot + DMSO group, and their percentage of S-phase cells was significantly higher than that of the Rot + DMSO group (Fig. 6B). The biochemical assays indicated that the levels of T-GSH and GSSG were significantly higher in the Rot + Codonopsis pilosula polysaccharide group than in the Rot + DMSO organoids (Fig. 6C). The MS-PCR results showed that in the Rot + DMSO group, the methylation primers for three gene bodies, Zic4, Pgm5, and Camta1, produced positive bands by PCR. In the Rot + Codonopsis pilosula polysaccharide group, however, the methylation primers for these genes did not produce positive PCR products (Fig. 6D). Western blotting and qPCR also indicated that the expression levels of PGM5 and ZIC4 were significantly lower in the control Rot + DMSO group than in the Rot + Codonopsis pilosula polysaccharide group (Fig. 6E and F). Therefore, these findings suggested that Codonopsis pilosula polysaccharide promoted the transcription and expression of Zic4 and Pgm5 by inducing their demethylation and weakened the cytotoxicity of rotenone toward mouse brain organoids.

Fig. 6.

Codonopsis pilosula polysaccharide ameliorates the cytotoxicity and DNA methylation of rotenone on mouse brain organoids A. Results of MTT cell proliferation inhibition assay. **p < 0.01 vs. Rot + DMSO; *p < 0.05 vs. Rot + DMSO; t-test. B. Cell cycle flow cytometry assay results. **p < 0.01 vs. Rot + DMSO; t-test. C. Results of biochemical assays of the T-GSH and GSSG content. *p < 0.05 vs. Rot + DMSO; t-test. D. MS-PCR assay results. **p < 0.01 vs. Rot + DMSO; t-test. E. qRT-PCR results of three genes, Zic4, Pgm5, and Camta1. **p < 0.01 vs. Rot + DMSO; *p < 0.05 vs. Rot + DMSO; t-test. F. Western blotting assay for ZIC4 and PGM5 protei levels. **p < 0.01 vs. Rot + DMSO; t-test.

4. Discussion

Rotenone is an insecticide used to kill snails and catch ornamental fish [8]. Rotenone was initially considered safe for use in agriculture and was not believed to affect humans, the environment, or animals. Later studies, however, found rotenone to be highly toxic to fish, livestock, silkworms, and rodents, especially reproductive toxicity and neurotoxicity [[3], [4], [5], [6], [7]]. In a previous study, we showed that the transcriptional activity of target genes, in addition to the covalent modification of dopamine neuron histones in mice, is affected by rotenone [10]. In-depth systematic study data, however, have yet to be reported.

In this study, we used mouse brain organoids, which are similar to mouse brain tissue, as the study subjects. Because mouse brain organoids differentiate into a variety of neuron-like cells, they are useful to evaluate the neurotoxicity of rotenone. High-throughput sequencing revealed that rotenone induced hypermethylation modifications in mouse brain organoids, and the level of gene body-DMR methylation was significantly higher than in other gene structural elements. Thus, rotenone mainly stimulated hypermethylation of CpG islands in gene bodies. This was different from the effect of other chemotherapeutic drugs and gene methylation agonists [[42], [43], [44]]. Genomic DNA methylation occurs most often in the promoter regions of genes on CpG islands [[42], [43], [44]]. The promoter is important for the transcriptional activation of a gene; therefore, promoter methylation can significantly inhibit the transcriptional activation and expression of the gene [[42], [43], [44]]. In the present study, however, rotenone induced hypermethylation of gene body-DMRs in most genes. DNA methylation modifications are catalyzed by the methyltransferases DNMT1, DNMT3a, DNMT3b, and MeCP2 [[42], [43], [44]]. The enzymes catalyze only the cytosine 5 carbon position of genomic CpG dinucleotides to the biochemical process of covalent bonding of a methyl group. They do not show a clear preference for the recognition of the gene body structure, and the DNMT1 and DNMT3a/b gene families do not have specificity for the CpG dinucleotide sequence [[42], [43], [44]]. Interestingly, however, the majority of rotenone-induced genetic DNA hypermethylation modifications are located in gene bodies.

This study also investigated the protective effects and in-depth molecular biological mechanisms of the active substance of the Chinese medicine Codonopsis pilosula polysaccharide, also known as Dang Shen polysaccharide, against rotenone-treated neural-like organs. There have been several reports on Codonopsis pilosula and Codonopsis pilosula polysaccharide in terms of their antioxidant, anti-aging, immunomodulatory, and neuroprotective activities [[12], [13], [14], [15], [16], [17]]. There are few reports, however, on whether Codonopsis pilosula polysaccharide is able to regulate epigenetic modifications in the body. In this study, we found that Codonopsis pilosula polysaccharide significantly alleviated rotenone-induced cytotoxicity and protected against neuronal-like organ damage. This result was in agreement with previous reports [13,15]. Several reports have indicated that many of the protective effects of Codonopsis pilosula polysaccharide on neurons act by suppressing glial cell inflammation; promoting the expression of longevity genes, such as Sirt family genes; alleviating neuronal aging; or regulating the ratio and activity of T cell subsets, such as regulatory T cells (Tregs) and T helper cells (Th1/2/17) [[13], [14], [15],17]. Whether or not Codonopsis pilosula polysaccharide can target the regulation of epigenetic gene modifications is unknown. This study demonstrated that Codonopsis pilosula polysaccharide could regulate epigenetic DNA modifications. It removed hypermethylated modifications from three gene bodies (Zic4, Pgm5, and Camta1), thereby restoring their transcription and expression. This could be another important molecular mechanism by which Codonopsis pilosula polysaccharide maintains the normal physiological and biochemical activity of neurons. In summary, the environmental toxin rotenone caused damage to brain-like organoids by inducing gene body hypermethylation. Codonopsis pilosula polysaccharide, however, reduced the cytotoxicity of rotenone toward mouse brain organoids by inducing Zic4 and Pgm5 gene body demethylation, thereby promoting their transcription and expression.

CRediT authorship contribution statement

Haiyang Chen: Methodology. Yichao Wen: Methodology. Zhihua Yu: Methodology. Xiling Du: Methodology. Weidong Pan: Writing – review & editing, Writing – original draft, Project administration, Methodology. Te Liu: Writing – review & editing, Writing – original draft, Project administration, Methodology, Investigation, Funding acquisition.

Declaration of competing interest

We declared no potential conflicts of interest.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

figs1.

Data availability

No data was used for the research described in the article.