Abstract
Background : Ziziphus jujube Mill. belongs to the Rhamnaceae family. It has been reported to have a variety of biological activities such as antitumor, antioxidant, and anti-inflammatory effects. This study investigates the antiproliferative effect of Ziziphus jujube on KG-1 and NALM-6 acute leukemia cell lines.
Materials and Methods : In this experimental study, the aqueous, ethyl acetate, and hydroalcoholic extracts of the Ziziphus jujube were prepared. Total phenolic and flavonoid components were detected because the presence of these compounds is associated with antioxidant and anticancer effects. Different concentrations of extracts were prepared, and KG-1 and NALM-6 cell lines were treated with them at 12, 24, 36, and 48 hours. Cell viability and IC50 values of the extracts were calculated using MTT assays. BD Cycle TEST PLUS DNA Kit was used for cell cycle progression analysis. Bcl2, Bax, and caspase-3 mRNA expressions were also assessed.
Results : Cell viability decreased in a concentration-dependent manner. The best efficacy belonged to the ethyl acetate extract. Investigation of cell cycle progression demonstrated that the number of G0/G1 cells enhanced and the number of G2/M cells decreased when the ethyl acetate extract was applied in its IC50 concentration. A considerable increase in Caspase-3 and Bax and a decrease in Bcl2 gene expression were detected in molecular examination.
Conclusion : According to our research, Ziziphus jujube ethyl acetate extract has antitumor properties on KG-1 and NALM-6 cell lines, possibly through induction of apoptosis and cell cycle regulation.
Key Words: Ziziphus jujube, Acute leukemia, KG-1, NALM-6, Cell cycle, Caspase-3, Proto-oncogene proteins, c-bcl-2, Bax
Introduction
Acute leukemia is a large group of leukemia. Based on the cellular manifestations of primary stem cell defects on the maturation and differentiation of common myeloid precursors or common lymphoid precursors, they are divided into two categories: acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL) 1 . ALL is a hematologic disorder associated with the malignant proliferation of cancer cells and the accumulation of immature and malfunctioning hematopoietic cells in the bone marrow. This disorder is due to somatic acquired genetic mutation in lymphoid precursor in one of the maturation stages, leading to the formation of malignant clones. These cells exhibit a high capacity for self-renewal and resistance to apoptosis due to the cessation of differentiation that prevents them from developing into adult cells1. This neoplasm is not common in adults and is more common in men than women. In children, it is responsible for 30% of all cancers and 80% of all leukemia. Therefore, it is more common in children, with a peak prevalence of 2 to 5 years. Survival rates are higher in children than in adults 2 .
The essential characteristics of AML include the ability for continuous proliferation and maturation arrest. High cell proliferation can be the result of mutations in growth factors, growth factor receptors, messenger pathway components, and transcription factors that affect the genes involved in cell survival and proliferation. More than half of AML cases have cytogenetic abnormalities, most of which are balanced bilateral chromosomal translocations at the locus of transcription factor genes1. AML is the most common cause of acute leukemia during the first few months of life. However, it is responsible for only about one-third of acute leukemia cases in childhood and adolescence (15-20% of acute leukemia) 3,4 . Treatment for this type of leukemia usually involves chemotherapy drugs and monoclonal antibodies. One type of these drugs is purine analogs such as fludarabine, which inhibits DNA synthesis, repairs, and activates the apoptotic pathway. At present, the optional treatment of leukemia is bone marrow transplantation5. The utilization of medicinal plants to treat various diseases, particularly cancer, has witnessed a rise in recent years. This trend is driven by the cost-effectiveness and improved accessibility of medicinal plants and the desire to mitigate the adverse effects of chemotherapy drugs6,7.
Ziziphus jujube Mill. (Z. jujube) is a medicinal plant with many uses. It belongs to the Rhamnaceae family and contains various chemical constituents, including triterpenic acids, flavonoids, saponins, and alkaloids, among others. It is reported to have a variety of biological activities such as antitumor, antioxidant, and anti-inflammatory effects. Many studies have shown that Z. jujube exerts anticancer activities on several tumor cell lines 8-19. Z. jujube extract inhibits the growth of HeLa cervical cancer cells and decreases the growth of A549 lung cancer cells (Suk-Hyun Choi et al., 2012) 9 . Chloroform fraction from Z. jujube has anticancer activities in human liver cancer cells (X Huang et al., 2009) 10 . This extract reduces the viability of Hela and MAD-MB-468 cells significantly and concentration-dependently (Abbas Jafarian et al., 2014) 11 . Z. jujube delays colon cancer progression (Srinivasan Periasamy et al., 2015) 12 . Z. jujube water extract induces apoptosis in HEp-2, HeLa, and Jurkat cell lines (Fatemeh Vahedi et al., 2008) 13 . It has a cytotoxic effect on the HEp-2 cell line 14-16. Z. jujube fruit extracts exert antiproliferative and apoptotic effects in human breast cancer cells 17. It can be useful in colorectal cancer treatment (Xiaolong Ji et al., 2020) 18 and induce apoptosis cell death in human cancer cells through mitochondrial reactive oxygen species production 19 .
The present study aimed to evaluate the antiproliferative effects of Z. jujube on KG-1 and NALM-6 cell lines since no article was found to have investigated the effect of Z. jujube on these cell lines. We also aimed to study the cell cycle progression and caspase-3, Bcl2, and Bax gene expression under the influence of Z. jujube. If this substance demonstrates positive outcomes in animal studies and clinical trials, it may serve as a supplementary treatment to chemotherapy drugs.
MATERIALS AND METHODS
Cell culture
NALM-6 and KG-1 acute leukemia cell lines (ALL and AML, respectively), which were provided by (the Pastor Institute of Iran,) were grown and subcultured in RPMI1640 containing 20 mM HEPES-buffer and 1% GlutaMAX (Biosera, France) supplemented with 10% heat-inactivated FBS (fetal bovine serum) (Gibco, USA) and 100 µg/ml penicillin/streptomycin (Biosera). The cultures were incubated at 37◦C with 5% CO2 and 95% humidity. The medium was changed every 2-3 days.
Preparation of extracts
At first, the dried jujube kernels were separated, and the remainder of the fruit was pulverized to obtain a homogeneous powder. In order to prepare an aqueous extract, 50 grams of the powder was weighed and macerated in boiling distilled water for 30 minutes. The mixture was filtered, and then the samples were lyophilized. The dried aqueous extracts were subsequently diluted in RPMI medium and prepared at different concentrations 22 . One hundred grams of dried powder was extracted by 300 ml of ethyl acetate using the maceration method. The residue was subjected to more extraction using 300 ml of 60% methanol to prepare hydroalcoholic extract 11 . The extracts from each step were filtered and transferred to a rotary balloon (Heidolph, Germany) and concentrated at 100 rpm at 40°C.
Total phenol assay
Three test tubes were prepared for each extract; 1 ml of the extract with a concentration of 1 mg/ml was added to each tube, followed by 1.5 ml of folin-ciocalteu's phenol reagent (1%). After 10 minutes, 1.5 ml of sodium bicarbonate (7%) was added to each tube, and the tubes were kept in the dark for 30 minutes. Moreover, a blank tube was prepared containing 1 ml of methanol, 1.5 ml folin-ciocalteu's phenol reagent, and 1.5 ml of sodium bicarbonate. After 30 minutes, the samples were transferred to special cuvettes and read at 765 nm with a spectrophotometer. Gallic acid solutions with concentrations of 6.25, 12.5, 25, 50, 100, and 200 μg / ml were prepared in methanol solvent to draw the gallic acid standard curve. 1.5 ml of the folin-ciocalteu's phenol reagent solution was added in two stages to 200 μl of the gallic acid solutions and the sample separately. After 5 minutes, 1.5 ml of sodium bicarbonate solution was added to the above mixtures. The absorbance of the samples was read after 2 hours by a spectrophotometer at 760 nm. The adsorption diagram was plotted against the gallic acid concentration, and the line equation was obtained. Once the gallic acid calibration curve was plotted, the amount of total phenol in the extract was calculated by placing the extract's adsorption value in the linear equation of the standard curve 23 .
Total flavonoid assay
This is a colorimetric method using aluminum chloride. Three test tubes were prepared for each extract. First, 0.5 ml of the extract and 150 μl of sodium nitrite were added to each tube. After 6 minutes, 150 μl of aluminum chloride was added to all tubes. After six minutes, 2 ml of sodium bicarbonate was added, and the total volume of the test tube was increased to 5 ml. Lastly, distilled water was used to increase the volume. Simultaneously with the preparation of these three tubes, a blank tube was also prepared, which contained 0.5 ml of methanol, 150 μl of sodium nitrite, and 2 ml of sodium bicarbonate. The blank was prepared following all necessary time steps. The absorbance of the samples was recorded at 510 nm using a spectrophotometer.
Quercetin was used to draw the standard curve, and the results were expressed in mg of quercetin equivalent per gram of extract. At first, standard solutions with a concentration of 0-500 μg/ml quercetin in absolute methanol were prepared. It was subsequently added to 0.2 ml of plant extract or 0.2 ml of aluminum chloride solution plus 0.1 ml of 33% aqueous acetic acid and mixed well. Finally, the mixture volume was increased to 5 ml with 90% ethanol, and the tubes were kept at room temperature for 30 minutes. Their optical absorption at 510 nm was read, and the total flavonoids were obtained using a standard curve 23 .
MTT assay
In order to check cell viability, the 3-(4, 5-dimethylthiazol-2-yl)-2, 5 di-phenyl tetrazolium bromide (MTT) assay was used. The cells were seeded at a concentration of 1×106 cells/well in a 96-well plate. Both cell lines were treated with aqueous, methanol, and ethyl acetate extracts of the Z. jujube at 0.125, 0.25, 0.5, and 1 mg/ml concentrations for 12, 24, 36, and 48 h. Following 4h incubation with 50µl MTT (Sigma, USA), the supernatant was removed, and 100μl DMSO (Sigma-Aldrich, USA, Biologic Grade) was added to dissolve MTT. After 15 minutes of incubation, the OD was read with an ELISA plate reader (BioTek ELx808, USA) at 492 nm. The assay was performed at least three times. The viability percentages of each cell line and IC50s of all extracts were calculated using the Excel 2013 software. The optimum time and the best IC50s were considered for further analysis.
Cell cycle analysis
For cell cycle analysis, tumor cell populations were exposed to the extract and subsequently stained with propidium iodide using BD Cycle TEST PLUS DNA Kit (BD Biosciences); flow cytometry was then performed with a BD FACS Calibur Flow Cytometry Machine (BD Biosciences, USA). Data were collected
using BD Cell FIT software, and cell cycle progression was analyzed using the ModFit software (BD Biosciences). The number of cells gated in each phase was reported as %.
RT-PCR
RT-PCR was performed to identify Bcl2, Bax, and caspase-3 gene expressions. For this purpose, the cells were collected after 48 hours of treatment with the extract that had the best IC50 value on the MTT test, and their total RNA was extracted using the Trizol (Qiagen, Germany) method. Then, according to the manufacturer's instructions, 1µg total RNA was converted to cDNA using the PrimeScript 1st strand cDNA Synthesis kit (Takara, Japan). RQ-PCR assay was performed to investigate the level of Bcl2, Bax, and caspase-3 gene expression in drug-treated and control groups using primers in Table 1. β-2 microglobulin (B2M) was used as a housekeeping gene for normalization of RT-qPCR data. It should be noted that all tests were performed in triplicate. The fold change Bcl2, Bax, and Casp3 mRNA in treated cells in comparison with untreated cells was computed by the 2-ΔΔCT method.
Table 1.
Bcl2, Bax, caspase-3, and β-2 microglobulin primers
| Gene | Primer(5′-3′) |
PCR product size
(bp) |
|---|---|---|
| Casp3 (Forward) Casp3 (Reverse) |
TCTGGTTTTCGGTGGGTGTG CGCTTCCATGTATGATCTTTGGTTC |
137 |
| B2M (Forward) B2M (Reverse) |
CTCCGTGGCCTTAGCTGTG TTTGGAGTACGCTGGATAGCCT |
69 |
| Bcl2 (Forward) Bcl2 (Reverse) |
CTGCACCTGACGCCCTTCACC CACATGACCCCACCGAACTCAAAGA |
119 |
| Bax (Forward) Bax (Reverse) |
GTGCACCAAGGTGCCGGAAC TCAGCCCATCTTCTTCCAGA |
205 |
Statistical analysis
All experiments were performed in duplicate and repeated three times. The data were expressed as mean±SD for all experiments. IC50 value was calculated using the Excel 2013 software, and cell cycle analysis was done using the BD Cell FIT software. GraphPad Prism 5.0 (GraphPad Software, Inc., San Diego, CA) was used to detect the significant differences between the control and treated groups. Statistical significance levels were defined at *P<0.05, **P<0.01, and ***P<0.001 compared to the corresponding controls.
Results
Calculation of different IC 50 extracts and cell viability using the MTT assay
Based on the cell treatments with the Z. jujube's aqueous, hydroalcoholic, and ethyl acetate extracts at 0.125, 0.25, 0.5, 1 mg/ml concentrations for 12, 24, 36, and 48h, the best IC50s belonged to the ethyl acetate extract of the Z. jujube with 48 h treatment in both cell lines.
IC50 values of the aqueous extract were 0.582±1.76 and 8.719±2.87 mg/ml; IC50 values of the hydroalcoholic extract were 0.446±2.36 and 5.337±1.43 mg/ml; and those of the ethyl acetate extract were 0.242±3.12 and 0.665±2.57 mg/ml at 48 h for KG1 and Nalm6 cell lines, respectively (Figure 1). It was shown that cell proliferation was inhibited in a concentration-dependent manner with all extracts (Figure 2).
Figure 1.
Aqueous, hydroalcoholic, and ethyl acetate extract IC50 values for A) KG-1 and B) NALM-6 cell lines at 12, 24, 36, and 48 h, showing that the best IC50 belonged to the ethyl acetate extract of the Z. jujube semen in all three-cell lines with 48 h treatment.
Figure 2.
Effects of Z. jujube's aqueous, methanol, and ethyl acetate extracts on the viability of KG-1 and NALM-6 cells treated with different concentrations of extracts at 48 h (the optimum time). Following the addition of 50 μl of MTT-labeling reagent, the cells were incubated for 4 hours prior to the addition of 100 μl of DMSO solution. The experiments were repeated at least three times. The data represent the mean (± standard deviation, SD) of the three independent experiments, each performed in triplicate and presented relative to the controls: (A) KG-1 and (B) NALM-6. *** represents P<0.001 with respect to the controls.
Cell cycle progression
Z. jujube modulated cell cycle progression dependent on the tumor cell line. Applying ethyl acetate extract to KG-1 increased the number of G0/G1 (P=0.0253) cells and reduced the number of G2/M cells (P=0.0171). In NALM-6 cells, the number of G0/G1-phase cells increased (P=0.0228), but the number of cells in the G2/M-phase decreased (P=0.0437) compared to the controls (Figure 3).
Figure 3.
Cell cycle analysis of A) KG-1 and B) NALM-6 cultures pretreated with Z. jujube at 48 h (Controls remained untreated). The cell population is expressed as a percentage of the total cells analyzed. One representative experiment of the three is shown.
Effect of the ethyl acetate extract of Z. jujube on Bcl 2 , Bax, and caspase3 gene expression
Molecular examination 48 hours after the treatment of KG-1 and NALM-6 cell lines revealed a significant
increase in Bax and caspase-3 mRNA expression and a noticeable reduction in Bcl2 mRNA in test samples compared to the controls (Figures 4-6).
Figure 4.
RT-PCR analysis results of the mRNA levels of Bax. The following formula was used to calculate the fold change. Fold difference = 2-ΔΔCt . Results showed a significant increase in Bax mRNA expression. P<0.05 in KG-1 and P<0.01 in NALM-6 cell lines, respectively.
Figure 5.
RT-PCR analysis results of the mRNA Levels of Bcl-2. The following formula was used to calculate the fold change. Fold difference = 2-ΔΔCt. A noticeable decrease was detected in Bcl2 mRNA in test samples compared to the control group. P<0.01 in both KG-1 and NALM-6 cell lines.
Figure 6.
RT-PCR analysis results of the mRNA levels of caspase3. The following formula was used to calculate the fold change. Fold difference = 2-ΔΔCt. A significant increase was observed in caspase3 mRNA expression. P<0.05 in both KG-1 and NALM-6 cell lines.
Secondary metabolites measurement
Based on the results of the MTT test, the best IC50 was related to the ethyl acetate extract. Phenolic compounds are known to possess antioxidant and anticancer properties. Therefore, it is plausible to expect the presence of phenolic compounds in ethyl acetate fractions. For this reason, this fraction was measured for phenolic and flavonoid compounds.
After determining the adsorption of the samples, using the equation obtained from the standard curves, the total phenolic content equivalent to the amount of gallic acid and the flavonoid content equivalent to the amount of quercetin were calculated. Each experiment was repeated three times, and the results were reported as Mean ± SD. Moreover, the amounts of phenolic compounds (mg of equivalent to gallic acid per gram of sample) and flavonoids (mg of equivalent to quercetin per gram of sample) were obtained.
The ethyl acetate extract contained 151.64 ± 0.03 mg/g of total phenol and 1.21±0.02 mg/g of total flavonoids (Figures 7 and 8).
Figure 7.
Standard curve of absorption against gallic acid concentration. The ethyl acetate extract contains 151.64 ± 0.03 mg/g of total phenol. Y=0.0057X+0.0296; R2 =0.9992
Figure 8.
Standard curve of absorption against quercetin concentration. The ethyl acetate extract contains 1.21±0.02 mg/g of total flavonoids. Y=0.002X+0.007; R2= 0.9946
Discussion
The main purpose of this study was to evaluate the antiproliferative effect of Z. jujube extract on acute leukemia. Accordingly, cell viability, cell cycle progression, and Bcl2, Bax, and caspase-3 mRNA expressions were investigated. Results indicated that cell viability decreased as the extract concentration increased in both KG-1 and NALM-6 cell lines, implying that tumor cell survival was concentration-dependent. The best efficacy belonged to the ethyl acetate extract. The application of ethyl acetate extract of Z. jujube in its IC50 concentration was found to increase the number of G0/G1 cells and decrease the number of G2/M cells, as observed in the investigation of cell cycle progression. The molecular examination 48 hours after treating KG-1 and NALM-6 cell lines revealed a considerable increase in caspase-3 and Bax and a decrease in Bcl2 gene expression compared to the controls.
Natural compounds have garnered significant interest in cancer treatment 20 due to their higher accessibility, lower cost, and potential to mitigate chemotherapy drugs' adverse effects 6,7 . They accomplish this via their capacity to act as antioxidants and to induce apoptosis 21 . Many studies showed that Z. jujube exerts anticancer activities on several tumor cell lines 8-19 .
In the present study, cell viability decreased in both KG-1 and NALM-6 cells in a concentration-dependent manner, as demonstrated by the MTT assay results. Hoshyar et al., in 2015, showed the concentration- and time-dependent inhibitory effect of Z. jujube aqueous extracts on the MDA-MB-468 cell growth 22 . In 2012, Choi et al. demonstrated that all growth stages of Z. jujube inhibited HeLa cervical cancer cells concentration-dependently 9 . Jafarian et al. reported that Z. jujube significantly and concentration-dependently reduced the viability of Hela and MAD-MB-468 cells 11 Z. jujube is shown to have cytotoxic effects on the HEp-2 cell line 14-16 . Moreover, Z. jujube fruit extracts exert antiproliferative and apoptotic effects in human breast cancer cells 17 .
In our study, the cell cycle analysis of KG-1 and NALM-6 after treatment with the IC50 concentration of Z. jujube's ethyl acetate extract showed an increase in the number of G0/G1 cells and a reduction in the number of G2/M cells in both cell lines. In 2009, Huang et al. examined the changes in cell cycle dynamics. Their results showed that CHCl3-F of Z. jujube increased the cell numbers in the G1 cell cycle region 10 . They also found that the CHCl3-F and green tea extract combination effectively induced G1 phase arrest, while it did not induce apoptosis 14 . Huang et al.'s study showed that the application of Z. jujube in the HepG2 cell line would lead to the accumulation of the G1 cell cycle region and a decrease in the S phase, suggesting that the cell cycle was arrested at the G2/M phase 15 . The same results were reported when human hepatoma cells were treated with Z. jujube and green tea extracts 16 . All in all, these findings indicate that Z. jujube can have antitumor properties by regulating cell cycle progression.
In the current study, molecular examination detected a considerable increase in caspase-3 and Bax and a decrease in Bcl2 gene expression compared to the controls 48 hours after KG-1 and NALM-6 cell lines were treated. Similarly, Plastina et al. (2012) observed elevated Bax levels in MCF-7 and SKBR3 breast cancer cells following treatment with Z. jujube extracts, as compared to the control group 17 . Therefore, it can be stated that Z. jujube induces apoptosis by increasing pro-apoptotic proteins and decreasing anti-apoptotic proteins.
Since phenolic compounds are associated with antioxidant and anticancer effects, the ethyl acetate extract of Z. jujube with the best IC50 value in the MTT test was measured for phenolic and flavonoid compounds. The results confirmed the presence of 151.64 ± 0.03 mg/g of total phenol and 1.21±0.02 mg/g of total flavonoids in this extract. Likewise, Choi et al.'s study determined total phenolic and flavonoid content. They pointed out that Z. jujube fruit is a great source of flavonoids. Nonetheless, the maturity, variety, geographic location, soil, and climate environments cause variations in the content of these compounds 9 . In 2015, Jafarian et al. noticed that because of the presence of chemical agents such as alkaloids, flavonoids, terpenoids, saponin, and phenolic compounds, Ziziphus plants are important sources of cytotoxic compounds 11 . Hamood Al-Saeedi et al., in 2016, studied the phenolic content of different Z. jujube extracts. They showed that Z. jujube ethyl acetate extract had the highest content of phenols and flavonoids 23 .
CONCLUSION
According to our study, Z. jujube's ethyl acetate extract contains large amounts of phenolic compounds. The ethyl acetate extract of Z. jujube has been found to possess antitumor properties on KG-1 and NALM-6 cell lines. This is likely due to the presence of phenolic compounds, which are associated with antioxidant properties. The extract appears to induce apoptosis and regulate the cell cycle by increasing the expression of pro-apoptotic proteins, decreasing anti-apoptotic proteins, and promoting cell cycle arrest in the G1 phase while reducing the number of cells in the G2 phase. Among the limitations of this study was that the in vitro effect of extracts and serum antioxidant activity were not investigated. Therefore, it is recommended that future studies focus on the isolation of the effective ingredients of the ethyl acetate extract and evaluate their apoptotic molecular mechanisms in animal and human cancer cell lines.
ACKNOWLEDGMENTS
This research was supported by the School of Allied Medical Sciences, Tehran University of Medical Sciences.
CONFLICTS OF INTEREST
None declared.
References
- 1.William B Ershler, Kenneth Kaushansky, Marshal A Litchtman, Josef T Prchal, Marcel M Levi, Oliver W Press, Linda J Burns, Michael A Caligiuri. Williams Hematology. 9th edn. New York: Mc Graw Hill; 2016. [Google Scholar]
- 2.Bassan R, Gatta G, Tondini C, et al. Adult acute lymphoblastic leukaemia. Crit Rev Oncol Hematol. 2004;50(3):223–61. doi: 10.1016/j.critrevonc.2003.11.003. [DOI] [PubMed] [Google Scholar]
- 3.Richard A McPherson, Matthew R Pincus Henry. Clinical Diagnosis and Management by Laboratory Method. 23nd edn. USA: ELSEVIER; 2017. [Google Scholar]
- 4.Ross ME, Mahfouz R, Onciu M, et al. Gene expression profiling of pediatric acute myelogenous leukemia. Blood. 2004;104(12):3679–87. doi: 10.1182/blood-2004-03-1154. [DOI] [PubMed] [Google Scholar]
- 5.A Victor Hoffbrand, Douglas R Higgs, David M Keeling, Atual B Mehta. Postgraduate Haematology. 7th edn. UK: Wiley Blackwell; 2016. [Google Scholar]
- 6.Fattahi S, Ardekani AM, Zabihi E, et al. Antioxidant and apoptotic effects of an aqueous extract of Urtica dioica on the MCF-7 human breast cancer cell line. Asian Pac J Cancer Prev. 2013;14(9):5317–23. doi: 10.7314/apjcp.2013.14.9.5317. [DOI] [PubMed] [Google Scholar]
- 7.Otles S, Yalcin B. Phenolic compounds analysis of root, stalk, and leaves of nettle. ScientificWorldJournal. 2012;2012:564367. doi: 10.1100/2012/564367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bai L, Zhang H, Liu Q, et al. Chemical characterization of the main bioactive constituents from fruits of Ziziphus jujuba. Food Funct. 2016;7(6):2870–7. doi: 10.1039/c6fo00613b. [DOI] [PubMed] [Google Scholar]
- 9.Choi SH, Ahn JB, Kim HJ, et al. Changes in free amino acid, protein, and flavonoid content in jujube (Ziziphus jujube) fruit during eight stages of growth and antioxidative and cancer cell inhibitory effects by extracts. J Agric Food Chem. 2012;60(41):10245–55. doi: 10.1021/jf302848u. [DOI] [PubMed] [Google Scholar]
- 10.Huang X, Kojima-Yuasa A, Xu S, et al. Combination of Zizyphus jujuba and green tea extracts exerts excellent cytotoxic activity in HepG2 cells via reducing the expression of APRIL. Am J Chin Med. 2009;37(1):169–79. doi: 10.1142/S0192415X09006758. [DOI] [PubMed] [Google Scholar]
- 11.Jafarian A, Zolfaghari B, Shirani K. Cytotoxicity of different extracts of arial parts of Ziziphus spina-christi on Hela and MDA-MB-468 tumor cells. Adv Biomed Res. 2014;3:38. doi: 10.4103/2277-9175.125727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Periasamy S, Liu CT, Wu WH, et al. Dietary Ziziphus jujuba fruit influence on aberrant crypt formation and blood cells in colitis-associated colorectal cancer in mice. Asian Pac J Cancer Prev. 2015;16(17):7561–6. doi: 10.7314/apjcp.2015.16.17.7561. [DOI] [PubMed] [Google Scholar]
- 13.Vahedi F, Najafi MF, Bozari K. Evaluation of inhibitory effect and apoptosis induction of Zyzyphus Jujube on tumor cell lines, an in vitro preliminary study. Cytotechnology. 2008;56(2):105–11. doi: 10.1007/s10616-008-9131-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Huang X, Kojima-Yuasa A, Xu S, et al. Green tea extract enhances the selective cytotoxic activity of Zizyphus jujuba extracts in HepG2 cells. Am J Chin Med. 2008;36(4):729–44. doi: 10.1142/S0192415X08006193. [DOI] [PubMed] [Google Scholar]
- 15.Huang X, Kojima-Yuasa A, Norikura T, et al. Mechanism of the anti-cancer activity of Zizyphus jujuba in HepG2 cells. Am J Chin Med. 2007;35(3):517–32. doi: 10.1142/S0192415X0700503X. [DOI] [PubMed] [Google Scholar]
- 16.Huang X. Mechanism of the growth inhibitory effects of Zizyphus jujuba and green tea extracts in human hepatoma cells: Thesis. Osaka City University, Japan: Department of Food and Human Health Sciences, Graduate School of Human Life Science; 2008. [Google Scholar]
- 17.Plastina P, Bonofiglio D, Vizza D, et al. Identification of bioactive constituents of Ziziphus jujube fruit extracts exerting antiproliferative and apoptotic effects in human breast cancer cells. J Ethnopharmacol. 2012;140(2):325–32. doi: 10.1016/j.jep.2012.01.022. [DOI] [PubMed] [Google Scholar]
- 18.Ji X, Hou C, Gao Y, et al. Metagenomic analysis of gut microbiota modulatory effects of jujube (Ziziphus jujuba Mill.) polysaccharides in a colorectal cancer mouse model. Food Funct. 2020;11(1):163–173. doi: 10.1039/c9fo02171j. [DOI] [PubMed] [Google Scholar]
- 19.Shin M, Lee BM, Kim O, et al. Triterpenoids from Ziziphus jujuba induce apoptotic cell death in human cancer cells through mitochondrial reactive oxygen species production. Food Funct. 2018;9(7):3895–905. doi: 10.1039/c8fo00526e. [DOI] [PubMed] [Google Scholar]
- 20.Rahman MM, Khan MA. Anti-cancer potential of South Asian plants. Nat Prod Bioprospect. 2013;3(3):74–88. [Google Scholar]
- 21.Aboul-Enein AM, El-Ela FA, Shalaby EA, et al. Traditional medicinal plants research in Egypt: Studies of antioxidant and anticancer activities. J Med Plants Res. 2012;6(5):689–703. [Google Scholar]
- 22.Hoshyar R, Mohaghegh Z, Torabi N, et al. Antitumor activity of aqueous extract of Ziziphus jujube fruit in breast cancer: an in vitro and in vivo study. Asian Pac J Reprod. 2015;4(2):116–22. [Google Scholar]
- 23.Al-Saeedi AH, Al-Ghafri MTH, Hossain MA. Comparative evaluation of total phenols, flavonoids content and antioxidant potential of leaf and fruit extracts of Omani Ziziphus jujuba L. Pac Sci Rev A: Nat Sci Eng. 2016;18(1):78–83. [Google Scholar]